Piceatannol as an Antiviral Inhibitor of PRV Infection In Vitro and In Vivo
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells, Materials and Piceatannol
2.2. Determination of Cytotoxicity and Inhibitory Activity
2.3. Effect of Piceatannol on the PRV Life Cycle
2.4. Effects of Piceatannol on PRV Gene Expression
2.5. Apoptosis Analysis
2.6. Assay of the Antiviral Activity of Piceatannol against PRV In Vivo
2.7. Statistical Methods
3. Results
3.1. Cytotoxicity of Piceatannol on PK-15 Cells
3.2. Piceatannol Inhibited PRV Proliferation in PK-15 Cells
3.3. Effect of Piceatannol on the Replication Cycle of PRV
3.4. Inhibitory Effect of Piceatannol on PRV Gene Expression
3.5. Piceatannol Alleviates PRV-Induced Apoptosis
3.6. Piceatannol Inhibits PRV Infection in Mice
3.7. Changes in Cytokine Levels in the Serum of PRV-Infected Mice Treated with Piceatannol
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ferrara, G.; Longobardi, C.; D’Ambrosi, F.; Amoroso, M.G.; D’Alessio, N.; Damiano, S.; Ciarcia, R.; Iovane, V.; Iovane, G.; Pagnini, U.; et al. Aujeszky’s Disease in South-Italian Wild Boars (Sus scrofa): A Serological Survey. Animals 2021, 11, 3298. [Google Scholar] [CrossRef]
- Adnan, A.; Allaudin, Z.N.; Hani, H.; Loh, H.S.; Khoo, T.J.; Ting, K.N.; Abdullah, R. Virucidal activity of Garcinia parvifolia leaf extracts in animal cell culture. BMC Complement. Med. Ther. 2019, 19, 169. [Google Scholar] [CrossRef]
- Liu, Q.; Wang, X.; Xie, C.; Ding, S.; Yang, H.; Guo, S.; Li, J.; Qin, L.; Ban, F.; Wang, D.; et al. A novel human acute encephalitis caused by pseudorabies virus variant strain. Clin. Infect. Dis. 2020, 73, e3690–e3700. [Google Scholar] [CrossRef]
- Wang, D.; Tao, X.; Fei, M.; Chen, J.; Guo, W.; Li, P.; Wang, J. Human encephalitis caused by pseudorabies virus infection: A case report. J. Neurovirol. 2020, 26, 442–448. [Google Scholar] [CrossRef]
- Prochazkova, D.; Bousova, I.; Wilhelmova, N. Antioxidant and prooxidant properties of flavonoids. Fitoterapia 2011, 82, 513–523. [Google Scholar] [CrossRef]
- Matsui, Y.; Sugiyama, K.; Kamei, M.; Takahashi, T.; Suzuki, T.; Katagata, Y.; Ito, T. Extract of passion fruit (Passiflora edulis) seed containing high amounts of piceatannol inhibits melanogenesis and promotes collagen synthesis. J. Agric. Food Chem. 2010, 58, 11112–11118. [Google Scholar] [CrossRef]
- Hanna, P.; Malgorzata, K.; Marek, M. Biological activity of piceatannol: Leaving the shadow of resveratrol. Mutat. Res./Rev. Mutat. Res. 2011, 750, 60–82. [Google Scholar]
- Efstathios, P.V.; Athanassios, K.; Ioannis, G.; Dimitrios, S.; Marilena, E.L. Screening of mushrooms bioactivity: Piceatannol was identified as a bioactive ingredient in the order Cantharellales. Eur. Food Res. Technol. 2018, 244, 861–871. [Google Scholar]
- Shah, U.; Shah, R.; Acharya, S.; Acharya, N. Novel anticancer agents from plant sources. Chin. J. Nat. Med. 2013, 11, 16–23. [Google Scholar] [CrossRef]
- Rimando, A.M.; Kalt, W.; Magee, J.B.; Dewey, J.; Ballington, J.R. Resveratrol, pterostilbene, and piceatannol in vaccinium berries. J. Agric. Food Chem. 2004, 52, 4713–4719. [Google Scholar] [CrossRef]
- Cao, Y.; Smith, W.; Yan, L.; Kong, L. Overview of Cellular Mechanisms and Signaling Pathways of Piceatannol. Curr. Stem Cell Res. Ther. 2020, 15, 4–10. [Google Scholar] [PubMed]
- Wang, S.Y.; Zhang, J.; Xu, X.G.; Su, H.L.; Xing, W.M.; Zhang, Z.S.; Jin, W.H.; Dai, J.H.; Wang, Y.Z.; He, X.Y.; et al. Inhibitory effects of piceatannol on human cytomegalovirus (hCMV) in vitro. J. Microbiol. 2020, 58, 716–723. [Google Scholar] [CrossRef]
- Pflieger, A.; Waffo, T.P.; Papastamoulis, Y.; Chaignepain, S.; Subra, F.; Munir, S.; Delelis, O.; Lesbats, P.; Calmels, C.; Andreola, M.L.; et al. Natural stilbenoids isolated from grapevine exhibiting inhibitory effects against HIV-1 integrase and eukaryote MOS1 transposase in vitro activities. PLoS ONE 2013, 8, e81184. [Google Scholar] [CrossRef]
- Li, A.; Lu, G.; Qi, J.; Wu, L.; Tian, K.; Luo, T.; Shi, Y.; Yan, J.; Gao, G.F. Structural basis of nectin-1 recognition by pseudorabies virus glycoprotein D. PLoS Pathog. 2017, 13, e1006314. [Google Scholar] [CrossRef]
- Zheng, H.H.; Fu, P.F.; Chen, H.Y.; Wang, Z.Y. Pseudorabies Virus: From Pathogenesis to Prevention Strategies. Viruses 2022, 14, 1638. [Google Scholar] [CrossRef]
- He, W.; Auclert, L.Z.; Zhai, X.; Wong, G.; Zhang, C.; Zhu, H.; Xing, G.; Wang, S.; He, W.; Li, K.; et al. Interspecies Transmission, Genetic Diversity, and Evolutionary Dynamics of Pseudorabies Virus. J. Infect. Dis. 2019, 219, 1705–1715. [Google Scholar] [CrossRef]
- Dey, R.; Samadder, A.; Nandi, S. Exploring the Targets of Novel Corona Virus and Docking-based Screening of Potential Natural Inhibitors to Combat COVID-19. Curr. Top. Med. Chem. 2022, 22, 2410–2434. [Google Scholar]
- Chen, Z.; Ye, S. Research progress on antiviral constituents in traditional Chinese medicines and their mechanisms of action. Pharm. Biol. 2022, 60, 1063–1076. [Google Scholar] [CrossRef]
- Rossi, M.; Caruso, F.; Opazo, C.; Salciccioli, J. Crystal and molecular structure of piceatannol; scavenging features of resveratrol and piceatannol on hydroxyl and peroxyl radicals and docking with transthyretin. J. Agric. Food Chem. 2008, 56, 10557–10566. [Google Scholar] [CrossRef]
- Zakaria, M.Y.; Abd, E.S.M.; Beshay, B.Y.; Zaki, I.; Abourehab, M.A.S. ‘Poly phenolic phytoceutical loaded nano-bilosomes for enhanced caco-2 cell permeability and SARS-CoV 2 antiviral activity’: In-vitro and insilico studies. Drug Deliv. 2023, 30, 2162157. [Google Scholar] [CrossRef]
- Huan, C.; Xu, W.; Guo, T.; Pan, H.; Zou, H.; Jiang, L.; Li, C.; Gao, S. (-)-Epigallocatechin-3-Gallate Inhibits the Life Cycle of Pseudorabies Virus In Vitro and Protects Mice Against Fatal Infection. Front. Cell. Infect. Microbiol. 2020, 10, 616895. [Google Scholar] [CrossRef]
- Yu, P.W.; Fu, P.F.; Zeng, L.; Qi, Y.L.; Li, X.Q.; Wang, Q.; Yang, G.Y.; Li, H.W.; Wang, J.; Chu, B.B.; et al. EGCG Restricts PRRSV Proliferation by Disturbing Lipid Metabolism. Microbiol. Spectr. 2022, 10, e227621. [Google Scholar] [CrossRef]
- Mou, Q.; Jiang, Y.; Zhu, L.; Zhu, Z.; Ren, T. EGCG induces beta-defensin 3 against influenza A virus H1N1 by the MAPK signaling pathway. Exp. Ther. Med. 2020, 20, 3017–3024. [Google Scholar]
- Stamos, J.D.; Lee, L.H.; Taylor, C.; Elias, T.; Adams, S.D. In Vitro and In Silico Analysis of the Inhibitory Activity of EGCG-Stearate against Herpes Simplex Virus-2. Microorganisms 2022, 10, 1462. [Google Scholar] [CrossRef]
- Carneiro, B.M.; Batista, M.N.; Braga, A.; Nogueira, M.L.; Rahal, P. The green tea molecule EGCG inhibits Zika virus entry. Virology 2016, 496, 215–218. [Google Scholar] [CrossRef]
- Yang, B.; Luo, G.; Zhang, C.; Feng, L.; Luo, X.; Gan, L. Curcumin protects rat hippocampal neurons against pseudorabies virus by regulating the BDNF/TrkB pathway. Sci. Rep. 2020, 10, 22204. [Google Scholar] [CrossRef]
- Gao, Y.; Hu, J.H.; Liang, X.D.; Chen, J.; Liu, C.C.; Liu, Y.Y.; Cheng, Y.; Go, Y.Y.; Zhou, B. Curcumin inhibits classical swine fever virus replication by interfering with lipid metabolism. Vet. Microbiol. 2021, 259, 109152. [Google Scholar] [CrossRef]
- Li, Y.; Wang, J.; Liu, Y.; Luo, X.; Lei, W.; Xie, L. Antiviral and virucidal effects of curcumin on transmissible gastroenteritis virus in vitro. J. Gen. Virol. 2020, 101, 1079–1084. [Google Scholar] [CrossRef]
- Wei, Z.; Zhang, Y.; Ke, C.; Chen, H.; Ren, P.; He, Y.; Hu, P.; Ma, D.; Luo, J.; Meng, Z. Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation. World J. Gastroenterol. 2017, 23, 6252. [Google Scholar] [CrossRef]
- Padilla-S, L.; Rodriguez, A.; Gonzales, M.M.; Gallego-G, J.C.; Castano-O, J.C. Inhibitory effects of curcumin on dengue virus type 2-infected cells in vitro. Arch. Virol. 2014, 159, 573–579. [Google Scholar] [CrossRef]
- Xu, J.; Yin, Z.; Li, L.; Cheng, A.; Jia, R.; Song, X.; Lu, H.; Dai, S.; Lv, C.; Liang, X.; et al. Inhibitory effect of resveratrol against duck enteritis virus in vitro. PLoS ONE 2013, 8, e65213. [Google Scholar] [CrossRef] [PubMed]
- Huan, C.; Zhou, Z.; Yao, J.; Ni, B.; Gao, S. The Antiviral Effect of Panax Notoginseng Polysaccharides by Inhibiting PRV Adsorption and Replication In Vitro. Molecules 2022, 27, 1254. [Google Scholar] [CrossRef]
- Johnson, D.C.; Baines, J.D. Herpesviruses remodel host membranes for virus egress. Nat. Rev. Microbiol. 2011, 9, 382–394. [Google Scholar] [CrossRef] [PubMed]
- Pomeranz, L.E.; Reynolds, A.E.; Hengartner, C.J. Molecular biology of pseudorabies virus: Impact on neurovirology and veterinary medicine. Microbiol. Mol. Biol. Rev. 2005, 69, 462–500. [Google Scholar] [CrossRef] [PubMed]
- Men, X.; Li, S.; Cai, X.; Fu, L.; Shao, Y.; Zhu, Y. Antiviral Activity of Luteolin against Pseudorabies Virus In Vitro and In Vivo. Animals 2023, 13, 761. [Google Scholar] [CrossRef] [PubMed]
- Ye, G.; Liu, H.; Zhou, Q.; Liu, X.; Huang, L.; Weng, C. A Tug of War: Pseudorabies Virus and Host Antiviral Innate Immunity. Viruses 2022, 14, 547. [Google Scholar] [CrossRef]
- Liu, L. Fields Virology, 6th Edition. Clin. Infect. Dis. 2014, 59, 613. [Google Scholar] [CrossRef]
- Teodoro, J.G.; Branton, P.E. Regulation of apoptosis by viral gene products. J. Virol. 1997, 71, 1739–1746. [Google Scholar] [CrossRef]
- Hu, H.; Hu, Z.; Zhang, Y.; Wan, H.; Yin, Z.; Li, L.; Liang, X.; Zhao, X.; Yin, L.; Ye, G.; et al. Myricetin inhibits pseudorabies virus infection through direct inactivation and activating host antiviral defense. Front. Microbiol. 2022, 13, 985108. [Google Scholar] [CrossRef]
- Maresch, C.; Lange, E.; Teifke, J.P.; Fuchs, W.; Klupp, B.; Muller, T.; Mettenleiter, T.C.; Vahlenkamp, T.W. Oral immunization of wild boar and domestic pigs with attenuated live vaccine protects against Pseudorabies virus infection. Vet. Microbiol. 2012, 161, 20–25. [Google Scholar] [CrossRef]
- Cai, X.; Shao, Y.; Wang, Z.; Xu, Y.; Ren, Z.; Fu, L.; Zhu, Y. Antiviral activity of dandelion aqueous extract against pseudorabies virus both in vitro and in vivo. Front. Vet. Sci. 2022, 9, 1090398. [Google Scholar] [CrossRef]
- Brittle, E.E.; Reynolds, A.E.; Enquist, L.W. Two modes of pseudorabies virus neuroinvasion and lethality in mice. J. Virol. 2004, 78, 12951–12963. [Google Scholar] [CrossRef]
- Zhang, S.; Ye, J.; Wang, L.; Zhong, X.; Zou, X.; Qiu, F.; Huang, Z. Piceatannol protects rat neuron cells from oxygen-glucose deprivation reperfusion injury via regulation of GSK-3beta/Nrf2 signaling pathway. Zhejiang Da Xue Xue Bao Yi Xue Ban. 2022, 51, 552–562. [Google Scholar]
- Jingyun, W.; Yanmei, M.; Long, W.; Xiaojuan, C.; Ruoxiang, Y.; Song, W.; Xinxin, L.; Xiaoyong, C.; Wenhan, S.; Ji-Long, C. Alpha/beta interferon receptor deficiency in mice significantly enhances susceptibility of the animals to pseudorabies virus infection. Vet. Microbiol. 2017, 203, 234–244. [Google Scholar]
- Wang, F.; Zhang, S.; Jeon, R.; Vuckovic, I.; Jiang, X.; Lerman, A.; Folmes, C.D.; Dzeja, P.D.; Herrmann, J. Interferon Gamma Induces Reversible Metabolic Reprogramming of M1 Macrophages to Sustain Cell Viability and Pro-Inflammatory Activity. eBioMedicine 2018, 30, 303–316. [Google Scholar] [CrossRef]
- Smith, P.M.; Wolcott, R.M.; Chervenak, R.; Jennings, S.R. Control of acute cutaneous herpes simplex virus infection: T cell-mediated viral clearance is dependent upon interferon-gamma (IFN-gamma). Virology 1994, 202, 76–88. [Google Scholar] [CrossRef]
- Tanaka, T.; Narazaki, M.; Kishimoto, T. IL-6 in inflammation, immunity, and disease. Cold Spring Harb. Perspect. Biol. 2014, 6, a16295. [Google Scholar] [CrossRef]
- Mlcek, J.; Jurikova, T.; Skrovankova, S.; Sochor, J. Quercetin and Its Anti-Allergic Immune Response. Molecules 2016, 21, 623. [Google Scholar] [CrossRef]







| Gene Name | Sequence (5′-3′) |
|---|---|
| UL44-F | CGTCAGGAATCGCATCA |
| UL44-R | CGCGTCACGTTCACCAC |
| IE180-F | CGCTCCACCAACAACC |
| IE180-R | TCGTCCTCGTCCCAGA |
| UL29-F | AGAAGCCGCACGCCATCACC |
| UL29-R | GGGAACCCGCAGACGGACAA |
| EP0-F | GGGCGTGGGTGTTT |
| EP0-R | GCTTTATGGGCAGGT |
| US6-F | AACATCCTCACCGACTTCA |
| US6-R | CGTCAGGAATCGCATCA |
| UL27-F | TCGTCCACGTCGTCCTCTTCG |
| UL27-R | CGGCATCGCCAACTTCTTCC |
| β-actin-F | TGCGGGACATCAAGGAGAA |
| β-actin-R | AGGAAGGAGGGCTGGAAGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Cai, X.; Ren, Z.; Shao, Y.; Xu, Y.; Fu, L.; Zhu, Y. Piceatannol as an Antiviral Inhibitor of PRV Infection In Vitro and In Vivo. Animals 2023, 13, 2376. https://doi.org/10.3390/ani13142376
Wang Z, Cai X, Ren Z, Shao Y, Xu Y, Fu L, Zhu Y. Piceatannol as an Antiviral Inhibitor of PRV Infection In Vitro and In Vivo. Animals. 2023; 13(14):2376. https://doi.org/10.3390/ani13142376
Chicago/Turabian StyleWang, Zhiying, Xiaojing Cai, Zhiyuan Ren, Yi Shao, Yongkang Xu, Lian Fu, and Yan Zhu. 2023. "Piceatannol as an Antiviral Inhibitor of PRV Infection In Vitro and In Vivo" Animals 13, no. 14: 2376. https://doi.org/10.3390/ani13142376
APA StyleWang, Z., Cai, X., Ren, Z., Shao, Y., Xu, Y., Fu, L., & Zhu, Y. (2023). Piceatannol as an Antiviral Inhibitor of PRV Infection In Vitro and In Vivo. Animals, 13(14), 2376. https://doi.org/10.3390/ani13142376

