Molecular Identification of Bacillus Isolated from Korean Water Deer (Hydropotes inermis argyropus) and Striped Field Mouse (Apodemus agrarius) Feces by Using an SNP-Based 16S Ribosomal Marker
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacillus Species-Specific and Bacillus cereus-Specific Identification from Wild-Animal Feces
2.2. Sample Collection and Processing
2.3. Traditional Identification of Bacillus Species Using the Culture-Based Method
2.4. Genomic DNA (gDNA) Extraction
2.5. Development of a 16S rRNA Primer Set for Bacillus Species Identification
2.6. Development of Bacillus cereus-Specific SNP-Based 16S Primer Sets
2.7. PCR Amplification, Followed by Sequencing and Phylogenetic Analysis
3. Results
3.1. Identification of Bacillus spp. from Wild Animal (Korean Water Deer and Striped Field Mouse) Fecal Samples
3.2. Amplification of the Colonies Positive in the Culture Using The Newly Designed 16S rRNA Primers for Identification of Bacillus Species Isolated from Wild-Animal Fecal Samples
3.3. Development of an SNP-Based Primer for Discrimination between Different Members of the Bacillus cereus Group
3.4. Phylogenetic Analysis of Bacillus Species Isolated from Wild-Animal Fecal Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, E.K.; Kim, H.R.; Jeon, S.H.; Park, Y.C. Complete mitochondrial genome of a water deer subspecies, Hydropotes inermis argyropus (Cervidae: Hydropotinae). Mitochon. DNA 2013, 24, 17–18. [Google Scholar] [CrossRef] [PubMed]
- National Institute of Biological Resources of Korea (NIBR). Survey and Resource Management of Wildlife; National Institute of Biological Resources of Korea: Incheon, Korea, 2011; p. 24.
- O’Brien, D.J.; Schmitt, S.M.; Fierke, J.S.; Hogle, S.A.; Winterstein, S.R.; Cooley, T.M.; Moritz, W.E.; Diegel, K.L.; Fitzgerald, S.D.; Berry, D.E. Epidemiology of Mycobacterium bovis in free-ranging white-tailed deer, Michigan, USA, 1995–2000. Prev. Vet. Med. 2002, 54, 47–63. [Google Scholar] [CrossRef]
- Park, K.; Kim, W.K.; Lee, S.H.; Kim, J.; Lee, J.; Cho, S.; Lee, G.Y.; No, J.S.; Lee, K.H.; Song, J.W. A novel genotype of Hantaan orthohantavirus harbored by Apodemus agrarius chejuensis as a potential etiologic agent of hemorrhagic fever with renal syndrome in Republic of Korea. PLoS Negl. Trop. Dis. 2021, 15, e0009400. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.S.; Kim, J.; Son, K.; Kim, Y.; Hwang, J.; Jeong, H.; Ahn, T.; Jheong, W.H. Phylogenetic analysis of severe fever with thrombocytopenia syndrome virus in Korean water deer (Hydropotes inermis argyropus) in the Republic of Korea. Ticks Tick-Borne Dis. 2020, 11, 101331. [Google Scholar] [CrossRef] [PubMed]
- Truong, L.Q.; Kim, J.T.; Yoon, B.I.; Her, M.; Jung, S.C.; Hahn, T.W. Epidemiological survey for Brucella in wildlife and stray dogs, a cat and rodents captured on farms. J. Vet. Med. Sci. 2011, 73, 1597–1601. [Google Scholar] [CrossRef] [Green Version]
- Kang, J.G.; Ko, S.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Chae, J.B.; Jo, Y.S.; Choi, K.S.; Yu, D.H.; Park, B.K.; et al. Prevalence of Anaplasma and Bartonella spp. in ticks collected from Korean water deer (Hydropotes inermis argyropus). Korean J. Parasitol. 2016, 54, 87–91. [Google Scholar] [CrossRef] [Green Version]
- Lee, I.Y.; Lim, J.W.; Seo, J.H.; Kim, H.C.; Lee, K.J.; Yong, T.S.; Lee, W.J.; Yu, J.R.; Sim, S. Geographical distribution and epidemiologic factors of chigger mites on Apodemus agrarius during Autumn in Korea. Korean J. Parasitol. 2021, 59, 473–479. [Google Scholar] [CrossRef]
- Otte, J.; Pica-Ciamarra, U. Emerging infectious zoonotic diseases: The neglected role of food animals. One Health 2021, 3, 100323. [Google Scholar] [CrossRef]
- Lee, D.H.; Cha, I.H.; Woo, D.S.; Ohba, M. Microbial ecology of Bacillus thuringiensis: Fecal populations recovered from wildlife in Korea. Can. J. Microbiol. 2003, 49, 465–471. [Google Scholar] [CrossRef]
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, G.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990–994. [Google Scholar] [CrossRef]
- Rahman, M.M.; Yoon, K.B.; Lim, S.J.; Jeon, M.G.; Kim, H.J.; Kim, H.Y.; Cho, J.Y.; Chae, H.M.; Park, Y.C. Molecular detection by analysis of the 16S rRNA gene of fecal coliform bacteria from the two Korean Apodemus species (Apodemus agrarius and A. peninsulae). Genet. Mol. Res. 2017, 18, 16. [Google Scholar] [CrossRef] [PubMed]
- Bottone, E.J. Bacillus cereus, a volatile human pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhandari, V.; Ahmod, N.Z.; Shah, H.N.; Gupta, R.S. Molecular signatures for Bacillus species: Demarcation of the Bacillus subtilis and Bacillus cereus clades in molecular terms and proposal to limit the placement of new species into the genus Bacillus. Int. J. Syst. Evol. Microbiol. 2013, 63, 2712–2726. [Google Scholar] [CrossRef] [PubMed]
- Parte, A.C. LPSN—List of prokaryotic names with standing in nomenclature (bacterio.net), 20 years on. Int. J. Syst. Evol. Microbiol. 2018, 68, 1825–1829. [Google Scholar] [CrossRef] [PubMed]
- Euzeby, J.P.; Euzeby, J. List of prokaryotic names with standing in nomenclature—Genus Bacillus. Int. J. Syst. Evol. Microbiol. 2018, 47, 590–592. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caulier, S.; Nannan, C.; Gillis, A.; Licciardi, F.; Bragard, C.; Mahillon, J. Overview of the antimicrobial compounds produced by members of the Bacillus subtilis group. Front. Microbiol. 2019, 10, 302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ceuppens, S.; Boon, N.; Uyttendaele, M. Diversity of Bacillus cereus group strains is reflected in their broad range of pathogenicity and diverse ecological lifestyles. FEMS Microbiol. Ecol. 2013, 84, 433–450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Argôlo-Filho, R.C.; Loguercio, L.L. Bacillus thuringiensis is an environmental pathogen and host-specificity has developed as an adaptation to human-generated ecological niches. Insects 2013, 5, 62–91. [Google Scholar] [CrossRef] [Green Version]
- Ehling-Schulz, M.; Lereclus, D.; Koehler, T.M. The Bacillus cereus group: Bacillus species with pathogenic potential. Microbiol. Spectr. 2019, 7, 1–60. [Google Scholar] [CrossRef]
- Nyachuba, D.G. Foodborne illness: Is it on the rise? Nutr. Rev. 2010, 68, 257–269. [Google Scholar] [CrossRef]
- Lee, S.H.; Yun, J.W.; Lee, J.H.; Jung, Y.H.; Lee, D.H. Trends in recent waterborne and foodborne disease outbreaks in South Korea, 2015–2019. Osong Public Health Res. Perspect. 2021, 12, 73–79. [Google Scholar] [CrossRef] [PubMed]
- KFDA. Korea Food and Drug Administration Food Poisoning Statistics System. Available online: https://www.foodsafetykorea.go.kr/main.do (accessed on 7 March 2022).
- Kim, J.H.; Lim, E.G.; Jang, H.C.; Park, J.Y.; Lee, S.J.; Park, M.S.; Chli, G.B.; Lee, B.K. A case of emetic toxin-producing Bacillus cereus strains isolated from outbreak. Korean J. Clin. Microbiol. 2009, 12, 48–52. [Google Scholar] [CrossRef] [Green Version]
- Harris, J.K.; Kelley, S.T.; Pace, N.R. New perspective on uncultured bacterial phylogenetic division OP11. Appl. Environ. Microbiol. 2004, 70, 845–849. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goto, K.; Omura, T.; Hara, Y.; Sadaie, Y. Application of the partial 16S rDNA sequence as an index for rapid identification of species in the genus Bacillus. J. Gen. Appl. Microbiol. 2000, 46, 1–8. [Google Scholar] [CrossRef] [Green Version]
- Braun, P.; Nguyen, M.D.; Walter, M.C.; Grass, G. Ultrasensitive Detection of Bacillus anthracis by Real-Time PCR Targeting a Polymorphism in Multi-Copy 16S rRNA Genes and Their Transcripts. Int. J. Mol. Sci. 2021, 22, 12224. [Google Scholar] [CrossRef]
- Jones, B.; Goodall, T.; George, P.B.L.; Gweon, H.S.; Puissant, J.; Read, D.S.; Emmett, B.A.; Robinson, D.A.; Jones, D.L.; Griffiths, R.I. Beyond Taxonomic Identification: Integration of ecological responses to a soil bacterial 16S rRNA gene database. Front. Microbiol. 2021, 12, 682886. [Google Scholar] [CrossRef]
- Wei Wang, M.S. Phylogenetic relationships between Bacillus species and related genera inferred from 16s rDNA sequences. Braz. J. Microbiol. 2009, 40, 505–521. [Google Scholar] [CrossRef] [Green Version]
- Guinebretière, M.H.; Velge, P.; Couvert, O.; Carlin, F.; Debuyser, M.L.; Nguyen-The, C. Ability of Bacillus cereus group strains to cause food poisoning varies according to phylogenetic affiliation (groups I to VII) rather than species affiliation. J. Clin. Microbiol. 2010, 48, 3388–3391. [Google Scholar] [CrossRef] [Green Version]
- Fernández-No, I.C.; Böhme, K.; Caamaño-Antelo, S.; Barros-Velázquez, J.; Calo-Mata, P. Identification of single nucleotide polymorphisms (SNPs) in the 16S rRNA gene of foodborne Bacillus spp. Food Microbiol. 2015, 46, 239–245. [Google Scholar] [CrossRef]
- Van Ert, M.N.; Easterday, W.R.; Simonson, T.S.; U’Ren, J.M.; Pearson, T.; Kenefic, L.J.; Busch, J.D.; Huynh, L.Y.; Dukerich, M.; Trim, C.B.; et al. Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis Ames strain. J. Clin. Microbiol. 2007, 45, 47–53. [Google Scholar] [CrossRef] [Green Version]
- Vogler, A.J.; Busch, J.D.; Percy-Fine, S.; Tipton-Hunton, C.; Smith, K.L.; Keim, P. Molecular analysis of rifampin resistance in Bacillus anthracis and Bacillus cereus. Antimicrob. Agents Chemother. 2002, 46, 511–513. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moorhead, S.M.; Dykes, G.A.; Cursons, R.T. An SNP-based PCR assay to differentiate between Listeria monocytogenes lineages derived from phylogenetic analysis of the sigB gene. J. Microbiol. Methods 2003, 55, 425–432. [Google Scholar] [CrossRef]
- Zhang, P.; Essendoubi, S.; Keenliside, J.; Reuter, T.; Stanford, K.; King, R.; Lu, P.; Yang, X. Publisher Correction: Genomic analysis of Shiga toxin-producing Escherichia coli O157:H7 from cattle and pork-production related environments. NPJ Sci. Food 2021, 5, 21. [Google Scholar] [CrossRef] [PubMed]
- Sacchi, C.T.; Whitney, A.M.; Mayer, L.W.; Morey, R.; Steigerwalt, A.; Boras, A.; Weyant, R.S.; Popovic, T. Sequencing of 16S rRNA gene: A rapid tool for identification of Bacillus anthracis. Emerg. Infect. Dis. 2002, 8, 1117–1123. [Google Scholar] [CrossRef]
- Rahman, M.M.; Lim, S.J.; Kim, W.H.; Cho, J.Y.; Park, Y.C. Prevalence data of diarrheagenic E. coli in the fecal pellets of wild rodents using culture methods and PCR assay. Data Brief 2020, 33, 106439. [Google Scholar] [CrossRef]
- Berkeley, R.C.W.; Logan, N.A.; Shute, L.A.; Capey, A.G. Identification of Bacillus species. In Methods in Microbiology; Bergan, T., Ed.; Academic Press: London, UK, 1984. [Google Scholar]
- Thompson, J.D.; Gibson, T.J.; Plewniak, F.; Jeanmougin, F.; Higgins, D.G. The CLUSTAL_X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 1997, 25, 4876–4882. [Google Scholar] [CrossRef] [Green Version]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Gaudet, M.; Fara, A.G.; Beritognolo, I.; Sabatti, M. Allele-specific PCR in SNP genotyping. Methods Mol. Bio. 2009, 578, 415–424. [Google Scholar]
- Hirotsu, N.; Murakami, N.; Kashiwagi, T.; Ujiie, K.; Ishimaru, K. Protocol: A simple gel-free method for SNP genotyping using allele-specific primers in rice and other plant species. Plant Methods 2010, 6, 12. [Google Scholar] [CrossRef] [Green Version]
- Zeng, Z.; He, X.; Li, F.; Zhang, Y.; Huang, Z.; Wang, Y.; Li, K.; Bao, Y.; Iqbal, M.; Fakhar-E-Alam Kulyar, M.; et al. Probiotic properties of Bacillus proteolyticus isolated from Tibetan Yaks, China. Front. Microbiol. 2021, 12, 649207. [Google Scholar] [CrossRef]
- Wu, X.Y.; Walker, M.; Vanselow, B.; Chao, R.L.; Chin, J. Characterization of mesophilic bacilli in faeces of feedlot cattle. J. Appl. Microbiol. 2007, 102, 872–879. [Google Scholar] [CrossRef] [PubMed]
- Han, S.K.; Shin, M.S.; Park, H.E.; Kim, S.Y.; Lee, W.K. Screening of bacteriocin-producing Enterococcus faecalis strains for antagonistic activities against Clostridium perfringens. Korean J. Food Sci. Anim. Resour. 2014, 34, 614–621. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chon, J.W.; Song, K.Y.; Kim, H.; Seo, K.H. Comparison of 3 selective media for enumeration of Bacillus cereus in several food matrixes. J. Food Sci. 2014, 79, M2480–M2484. [Google Scholar] [CrossRef] [PubMed]
- Tallent, S.M.; Kotewicz, K.M.; Strain, E.A.; Bennett, R.W. Efficient isolation and identification of Bacillus cereus group. J. AOAC Int. 2012, 95, 446–451. [Google Scholar] [CrossRef]
- Schloss, P.D.; Handelsman, J. Introducing DOTUR, a computer program for defining operational taxonomic units and estimating species richness. Appl. Environ. Microbiol. 2005, 71, 1501–1506. [Google Scholar] [CrossRef] [Green Version]
- Johnson, J.S.; Spakowicz, D.J.; Hong, B.Y.; Petersen, L.M.; Demkowicz, P.; Chen, L.; Leopold, S.R.; Hanson, B.M.; Agresta, H.O.; Gerstein, M.; et al. Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis. Nat. Commun. 2019, 10, 5029. [Google Scholar] [CrossRef] [Green Version]
- Daniele, D.; Sara, B.; Arianna, C.; Diego, M.; Pier, L.M.; Claudia, S. 16S–23S rRNA internal transcribed spacers as molecular markers for the species of the 16S rRNA group I of the genus Bacillus. FEMS Microbiol. Lett. 1998, 163, 229–236. [Google Scholar]
- Rhoads, D.D.; Cox, S.B.; Rees, E.J.; Sun, Y.; Wolcott, R.D. Clinical identification of bacteria in human chronic wound infections: Culturing vs. 16S ribosomal DNA sequencing. BMC Infect. Dis. 2012, 12, 321. [Google Scholar] [CrossRef] [Green Version]
- Valledor, S.; Valledor, I.; Gil-Rodríguez, M.C.; Seral, C.; Castillo, J. Comparison of several real-time PCR kits versus a culture-dependent algorithm to identify enteropathogens in stool samples. Sci. Rep. 2020, 10, 4301. [Google Scholar] [CrossRef] [Green Version]
- Rooney, A.P.; Price, N.P.J.; Ehrhardt, C.; Swezey, J.L.; Bannan, J.D. Phylogeny and molecular taxonomy of the Bacillus subtilis species complex and description of Bacillus subtilis subsp inaquosorum subsp. nov. Int. J. Syst. Evol. Microbiol. 2009, 59, 2429–2436. [Google Scholar] [CrossRef]
- Rasko, D.A.; Altherr, M.R.; Han, C.S.; Ravel, J. Genomics of the Bacillus cereus group of organisms. FEMS Microbiol. Rev. 2005, 29, 303–329. [Google Scholar] [PubMed]
- Tchesnokova, V.; Avagyan, H.; Billig, M.; Chattopadhyay, S.; Aprikian, P.; Chan, D.; Pseunova, J.; Rechkina, E.; Riddell, K.; Scholes, D.; et al. A novel 7-single nucleotide polymorphism-based clonotyping test allows rapid prediction of antimicrobial susceptibility of extraintestinal Escherichia coli directly from urine specimens. Open Forum Infect. Dis. 2016, 3, ofw002. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hakovirta, J.R.; Prezioso, S.; Hodge, D.; Pillai, S.P.; Weigel, L.M. Identification and analysis of informative single nucleotide polymorphisms in 16S rRNA gene sequences of the Bacillus cereus group. J. Clin. Microbiol. 2006, 54, 2749–2756. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Roonie, A.; Majumder, S.; Kingston, J.J.; Parida, M. Molecular characterization of B. anthracis isolates from the anthrax outbreak among cattle in Karnataka, India. BMC Microbiol. 2020, 20, 232. [Google Scholar] [CrossRef]
- Kuwana, R.; Imamura, D.; Takamatsu, H.; Watabe, K. Discrimination of the Bacillus cereus group members by pattern analysis of random amplified polymorphic DNA-PCR. Biocontrol. Sci. 2012, 17, 83–86. [Google Scholar] [CrossRef] [Green Version]
- Ohba, M.; Lee, D.H. Bacillus thuringiensis associated with faeces of the Kerama-jika, Cervus nippon keramae, a wild deer indigenous to the Ryukyus, Japan. J. Basic Microbiol. 2003, 43, 158–161. [Google Scholar] [CrossRef]
- Fritze, D. Taxonomy of the genus Bacillus and related genera: The aerobic endospore-forming bacteria. Phytopathology 2004, 94, 1245–1248. [Google Scholar] [CrossRef] [Green Version]
- Fan, B.; Blom, J.; Klenk, H.P.; Borriss, R. Bacillus amyloliquefaciens, Bacillus velezensis and Bacillus siamensis Form an “Operational Group B. amyloliquefaciens” within the B. subtilis species complex. Front. Microbiol. 2017, 8, 22. [Google Scholar] [CrossRef] [Green Version]
Identification | Primer Code | Primer Sequence | Primer Length (bp) | Annealing TEMPERATURE (°C) | PCR Product (bp) | Remarks a |
---|---|---|---|---|---|---|
Bacillus species-specific b | Ba_F | CGRACGGGTGAGTAACACG | 19 | 58 | 712 | Bacillus species-specific markers based on 16S rRNA (sequencing primers) |
Ba_R | GACTACCAGGGTATCTAATCC | 21 | ||||
Ba_F1 | GGAGGAACACCAGTGGCGAAG | 21 | 678 | |||
Ba_R1 | CCCGGGAACGTATTCACCGC | 20 | ||||
Bacillus cereus-specific | BcF1m | GGGAAGAACAAGTGCTAGTTGYAT | 24 | 62 | 583 | B. cereus-specific markers based on SNP-sites (this study); transversion mutation (altered bases) |
BCR1m | GAAGCCCTATCTCTAGGGRTT | 21 | ||||
BcF2m | CCAGGTCTTGACATCCTCTYAA | 22 | 65 | 174 | ||
BCR2m | GTCACCTTAGAGTGCCCAARTT | 22 |
Host | Fecal Id | Colony Id | Coverage | Similarity | bp | Accession | Matched Bacteria from NCBI (Accession No) | Bacillus Group |
---|---|---|---|---|---|---|---|---|
Apodemus agrarius | ONApPe_M1 | BA#01 | 99 | 99 | 1262 | MF139612 | Bacillus cereus ZLynn800-11 (KY316431.1) | B. cereus |
ONApPe_M2 | BA#02 | 100 | 100 | 1262 | MF139613 | B. siamensis FL11 (KY818929.1) | B. amyloliquefaciens | |
ONApPe_M3 | BA#03 | 100 | 100 | 1267 | MF139615 | B. siamensis KCTC 13613 (AJVF01000043) | ||
ONApPe_M10 | BA#10 | 100 | 99 | 1268 | MF139620 | B. amyloliquefaciens HY-5 (KY886133.1) | ||
ONApPe_M11 | BA#11 | 100 | 99 | 1267 | MF139619 | B. amyloliquefaciens IIHR (OL477453.1) | ||
ONApPe_M13 | BA#13 | 100 | 100 | 1268 | MF139622 | B. amyloliquefaciens HY-5 (KY886133.1) | ||
ONApPe_M14 | BA#14 | 99 | 100 | 1268 | MF139616 | B. amyloliquefaciens H5Y (KY886133.1) | ||
ONApPe_M15 | BA#15 | 100 | 99 | 1267 | MF139617 | B. amyloliquefaciens MN4 (KY305419.1) | ||
ONApPe_M18 | BA#18 | 100 | 100 | 1268 | MF139614 | B. velezensis GQJK49 (KY952710.1) | ||
ONApPe_M19 | BA#19 | 100 | 100 | 1267 | MF139618 | B. amyloliquefaciens 2M5-2 (KX267874.1) | ||
ONApPe_M33 | BA#33 | 100 | 99 | 1266 | MF139621 | B. amyloliquefaciens IIHR (OL477453.1) | ||
ONApPe_M38 | BA#38 | 100 | 99 | 1272 | MF139623 | B. amyloliquefaciens MN4 (KY305419.1) | ||
ONApPe_M39 | BA#39 | 100 | 100 | 1267 | MF139624 | B. amyloliquefaciens HY-5 (KY886133.1) | ||
ONApPe_M18 | BA#18 | - | - | - | - | - | Not found | |
ONApPe_M20 | BA#20 | - | - | - | - | - | ||
ONApPe_M37 | BA#37 | - | - | - | - | - | ||
Hydropotes inermis argyropus | SNHyIn_WD4 | BA#04 | 100 | 100 | 1267 | MF139625 | Bacillus sp. JDMASP69 (KX817970.1) | B. megaterium |
SNHyIn_WD5 | BA#05 | 100 | 100 | 1270 | MF139627 | B. megaterium JDMARP68 (KX817907.1) | ||
SNHyIn_WD6 | BA#06 | 100 | 100 | 1268 | MF139629 | B. megaterium T11-11.1 (OM062585.1) | ||
SNHyIn_WD7 | BA#07 | 100 | 99 | 1270 | MF139628 | B. megaterium strain ZLynn800-19 (KY316435.1) | ||
SNHyIn_WD8 | BA#08 | x | x | x | x | Chimeric | ||
SNHyIn_WD9 | BA#09 | 100 | 100 | 1269 | MF139626 | B. megaterium 1000-18 (KY316449.1) | ||
SNHyIn_WD10 | BA#10 | - | - | - | - | - | Not found | |
SNHyIn_WD16 | BA#16 | - | - | - | - | - | ||
SNHyIn_WD25 | BA#25 | - | - | - | - | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rahman, M.-M.; Lim, S.-J.; Park, Y.-C. Molecular Identification of Bacillus Isolated from Korean Water Deer (Hydropotes inermis argyropus) and Striped Field Mouse (Apodemus agrarius) Feces by Using an SNP-Based 16S Ribosomal Marker. Animals 2022, 12, 979. https://doi.org/10.3390/ani12080979
Rahman M-M, Lim S-J, Park Y-C. Molecular Identification of Bacillus Isolated from Korean Water Deer (Hydropotes inermis argyropus) and Striped Field Mouse (Apodemus agrarius) Feces by Using an SNP-Based 16S Ribosomal Marker. Animals. 2022; 12(8):979. https://doi.org/10.3390/ani12080979
Chicago/Turabian StyleRahman, Md-Mafizur, Sang-Jin Lim, and Yung-Chul Park. 2022. "Molecular Identification of Bacillus Isolated from Korean Water Deer (Hydropotes inermis argyropus) and Striped Field Mouse (Apodemus agrarius) Feces by Using an SNP-Based 16S Ribosomal Marker" Animals 12, no. 8: 979. https://doi.org/10.3390/ani12080979
APA StyleRahman, M.-M., Lim, S.-J., & Park, Y.-C. (2022). Molecular Identification of Bacillus Isolated from Korean Water Deer (Hydropotes inermis argyropus) and Striped Field Mouse (Apodemus agrarius) Feces by Using an SNP-Based 16S Ribosomal Marker. Animals, 12(8), 979. https://doi.org/10.3390/ani12080979