Effects of Thymol and Carvacrol Eutectic on Growth Performance, Serum Biochemical Parameters, and Intestinal Health in Broiler Chickens
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds, Experimental Design, Diet, and Management
2.2. Data and Sample Collection
2.3. Serum Biochemical Indices
2.4. Intestinal Morphology
2.5. Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Serum Biochemical Indices
3.3. Intestinal Morphology
3.4. Intestinal Nutrient Absorption, Barrier Function, and Inflammation-Related Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ramsey, J.T.; Shropshire, B.C.; Nagy, T.R.; Chambers, K.D.; Li, Y.; Korach, K.S. Essential Oils and Health. Yale J. Biol. Med. 2020, 93, 291–305. [Google Scholar] [PubMed]
- Peterfalvi, A.; Miko, E.; Nagy, T.; Reger, B.; Simon, D.; Miseta, A.; Czéh, B.; Szereday, L. Much More Than a Pleasant Scent: A Review on Essential Oils Supporting the Immune System. Molecules 2019, 24, 4530. [Google Scholar] [CrossRef]
- Valdivieso-Ugarte, M.; Gomez-Llorente, C.; Plaza-Díaz, J.; Gil, Á. Antimicrobial, Antioxidant, and Immunomodulatory Properties of Essential Oils: A Systematic Review. Nutrients 2019, 11, 2786. [Google Scholar] [CrossRef]
- Lee, J.-W.; Kim, D.-H.; Kim, Y.-B.; Jeong, S.-B.; Oh, S.-T.; Cho, S.-Y.; Lee, K.-W. Dietary Encapsulated Essential Oils Improve Production Performance of Coccidiosis-Vaccine-Challenged Broiler Chickens. Animals 2020, 10, 481. [Google Scholar] [CrossRef]
- Xue, F.; Shi, L.; Li, Y.; Ni, A.; Ma, H.; Sun, Y.; Chen, J. Effects of replacing dietary Aureomycin with a combination of plant essential oils on production performance and gastrointestinal health of broilers. Poult. Sci. 2020, 99, 4521–4529. [Google Scholar] [CrossRef]
- Yanan, D.; Yi, H.; Xiaofeng, Y.; Yechun, H.; Junlie, C.; Jin, W.; Shilin, W.; Haihan, Z.; Xi, H.; Zehe, S. Dietary essential oils improves the growth performance, antioxidant properties and intestinal permeability by inhibiting bacterial proliferation, and altering the gut microbiota of yellow-feather broilers. Poult. Sci. 2022, 101, 102087. [Google Scholar]
- Gholami-Ahangaran, M.; Ahmadi-Dastgerdi, A.; Azizi, S.; Basiratpour, A.; Zokaei, M.; Derakhshan, M. Thymol and carvacrol supplementation in poultry health and performance. Vet. Med. Sci. 2022, 8, 267–288. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.D.; Song, M.H.; Yun, W.; Lee, J.H.; Kim, H.B.; Cho, J.H. Effect of carvacrol essential oils on immune response and inflammation-related genes expression in broilers challenged by lipopolysaccharide. Poult. Sci. 2019, 98, 2026–2033. [Google Scholar] [CrossRef]
- Mallick, P.; Muduli, K.; Biswal, J.N.; Pumwa, J. Broiler Poultry Feed Cost Optimization Using Linear Programming Technique. J. Oper. Strat. Plan. 2020, 3, 31–57. [Google Scholar] [CrossRef]
- Sousa, V.I.; Parente, J.F.; Marques, J.F.; Forte, M.A.; Tavares, C.J. Microencapsulation of Essential Oils: A Review. Polymers 2022, 14, 1730. [Google Scholar] [CrossRef]
- Turek, C.; Stintzing, F.C. Stability of Essential Oils: A Review. Compr. Rev. Food Sci. Food Saf. 2013, 12, 40–53. [Google Scholar] [CrossRef]
- Duggirala, N.K.; Perry, M.L.; Almarsson, Ö.; Zaworotko, M.J. Pharmaceutical cocrystals: Along the path to improved medicines. Chem. Commun. 2016, 52, 640–655. [Google Scholar] [CrossRef] [PubMed]
- Shaikh, R.; Singh, R.; Walker, G.M.; Croker, D.M. Pharmaceutical Cocrystal Drug Products: An Outlook on Product Development. Trends Pharmacol. Sci. 2018, 39, 1033–1048. [Google Scholar] [CrossRef]
- Bolla, G.; Sarma, B.; Nangia, A.K. Crystal Engineering of Pharmaceutical Cocrystals in the Discovery and Development of Improved Drugs. Chem. Rev. 2022, 122, 11514–11603. [Google Scholar] [CrossRef]
- Bassolé, I.H.; Juliani, H.R. Essential oils in combination and their antimicrobial properties. Molecules 2012, 17, 3989–4006. [Google Scholar] [CrossRef]
- Du, E.; Wang, W.; Gan, L.; Li, Z.; Guo, S.; Guo, Y. Effects of thymol and carvacrol supplementation on intestinal integrity and immune responses of broiler chickens challenged with Clostridium perfringens. J. Anim. Sci. Biotechnol. 2016, 7, 19. [Google Scholar] [CrossRef] [PubMed]
- Han, H.Y.; Zhang, K.Y.; Ding, X.M.; Bai, S.P.; Luo, Y.H.; Wang, J.P.; Zeng, Q.F. Effect of dietary fiber levels on performance, gizzard development, intestinal morphology, and nutrient utilization in meat ducks from 1 to 21 days of age. Poult. Sci. 2017, 96, 4333–4341. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.L.; Zhang, K.Y.; Ding, X.M.; Zheng, P.; Luo, Y.H.; Bai, S.P.; Wang, J.P.; Xuan, Y.; Su, Z.W.; Zeng, Q.F. Effects of dietary DL-2-hydroxy-4(methylthio)butanoic acid supplementation on growth performance, indices of ascites syndrome, and antioxidant capacity of broilers reared at low ambient temperature. Int. J. Biometeorol. 2016, 60, 1193–1203. [Google Scholar] [CrossRef]
- Ruan, D.; Fan, Q.; Fouad, A.M.; Sun, Y.; Huang, S.; Wu, A.; Lin, C.; Kuang, Z.; Zhang, C.; Jiang, S. Effects of dietary oregano essential oil supplementation on growth performance, intestinal antioxidative capacity, immunity, and intestinal microbiota in yellow-feathered chickens. J. Anim. Sci. 2021, 99, skab033. [Google Scholar] [CrossRef]
- Youssef, I.M.I.; Männer, K.; Zentek, J. Effect of essential oils or saponins alone or in combination on productive performance, intestinal morphology and digestive enzymes’ activity of broiler chickens. J. Anim. Physiol. Anim. Nutr. 2021, 105, 99–107. [Google Scholar] [CrossRef]
- Zhang, L.Y.; Peng, Q.Y.; Liu, Y.R.; Ma, Q.G.; Zhang, J.Y.; Guo, Y.P.; Xue, Z.; Zhao, L.H. Effects of oregano essential oil as an antibiotic growth promoter alternative on growth performance, antioxidant status, and intestinal health of broilers. Poult. Sci. 2021, 100, 101163. [Google Scholar] [CrossRef]
- Tóthová, C.; Sesztáková, E.; Bielik, B.; Nagy, O. Changes of total protein and protein fractions in broiler chickens during the fattening period. Vet. World 2019, 12, 598–604. [Google Scholar] [CrossRef] [PubMed]
- Cheng, H.; Chen, J.F.; Tang, S.G.; Guo, S.C.; He, C.Q.; Qu, X.Y. Effects of essential oil/palygorskite composite on performance, egg quality, plasma biochemistry, oxidation status, immune response and intestinal morphology of laying hens. Poult. Sci. 2022, 101, 101632. [Google Scholar] [CrossRef] [PubMed]
- Mohiti-Asli, M.; Ghanaatparast-Rashti, M. Comparison of the effect of two phytogenic compounds on growth performance and immune response of broilers. J. Appl. Anim. Res. 2017, 45, 603–608. [Google Scholar] [CrossRef]
- Stamilla, A.; Messina, A.; Sallemi, S.; Condorelli, L.; Antoci, F.; Puleio, R.; Loria, G.R.; Cascone, G.; Lanza, M. Effects of Microencapsulated Blends of Organics Acids (OA) and Essential Oils (EO) as a Feed Additive for Broiler Chicken. A Focus on Growth Performance, Gut Morphology and Microbiology. Animals 2020, 10, 442. [Google Scholar] [CrossRef] [PubMed]
- Biasato, I.; Ferrocino, I.; Biasibetti, E.; Grego, E.; Dabbou, S.; Sereno, A.; Gai, F.; Gasco, L.; Schiavone, A.; Cocolin, L.; et al. Modulation of intestinal microbiota, morphology and mucin composition by dietary insect meal inclusion in free-range chickens. BMC Vet. Res. 2018, 14, 383. [Google Scholar] [CrossRef]
- Guo, S.; Liu, L.; Lei, J.; Qu, X.; He, C.; Tang, S.; Xiao, B.; Li, P.; Gao, Q.; Lan, F.; et al. Modulation of intestinal morphology and microbiota by dietary Macleaya cordata extract supplementation in Xuefeng Black-boned Chicken. Animal 2021, 15, 100399. [Google Scholar] [CrossRef]
- Ding, X.; Yang, C.; Wang, P.; Yang, Z.; Ren, X. Effects of star anise (Illicium verum Hook. f) and its extractions on carcass traits, relative organ weight, intestinal development, and meat quality of broiler chickens. Poult. Sci. 2020, 99, 5673–5680. [Google Scholar] [CrossRef]
- Suzuki, T. Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim. Sci. J. 2020, 91, e13357. [Google Scholar] [CrossRef]
- Pham, V.H.; Kan, L.; Huang, J.; Geng, Y.; Zhen, W.; Guo, Y.; Abbas, W.; Wang, Z. Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis. J. Anim. Sci. Biotechnol. 2020, 11, 18. [Google Scholar] [CrossRef]
- Wang, H.; Liang, S.; Li, X.; Yang, X.; Long, F.; Yang, X. Effects of encapsulated essential oils and organic acids on laying performance, egg quality, intestinal morphology, barrier function, and microflora count of hens during the early laying period. Poult. Sci. 2019, 98, 6751–6760. [Google Scholar] [CrossRef] [PubMed]
- Al-Sadi, R.; Boivin, M.; Ma, T. Mechanism of cytokine modulation of epithelial tight junction barrier. Front. Biosci. (Landmark Ed.) 2009, 14, 2765–2778. [Google Scholar] [CrossRef]
- Neumann, C.; Scheffold, A.; Rutz, S. Functions and regulation of -10. Semin. Immunol. 2019, 44, 101344. [Google Scholar] [CrossRef] [PubMed]
- Rutz, S.; Ouyang, W. Regulation of Interleukin-10 Expression. Adv. Exp. Med. Biol. 2016, 941, 89–116. [Google Scholar] [CrossRef] [PubMed]


| Ingredients | Contents (%) | |
|---|---|---|
| 1–21 d | 22–42 d | |
| Corn | 50.42 | 50.41 |
| Flour | 4.00 | 4.00 |
| Soybean meal | 37.9 | 36.0 |
| Soya oil | 3.65 | 5.33 |
| Dicalcium phosphate | 1.90 | 1.30 |
| Limestone | 1.26 | 1.33 |
| Sodium chloride | 0.30 | 0.30 |
| Vitamin premix (1) | 0.03 | 0.03 |
| Mineral premix (2) | 0.20 | 0.20 |
| L-Lysine-HCL | 0.00 | 0.07 |
| L-Threonine | 0.00 | 0.03 |
| DL-Methionine | 0.19 | 0.21 |
| Choline chloride (50%) | 0.15 | 0.15 |
| Rice bran | 0.00 | 0.64 |
| Total | 100.00 | 100.00 |
| Calculated nutritional levels, % | ||
| ME, Mcal/kg | 3.00 | 3.10 |
| Crude protein | 20.88 | 20.16 |
| Calcium | 1.00 | 0.90 |
| Non-phytate phosphorus | 0.45 | 0.35 |
| Digestible lysine | 1.15 | 1.15 |
| Digestible methionine | 0.50 | 0.50 |
| Digestible threonine | 0.81 | 0.81 |
| Gene Name/Abbreviation | Accession Number | Primer Sequence (5′-3′) |
|---|---|---|
| β-actin | NM_205518 | F:GAGAAATTGTGCGTGACATCA |
| R:CCTGAACCTCTCATTGCCA | ||
| FATP4 | XM_015279553.3 | F:GAGCCGCATCCTCAACCTG |
| R:GCTGCCATTCCTGCCTTCC | ||
| PepT1 | NM_204365.2 | F:TCACTGTTGGCATGTTCCT |
| R:TTCGCATTGCTATCACCTA | ||
| CAT-1 | NM_001145490.1 | F:TACAACAGGTGAGGAGGTG |
| R:AAGCCACAAAGCAGATGAG | ||
| ZO-1 | XM_040680632.1 | F:GGCAAGTTGAAGATGGTGGT |
| R:ATGCCAGCGACTGAATTTCT | ||
| MUC2 | XM_040701667.1 | F:AACTCCTCCTTTGTATGCG |
| R:ATTCAACCTTCTGCCCTAA | ||
| OCLN | NM_205128.1 | F:CCTCATCGTCATCCTGCTCTG |
| R:GCCACGTTCTTCACCCACTC | ||
| IL-10 | NM_001004414.2 | F:TGTCACCGCTTCTTCACCT |
| R:TCCCGTTCTCATCCATCTT | ||
| IL-6 | NM_204628.1 | F: CTCCTCGCCAATCTGAAGTC |
| R:CCCTCACGGTCTTCTCCATA | ||
| IL-1β | NM_204524.1 | F:GCTCTACATGTCGTGTGTGATGAG |
| R:TGTCGATGTCCCGCATGA | ||
| TNF-α | NM_204267.2 | F:TACCCTGTCCCACAACCTG |
| R:GGCGGTCATAGAACAGCAC |
| Item | The Supplemented Dosage of Eutectic, mg/kg | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| 0 | 30 | 60 | 120 | ANOVA | Linear | Quadratic | ||
| Body weight (BW), g | ||||||||
| 1 d | 43.05 | 43.15 | 43.08 | 42.98 | 0.09 | 0.327 | 0.321 | 0.197 |
| 21 d | 914.5 | 933.3 | 935.7 | 927.4 | 15.86 | 0.552 | 0.415 | 0.345 |
| 42 d | 2704b | 2866 a | 2809 a | 2856 a | 49.56 | 0.011 | 0.026 | 0.027 |
| Average daily gain (ADG), g | ||||||||
| 1–21 d | 41.50 | 42.39 | 42.50 | 42.11 | 0.76 | 0.554 | 0.412 | 0.348 |
| 22–42 d | 85.27 b | 92.13 a | 89.25 b | 91.93 a | 1.95 | 0.005 | 0.018 | 0.025 |
| 1–42 d | 63.37 b | 67.23 a | 65.86 a | 66.98 a | 1.18 | 0.011 | 0.026 | 0.027 |
| Average daily feed intake (ADFI), g | ||||||||
| 1–21 d | 67.55 | 67.05 | 68.05 | 67.22 | 1.53 | 0.917 | 0.997 | 0.988 |
| 22–42 d | 157.5 | 166.4 | 162.5 | 163.1 | 3.53 | 0.114 | 0.280 | 0.159 |
| 1–42 d | 116.5 | 120.7 | 119.4 | 119.2 | 2.20 | 0.309 | 0.354 | 0.252 |
| Feed to gain ratio (F: G), g/g | ||||||||
| 1–21 d | 1.63 | 1.58 | 1.60 | 1.60 | 0.03 | 0.447 | 0.420 | 0.432 |
| 22–42 d | 1.85 | 1.81 | 1.82 | 1.78 | 0.03 | 0.052 | 0.017 | 0.060 |
| 1–42 d | 1.80 | 1.76 | 1.78 | 1.75 | 0.02 | 0.054 | 0.025 | 0.078 |
| Item | The Supplemented Dosage of Eutectic, mg/kg | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| 0 | 30 | 60 | 120 | ANOVA | Linear | Quadratic | ||
| Serum biochemical indexes of broilers at 21 d of age | ||||||||
| Total protein (g/L) | 26.20 | 24.73 | 27.01 | 25.49 | 1.20 | 0.281 | 0.970 | 0.999 |
| Albumin (g/L) | 12.20 | 11.53 | 12.36 | 11.59 | 0.72 | 0.566 | 0.664 | 0.907 |
| Globulin (g/L) | 14.00 | 13.20 | 14.65 | 13.90 | 0.87 | 0.440 | 0.682 | 0.920 |
| Uric Acid (μmol/L) | 227.6 | 288.9 | 268.5 | 300.3 | 37.28 | 0.244 | 0.102 | 0.230 |
| IgE (U/mL) | 6.96 | 8.59 | 9.80 | 10.09 | 1.28 | 0.082 | 0.012 | 0.033 |
| IgG (mg/mL) | 17.10 | 17.92 | 21.25 | 23.99 | 3.63 | 0.230 | 0.039 | 0.116 |
| IgM (mg/mL) | 9.18 | 6.54 | 8.26 | 9.83 | 1.63 | 0.225 | 0.497 | 0.161 |
| Serum biochemical indexes of broilers at 42 d of age | ||||||||
| Total protein (g/L) | 27.26 | 27.56 | 25.13 | 23.29 | 2.35 | 0.248 | 0.057 | 0.136 |
| Albumin (g/L) | 12.40 | 13.29 | 11.83 | 10.71 | 1.14 | 0.172 | 0.081 | 0.105 |
| Globulin(g/L) | 14.86 | 14.28 | 13.30 | 12.40 | 1.40 | 0.330 | 0.061 | 0.175 |
| Uric Acid (μmol/L) | 202.1 | 247.5 | 182.0 | 191.5 | 43.20 | 0.453 | 0.482 | 0.664 |
| IgE (U/mL) | 4.96 | 5.79 | 4.93 | 5.74 | 1.12 | 0.781 | 0.958 | 0.990 |
| IgG (mg/mL) | 45.24 | 51.08 | 48.41 | 58.01 | 5.67 | 0.163 | 0.095 | 0.227 |
| IgM (mg/mL) | 10.13 | 8.11 | 3.95 | 11.61 | 4.39 | 0.347 | 0.871 | 0.315 |
| Item | The Supplemented Dosage of Eutectic, mg/kg | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| 0 | 30 | 60 | 120 | ANOVA | Linear | Quadratic | ||
| Jejunal morphology | ||||||||
| Villus height at 21 d (μm) | 1003 b | 1099 a | 997.1 b | 1036 b | 32.26 | 0.006 | 0.882 | 0.499 |
| Crypt depth at 21 d (μm) | 192.2 b | 197.6 b | 233.2 a | 232.2 a | 9.09 | <0.001 | <0.001 | <0.001 |
| VH:CD at 21 d | 5.41 a | 5.77 a | 4.58 b | 4.77 b | 0.22 | <0.001 | <0.001 | <0.001 |
| Intestinal wall thickness at 21 d (μm) | 1374 | 1462 | 1396 | 1434 | 39.76 | 0.128 | 0.413 | 0.498 |
| Villus height at 42 d (μm) | 1147 b | 1460 a | 1161 b | 1119 b | 52.74 | <0.001 | 0.035 | <0.001 |
| Crypt depth at 42 d (μm) | 207.5 a | 216.7 a | 185.0 b | 188.0 b | 9.29 | 0.002 | 0.003 | 0.011 |
| VH:CD at 42 d | 6.16 b | 7.36 a | 7.06 a | 6.03 b | 0.43 | 0.004 | 0.603 | 0.001 |
| Intestinal wall thickness at 42 d (μm) | 1563 b | 1993 a | 1613 b | 1539 b | 55.65 | <0.001 | 0.024 | <0.001 |
| Ileal morphology | ||||||||
| Villus height at 21 d (μm) | 772.5 a | 654.7 c | 704.3 b | 601.8 d | 19.64 | <0.001 | <0.001 | <0.001 |
| Crypt depth at 21 d (μm) | 245.4 a | 205.1 c | 249.0 a | 221.5 b | 6.64 | <0.001 | 0.225 | 0.217 |
| VH:CD at 21 d | 3.23 a | 3.30 a | 2.86 b | 2.72 b | 0.09 | <0.001 | <0.001 | <0.001 |
| Intestinal wall thickness at 21 d (μm) | 1272 a | 1046 c | 1177 b | 1016 c | 30.12 | <0.001 | <0.001 | <0.001 |
| Villus height at 42 d (μm) | 1086 b | 1202 a | 1226 a | 996.5 c | 39.95 | <0.001 | 0.193 | <0.001 |
| Crypt depth at 42 d (μm) | 199.9 ab | 205.5 a | 191.6 b | 175.0 c | 6.69 | <0.001 | <0.001 | <0.001 |
| VH:CD at 42 d | 5.56 b | 5.89 b | 6.73 a | 5.65 b | 0.22 | <0.001 | 0.062 | <0.001 |
| Intestinal wall thickness at 42 d (μm) | 1644 b | 1861 a | 1846 a | 1559 b | 52.61 | <0.001 | 0.305 | <0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, L.; Chen, X.; Zhang, K.; Tian, G.; Ding, X.; Bai, S.; Zeng, Q. Effects of Thymol and Carvacrol Eutectic on Growth Performance, Serum Biochemical Parameters, and Intestinal Health in Broiler Chickens. Animals 2023, 13, 2242. https://doi.org/10.3390/ani13132242
Li L, Chen X, Zhang K, Tian G, Ding X, Bai S, Zeng Q. Effects of Thymol and Carvacrol Eutectic on Growth Performance, Serum Biochemical Parameters, and Intestinal Health in Broiler Chickens. Animals. 2023; 13(13):2242. https://doi.org/10.3390/ani13132242
Chicago/Turabian StyleLi, Lixuan, Xiaochun Chen, Keying Zhang, Gang Tian, Xuemei Ding, Shiping Bai, and Qiufeng Zeng. 2023. "Effects of Thymol and Carvacrol Eutectic on Growth Performance, Serum Biochemical Parameters, and Intestinal Health in Broiler Chickens" Animals 13, no. 13: 2242. https://doi.org/10.3390/ani13132242
APA StyleLi, L., Chen, X., Zhang, K., Tian, G., Ding, X., Bai, S., & Zeng, Q. (2023). Effects of Thymol and Carvacrol Eutectic on Growth Performance, Serum Biochemical Parameters, and Intestinal Health in Broiler Chickens. Animals, 13(13), 2242. https://doi.org/10.3390/ani13132242

