Impact of Feeding Fermented Palm Kernel Cake and High Dietary Fat on Nutrient Digestibility, Enzyme Activity, Intestinal Morphology and Intestinal Nutrient Transporters mRNA Expression in Broiler Chickens under Hot and Humid Conditions
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methodology
2.1. Birds and Management
2.2. Diets and Experimental Design
2.3. Samples and Data Collection
2.4. Digestive Enzyme Activity
2.5. Nutrient Digestibility
2.6. Intestinal Histomorphology
2.7. mRNA Analysis of Nutrient Transporter
2.8. Statistical Analyses
3. Results
3.1. Nutrient Digestibility
3.2. Intestinal Digestive Enzyme Activity
3.3. Intestinal Morphology Indices
3.4. Gene Expressions of Nutrient Transporters Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Sharmila, A.; Alimon, A.R.; Azhar, K.; Noor, H.M.; Samsudin, A.A. Improving nutritional values of palm kernel cake (PKC) as poultry feeds: A review. Malays. J. Anim. Sci. 2014, 17, 1–18. [Google Scholar]
- Abdollahi, M.R.; Hosking, B.; Ravindran, V. Nutrient analysis, metabolisable energy and ileal amino acid digestibility of palm kernel meal for broilers. Anim. Feed Sci. Technol. 2015, 206, 119–125. [Google Scholar] [CrossRef]
- Alshelmani, M.; Kaka, U.; Abdalla, E.; Humam, A.; Zamani, H. Effect of feeding fermented and non-fermented palm kernel cake on the performance of broiler chickens: A review. World’s Poult. Sci. J. 2021, 77, 377–388. [Google Scholar] [CrossRef]
- Saenphoom, P.; Liang, J.B.; Ho, Y.W.; Loh, T.C.; Rosfarizan, M. Effects of enzyme treated palm kernel expeller on metabolizable energy, growth performance, villus height and digesta viscosity in broiler chickens. Asian-Australas. J. Anim. Sci. 2013, 26, 537–544. [Google Scholar] [CrossRef] [Green Version]
- Alshelmani, M.I.; Loh, T.C.; Foo, H.L.; Sazili, A.Q.; Lau, W.H. Effect of feeding different levels of palm kernel cake fermented by Paenibacillus polymyxa ATCC 842 on nutrient digestibility, intestinal morphology, and gut microflora in broiler chickens. Anim. Feed Sci. Technol. 2016, 216, 216–224. [Google Scholar] [CrossRef] [Green Version]
- Zulkifli, I.; Ginsos, J.; Liew, P.K.; Gilbert, J. Growth performance and Newcastle disease antibody titres of broiler chickens fed palm-based diets and their response to heat stress during fasting. Eur. Poult. Sci. 2003, 67, 125–130. [Google Scholar]
- Hakim, A.H.; Zulkifli, I.; Farjam, A.S.; Awad, E.A. Feeding fermented palm kernel cake with higher levels of dietary fat improved gut bacterial population and blood lipid concentration but not the growth performance in broiler chickens. Ital. J. Anim. Sci. 2021, 20, 1671–1680. [Google Scholar] [CrossRef]
- Choct, M.; Hughes, R.J.; Wang, J.; Bedford, M.R.; Morgan, A.J.; Annison, G. Increased small intestinal fermentation is partly responsible for the anti-nutritive activity of non-starch polysaccharides in chickens. Br. Poult. Sci. 1996, 37, 609–621. [Google Scholar] [CrossRef]
- Choct, M.; Hughes, R.J.; Bedford, M.R. Effects of a xylanase on individual bird variation, starch digestion throughout the intestine, and ileal and caecal volatile fatty acid production in chickens fed wheat. Br. Poult. Sci. 1999, 40, 419–422. [Google Scholar] [CrossRef]
- Hetland, H.; Svihus, B. Effect of oat hulls on performance, gut capacity and feed passage time in broiler chickens. Br. Poult. Sci. 2001, 42, 354–361. [Google Scholar] [CrossRef]
- Mateos, G.G.; Sell, J.L.; Eastwood, J.A. Rate of food passage (transit time) as influenced by level of supplemental fat. Poult. Sci. 1982, 61, 94–100. [Google Scholar] [CrossRef]
- Brue, R.N.; Latshaw, J.D. Energy Utilization by the Broiler Chicken as Affected by Various Fats and Fat Levels. Poult. Sci. 1985, 64, 2119–2130. [Google Scholar] [CrossRef]
- Rochell, S.J.; Applegate, T.J.; Kim, E.J.; Dozier, W.A., 3rd. Effects of diet type and ingredient composition on rate of passage and apparent ileal amino acid digestibility in broiler chicks. Poult. Sci. 2012, 91, 1647–1653. [Google Scholar] [CrossRef]
- Annison, G.; Choct, M. Anti-nutritive activities of cereal non-starch polysaccharides in broiler diets and strategies minimizing their effects. World’s Poult. Sci. J. 1991, 47, 232–242. [Google Scholar] [CrossRef]
- González-Alvarado, J.M.; Jiménez-Moreno, E.; González-Sánchez, D.; Lázaro, R.; Mateos, G.G. Effect of inclusion of oat hulls and sugar beet pulp in the diet on productive performance and digestive traits of broilers from 1 to 42 days of age. Anim. Feed Sci. Technol. 2010, 162, 37–46. [Google Scholar] [CrossRef]
- Knudsen, K.E.B.; Jensen, B.B.; Hansen, I. Digestion of polysaccharides and other major components in the small and large intestine of pigs fed on diets consisting of oat fractions rich in β-D-glucan. Br. J. Nutr. 1993, 70, 537–556. [Google Scholar] [CrossRef]
- Le Gall, M.; Serena, A.; Jørgensen, H.; Theil, P.K.; Knudsen, K.E.B. The role of whole-wheat grain and wheat and rye ingredients on the digestion and fermentation processes in the gut–a model experiment with pigs. Br. J. Nutr. 2009, 102, 1590–1600. [Google Scholar] [CrossRef] [Green Version]
- Yaghobfar, A.; Kalantar, M. Effect of Non-Starch Polysaccharide (NSP) of Wheat and Barley Supplemented with Exogenous Enzyme Blend on Growth Performance, Gut Microbial, Pancreatic Enzyme Activities, Expression of Glucose Transporter (SGLT1) and Mucin Producer (MUC2) Genes of Broiler Chickens. Rev. Bras. Ciência Avícola 2017, 19, 629–638. [Google Scholar] [CrossRef] [Green Version]
- Alshelmani, M.I.; Loh, T.C.; Foo, H.L.; Lau, W.H.; Sazili, A.Q. Biodegradation of palm kernel cake by cellulolytic and hemicellulolytic bacterial cultures through solid state fermentation. Sci. World J. 2014, 2014, 729852. [Google Scholar] [CrossRef]
- Marini, A.M.; Daud, M.J.; Noraini, S.; Azahan, E.A.E. Performance of locally isolated microorganism in degrading palm kernel cake (PKC) fibre and improving the nutritional value of fermented PKC. J. Trop. Agric. Food Sci. 2005, 33, 311–319. [Google Scholar]
- Roslan, M.A.H.; Abdullah, N.; Mustafa, S. Removal of shells in palm kernel cake via static cling and electrostatic separation. J. Biochem. Microbiol. Biotechnol. 2015, 3, 1–6. [Google Scholar]
- Saenphoom, P.; Liang, J.B.; Ho, Y.W.; Loh, T.C.; Rosfarizan, M. Effect of enzyme treatment on chemical composition and production of reducing sugars in palm (Elaeis guineenis) kernel expeller. Afr. J. Biotechnol. 2011, 10, 15372–15377. [Google Scholar] [CrossRef]
- Hakim, A.H.; Zulkifli, I.; Soleimani Farjam, A.; Awad, E.A.; Abdullah, N.; Chen, W.L.; Mohamad, R. Passage time, apparent metabolisable energy and ileal amino acids digestibility of treated palm kernel cake in broilers under the hot and humid tropical climate. Ital. J. Anim. Sci. 2020, 19, 194–202. [Google Scholar] [CrossRef] [Green Version]
- Gilbert, E.R.; Li, H.; Emmerson, D.A.; Webb, K.E.; Wong, E.A. Developmental regulation of nutrient transporter and enzyme mRNA abundance in the small intestine of broilers. Poult. Sci. 2007, 86, 1739–1753. [Google Scholar] [CrossRef]
- Yokhana, J.S.; Parkinson, G.; Frankel, T.L. Effect of insoluble fiber supplementation applied at different ages on digestive organ weight and digestive enzymes of layer-strain poultry. Poult. Sci. 2016, 95, 550–559. [Google Scholar] [CrossRef]
- Jiang, Z.; Zhou, Y.; Lu, F.; Han, Z.; Wang, T. Effects of different levels of supplementary alpha-amylase on digestive enzyme activities and pancreatic amylase mRNA expression of young broilers. Asian-Australas. J. Anim. Sci. 2008, 21, 97–102. [Google Scholar] [CrossRef]
- Jin, L.Z.; Ho, Y.W.; Abdullah, N.; Jalaludin, S. Digestive and bacterial enzyme activities in broilers fed diets supplemented with Lactobacillus cultures. Poult. Sci. 2000, 79, 886–891. [Google Scholar] [CrossRef]
- Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligosaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef]
- Pinheiro, D.F.; Cruz, V.C.; Sartori, J.R.; Vicentini Paulino, M.L.M. Effect of early feed restriction and enzyme supplementation on digestive enzyme activities in broilers. Poult. Sci. 2004, 83, 1544–1550. [Google Scholar] [CrossRef]
- Almirall, M.; Francesch, M.; Perez-vendrell, A.M.; Esteve-garcia, J.B.E. The differences in intestinal viscosity produced by barley and β-glucanase alter digesta enzyme activities and ileal nutrient digestibilities more in broiler chicks than in cocks. Am. Inst. Nutr. 1995, 125, 947–955. [Google Scholar]
- Guo, S.; Liu, D.; Zhao, X.; Li, C.; Guo, Y. Xylanase supplementation of a wheat-based diet improved nutrient digestion and mRNA expression of intestinal nutrient transporters in broiler chickens infected with Clostridium perfringens. Poult. Sci. 2014, 93, 94–103. [Google Scholar] [CrossRef]
- Longstaff, M.; McNab, J.M. The inhibitory effects of hull polysaccharides and tannins of field beans (Vicia faba L.) on the digestion of amino acids, starch and lipid and on digestive enzyme activities in young chicks. Br. J. Nutr. 1991, 65, 199–216. [Google Scholar] [CrossRef] [Green Version]
- Hu, Y.; Smith, D.E.; Ma, K.; Jappar, D.; Thomas, W.; Hillgren, K.M. Targeted disruption of peptide transporter pept1 gene in mice significantly reduces dipeptide absorption in intestine. Mol. Pharm. 2008, 5, 1122–1130. [Google Scholar] [CrossRef] [Green Version]
- Regnault, T.R.H.; De Vrijer, B.; Battaglia, F.C. Transport and metabolism of amino acids in placenta. Endocrine 2002, 19, 23–41. [Google Scholar] [CrossRef]
- Röder, P.V.; Geillinger, K.E.; Zietek, T.S.; Thorens, B.; Koepsell, H.; Daniel, H. The role of SGLT1 and GLUT2 in intestinal glucose transport and sensing. PLoS ONE 2014, 9, 20–22. [Google Scholar] [CrossRef]
- Ebrahimi, R.; Jahromi, M.F.; Liang, J.B.; Farjam, A.S.; Shokryazdan, P.; Idrus, Z. Effect of dietary lead on intestinal nutrient transporters mRNA expression in broiler chickens. BioMed Res. Int. 2015, 2015, 149745. [Google Scholar] [CrossRef] [Green Version]
- Habashy, W.S.; Milfort, M.C.; Adomako, K.; Attia, Y.A.; Rekaya, R.; Aggrey, S.E. Effect of heat stress on amino acid digestibility and transporters in meat-type chickens Gene Expression of Amino Acid. Poult. Sci. 2017, 96, 2312–2319. [Google Scholar] [CrossRef]
- Sun, X.; Zhang, H.; Sheikhahmadi, A.; Wang, Y.; Jiao, H.; Lin, H.; Song, Z. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus domesticus). Int. J. Biometeorol. 2015, 59, 127–135. [Google Scholar] [CrossRef]
- Tan, W.L. Fermentation of Palm Kernel Cake by Indigenous Lactic Acid Bacteria as Potential Poultry Feed Ingredients. Master’s Thesis, Universiti Putra Malaysia, Serdang, Malaysia, 2016. [Google Scholar]
- Farouk, M.M.; Al-Mazeedi, H.M.; Sabow, A.B.; Bekhit, A.E.D.; Adeyemi, K.D.; Sazili, A.Q.; Ghani, A. Halal and kosher slaughter methods and meat quality: A review. Meat Sci. 2014, 98, 505–519. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis of the Association of Official Analytical Chemists, 15th ed.; VA: AOAC Inc.: Arlington, TX, USA, 1990. [Google Scholar]
- Short, F.J.; Gorton, P.; Wiseman, J.; Boorman, K.N. Determination of titanium dioxide added as an inert marker in chicken digestibility studies. Anim. Feed Sci. Technol. 1996, 59, 215–221. [Google Scholar] [CrossRef]
- Awad, E.A.; Zulkifli, I.; Farjam, A.S.; Loh, T.C.; Hossain, M.A.; Ahmed, A. Effect of low-protein diet, gender and age on the apparent ileal amino acid digestibility in broiler chickens raised under hot-humid tropical condition. Indian J. Anim. Sci. 2016, 86, 696–701. [Google Scholar]
- Awad, E.A. Effects of Feeding Low-Protein Diets Fortified with Amino Acids on Broiler Chickens under High Environmental Temperatures. Ph.D. Thesis, Universiti Putra Malaysia, Serdang, Malaysia, 2016. [Google Scholar]
- Izuddin, W.I.; Loh, T.C.; Foo, H.L.; Samsudin, A.A.; Humam, A.M. Postbiotic L. plantarum RG14 improves ruminal epithelium growth, immune status and upregulates the intestinal barrier function in post-weaning lambs. Sci. Rep. 2019, 9, 9938. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- SAS. SAS/STAT Software, Version 9.4; SAS Inst. Inc.: Cary, NC, USA, 2005.
- Jaafar, M.D.; Jarvis, M.C. Mannan of oil palm kernel. Phytochemistry 1992, 31, 463–464. [Google Scholar] [CrossRef]
- Chen, W.L.; Liang, J.B.; Jahromi, M.F.; Abdullah, N.; Ho, Y.W.; Tufarelli, V. Enzyme treatment enhances release of prebiotic oligosaccharides from palm kernel expeller. BioResources 2015, 10, 196–209. [Google Scholar] [CrossRef]
- Choct, M. Feed non-starch polysaccharides: Chemical structures and nutritional significance. Feed Milling Int. 1997, 191, 13–26. [Google Scholar]
- Navidshad, B.; Liang, J.B.; Jahromi, M.F.; Akhlaghi, A.; Abdullah, N. Effects of enzymatic treatment and shell content of palm kernel expeller meal on performance, nutrient digestibility, and ileal bacterial population in broiler chickens. J. Appl. Poult. Res. 2016, 25, 474–482. [Google Scholar] [CrossRef]
- Honda, K.; Kamisoyama, H.; Isshiki, Y.; Hasegawa, S. Effects of Dietary Fat Levels on Nutrient Digestibility at Different Sites of Chicken Intestines. J. Poult. Sci. 2009, 46, 291–295. [Google Scholar] [CrossRef] [Green Version]
- Mathiavanan, R.; Selvaraj, P.; Nanjappan, K. Feeding of fermented soybean meal on broiler performance. Int. J. Poult. Sci. 2006, 5, 868–872. [Google Scholar]
- Feng, J.; Liu, X.; Xu, Z.R.; Wang, Y.Z.; Liu, J.X. Effects of fermented soybean meal on digestive enzyme activities and intestinal morphology in broilers. Poult. Sci. 2007, 86, 1149–1154. [Google Scholar] [CrossRef]
- Luo, D.; Yanga, F.; Yang, X.; Yao, J.; Shi, B.; Zhou, Z. Effects of xylanase on performance, blood parameters, intestinal morphology, microflora and digestive enzyme activities of broilers fed wheat-based diets. Asian-Australas. J. Anim. Sci. 2009, 22, 1288–1295. [Google Scholar] [CrossRef]
- Petersen, S.T.; Wiseman, J.; Bedford, M.R. Effects of age and diet on the viscosity of intestinal contents in broiler chicks. Br. Poult. Sci. 1999, 40, 364–370. [Google Scholar] [CrossRef]
- Zhu, H.L.; Hu, L.L.; Hou, Y.Q.; Zhang, J.; Ding, B.Y. The effects of enzyme supplementation on performance and digestive parameters of broilers fed corn-soybean diets. Poult. Sci. 2014, 93, 1704–1712. [Google Scholar] [CrossRef]
- Chen, X.; Murdoch, R.; Zhang, Q.; Shafer, D.J.; Applegate, T.J. Effects of dietary protein concentration on performance and nutrient digestibility in Pekin ducks during aflatoxicosis. Poult. Sci. 2016, 95, 834–841. [Google Scholar] [CrossRef]
- Hulan, H.W.; Bird, F.H. Effect of fat level in isonitrogenous diets on the composition of avian pancreatic juice. J. Nutr. 1972, 102, 459–468. [Google Scholar] [CrossRef] [Green Version]
- Dowling, R.H.; Booth, C.C. Structural and functional changes following small intestinal resection in the rats. Clin. Sci. 1967, 32, 139–149. [Google Scholar]
- Yamauchi, K.-E.; Nakamura, E.; Isshiki, Y. Development with the of the intestinal epithelial villi cell associated increased in chickens mitosis. Anim. Sci. Technol. 1993, 64, 340–350. [Google Scholar]
- Yason, C.V.; Summers, B.A.; Schat, K.A. Pathogenesis of rotavirus infection in various age groups of chickens and turkeys: Pathology. Am. J. Vet. Res. 1987, 48, 927–938. [Google Scholar]
- Jahromi, M.F.; Liang, J.B.; Abdullah, N.; Goh, Y.M.; Ebrahimi, R.; Shokryazdan, P. Extraction and characterization of oligosaccharides from palm kernel cake as prebiotic. BioResources 2016, 11, 674–695. [Google Scholar] [CrossRef]
- Roslan, M.A.H.; Abdullah, N.; Abdul Murad, N.Z.; Halmi, M.I.E.; Zulkifli, I.; Mustafa, S. Optimisation of extrusion for enhancing the nutritive value of palm kernel cake using response surface methodology. BioResources 2017, 12, 6679–6697. [Google Scholar]
- Iji, P.A.; Saki, A.A.; Tivey, D. R Intestinal structure and function of broiler chickens on diets supplemented with a mannan oligosaccharide. J. Sci. Food Agric. 2001, 81, 1186–1192. [Google Scholar] [CrossRef]
- Yang, Y.; Iji, P.A.; Kocher, A.; Mikkelsen, L.L.; Choctt, M. Effects of mannanoligosaccharide on growth performance, the development of gut microflora, and gut function of broiler chickens raised on new litter. J. Appl. Poult. Res. 2007, 16, 280–288. [Google Scholar] [CrossRef]
- Teng, P.Y.; Kim, W.K. Review: Roles of Prebiotics in Intestinal Ecosystem of Broilers. Front. Vet. Sci. 2018, 5, 245. [Google Scholar] [CrossRef]
- Almirall, M.; Esteve-Garcia, E. Rate of passage of barley diets with chromium oxide: Influence of age and poultry strain and effect of β-glucanase supplementation. Poult. Sci. 1994, 73, 1433–1440. [Google Scholar] [CrossRef]
- Incharoen, T.; Yamauchi, K.-E.; Erikawa, T.; Gotoh, H. Histology of intestinal villi and epithelial cells in chickens fed low-crude protein or low-crude fat diets. Ital. J. Anim. Sci. 2016, 9, e82. [Google Scholar] [CrossRef]
- Schiavone, A.; Dabbou, S.; De Marco, M.; Cullere, M.; Biasato, I.; Biasibetti, E.; Capucchio, M.T.; Bergagna, S.; Dezzutto, D.; Meneguz, M.; et al. Black soldier fly larva fat inclusion in finisher broiler chicken diet as an alternative fat source. Animal 2018, 12, 2032–2039. [Google Scholar] [CrossRef]
- Sharifi, S.D.; Dibamehr, A.; Lotfollahian, H.; Baurhoo, B. Effects of flavomycin and probiotic supplementation to diets containing different sources of fat on growth performance, intestinal morphology, apparent metabolizable energy, and fat digestibility in broiler chickens. Poult. Sci. 2012, 91, 918–927. [Google Scholar] [CrossRef]
- Ullah, S.; Zhang, J.; Xu, B.; Tegomo, A.F.; Sagada, G.; Zheng, L.; Wang, L.; Shao, Q. Effect of dietary supplementation of lauric acid on growth performance, antioxidative capacity, intestinal development and gut microbiota on black sea bream (Acanthopagrus schlegelii). PLoS ONE 2022, 17, e0262427. [Google Scholar] [CrossRef]
- Lin, Y.; Hu, S.-Z.; Sun, Y.; Jin, L.; Wang, C.-K.; Gao, Y.-Y. Effects of bacitracin zinc, potassium diformate and lauric acid on duodenal digestive functions, intestinal morphology and caecal microflora of broilers. Czech J. Anim. Sci. 2022, 67, 65–74. [Google Scholar] [CrossRef]
- Al-Khalaifah, H.S.; Shahin, S.E.; Omar, A.E.; Mohammed, H.A.; Mahmoud, H.I.; Ibrahim, D. Effects of graded levels of microbial fermented or enzymatically treated dried brewer’s grains on growth, digestive and nutrient transporter genes expression and cost effectiveness in broiler chickens. BMC Vet. Res. 2020, 16, 424. [Google Scholar] [CrossRef]
- Saleh, A.A.; El-Far, A.H.; Abdel-Latif, M.A.; Emam, M.A.; Ghanem, R.; El-Hamid, H.S.A. Exogenous dietary enzyme formulations improve growth performance of broiler chickens fed a low-energy diet targeting the intestinal nutrient transporter genes. PLoS ONE 2018, 13, e0198085. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ramiah, S.K.; Abdullah, N.; Akhmal, M.; Mookiah, S.; Farjam, A.S.; Li, C.W.; Boo, L.J.; Idrus, Z. Effect of feeding less shell, extruded and enzymatically treated palm kernel cake on expression of growth-related genes in broiler chickens. Ital. J. Anim. Sci. 2019, 18, 997–1004. [Google Scholar] [CrossRef] [Green Version]
- Jahromi, M.F.; Shokryazdan, P.; Idrus, Z.; Ebrahimi, R.; Liang, J.B. In Ovo and dietary administration of oligosaccharides extracted from palm kernel cake influence general health of pre- and neonatal broiler chicks. PLoS ONE 2017, 12, e0184553. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.L.; Jahromi, M.F.; Candyrine, S.C.L.; Liang, J.B.; Abdullah, N.; Idrus, Z. Enzymatic hydrolysis drastically reduces fibre content of palm-kernel expeller, but without enhancing performance in broiler chickens. Anim. Prod. Sci. 2018, 59, 2131–2137. [Google Scholar] [CrossRef]
- Wilson, T.H.; Vincent, T.N. Absorption of Sugars in Vitro by the Intestine of the Golden Hamster. J. Biol. Chem. 1955, 216, 851–866. [Google Scholar] [CrossRef]
Experimental Period | Temperature, °C | Relative Humidity, % | ||
---|---|---|---|---|
Minimum | Maximum | Minimum | Maximum | |
Week 1 | 24 | 33 | 58 | 88 |
Week 2 | 23 | 33 | 64 | 90 |
Week 3 | 23 | 31 | 68 | 95 |
Week 4 | 24 | 34 | 62 | 90 |
Week 5 | 25 | 36 | 62 | 88 |
Ingredient (%, as Fed Basis) | Diets | ||||
---|---|---|---|---|---|
Starter (Day 1–21) | Finisher (Day 22–35) | ||||
LPKC-LO | LPKC-HI | PKC-LO | PKC-HI | ||
Corn | 51.26 | 45.53 | 39.63 | 42.91 | 35.77 |
Corn gluten meal | - | 6.67 | - | 7.96 | - |
Soybean meal | 40.00 | 7.93 | 27.56 | - | 19.18 |
Fullfat soybean meal | - | 11.22 | - | 20.43 | 12.23 |
Fermented PKC | - | 20.00 | 20.00 | - | - |
PKC | - | - | - | 20.00 | 20.00 |
Palm oil | 5.00 | 5.00 | 9.50 | 5.00 | 9.50 |
L-Lysine | 0.07 | 0.41 | 0.13 | 0.45 | 0.15 |
DL-Methionine | 0.28 | 0.21 | 0.25 | 0.21 | 0.27 |
L-Threonine | - | 0.08 | 0.06 | 0.09 | 0.08 |
DCP | 1.82 | 1.53 | 1.48 | 1.53 | 1.47 |
Limestone | 0.92 | 0.65 | 0.65 | 0.65 | 0.63 |
Salt | 0.50 | 0.35 | 0.35 | 0.35 | 0.35 |
Vitamin Premix | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
Mineral Premix | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
Choline Chloride | - | 0.08 | 0.05 | 0.07 | 0.03 |
Antioxidant | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
Toxin binder | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
Nutrients composition calculated (%, unless stated otherwise) | |||||
ME (kcal/kg) | 3065.00 | 3177.00 | 3177.00 | 3177.00 | 3177.00 |
CP | 22.36 | 19.67 | 19.67 | 19.67 | 19.67 |
EE | 7.52 | 9.98 | 12.36 | 11.36 | 14.21 |
CF | 3.01 | 4.36 | 4.55 | 5.46 | 5.77 |
NDF | 11.62 | 22.86 | 22.58 | 24.01 | 23.93 |
Dig Lys | 1.18 | 0.96 | 0.95 | 0.96 | 0.96 |
Dig Met + Cys | 0.88 | 0.75 | 0.74 | 0.75 | 0.75 |
Dig Thr | 0.77 | 0.65 | 0.65 | 0.65 | 0.66 |
Gene | Primer Sequences | Product Size (bp) | Reference |
---|---|---|---|
FABP1 | F: ACTGGCTCCAAAGAATGACCAATG | 163 | (Sun et al., 2015) |
R: TGTCTCCGTTGAGTTCGGTCAC | |||
r-BAT | F: CTTCGCAACAGTGAGCTACCCATA | 109 | (Sun et al., 2015) |
R: TAAAGACGCTGTCTAACCCATCCAA | |||
EAAT3 | F: TGCTGCTTTGGATTCCAGTGT | 79 | (Ebrahimi et al., 2015) |
R: AGCAATGACTGTAGTGCAGAAGTAATATATG | |||
PepT-1 | F: CCCCTGAGGAGGATCACTGTT | 205 | (Ebrahimi et al., 2015) |
R: CAAAAGAGCAGCAGCAACGA | |||
SGLT-1 | F: TGTCTCTCTGGCAAGAACATGTC | 229 | (Ebrahimi et al., 2015) |
R: GGGCAAGAGCTTCAGGTATCC | |||
SGLT-5 | F: ATACCCAAGGTAATAGTCCCAAAC | 75 | (Ebrahimi et al., 2015) |
R: TGGGTCCCTGAACAAATGAAA | |||
GAPDH | F: GCCGTCCTCTCTGGCAAAG | 128 | (Ebrahimi et al., 2015) |
R: TGTAAACCATGTAGTTCAGATCGATGA |
Diet | Nutrient, % | ||||
---|---|---|---|---|---|
DM | GE | CP | EE | Ash | |
Type of PKC | |||||
PKC | 59.58 ± 1.10 | 60.87 ± 0.94 | 75.31 ± 0.55 | 89.38 ± 0.72 | 37.56 ± 1.79 |
LPKC | 61.16 ± 0.95 | 62.79 ± 0.92 | 75.98 ± 0.72 | 87.36 ± 0.91 | 39.24 ± 1.67 |
Level of Oil | |||||
Low | 57.78 ± 1.29 b | 60.10 ± 0.93 b | 73.87 ± 0.36 b | 87.46 ± 0.93 | 35.52 ± 1.19 b |
High | 62.97 ± 1.61 a | 63.56 ± 0.70 a | 77.43 ± 0.36 a | 89.28 ± 0.72 | 41.27 ± 1.79 a |
p-Value | |||||
Types of PKC | 0.4510 | 0.1091 | 0.2056 | 0.0934 | 0.4572 |
Level of Oil | 0.0200 | 0.0065 | <0.0001 | 0.1284 | 0.0175 |
PKC × Oil | 0.2413 | 0.8665 | 0.5931 | 0.8137 | 0.7549 |
Diet | Amylase, U | Protease, U | Lipase, U |
---|---|---|---|
Type of PKC | |||
PKC | 10,256.60 ± 410.26 | 2233.00 ± 77.55 | 27.59 ± 1.10 |
LPKC | 11,659.40 ± 466.38 | 2240.00 ± 96.32 | 26.58 ± 1.03 |
Level of Oil | |||
5.0% | 13,485.90 ± 458.92 a | 2238.10 ± 70.24 | 25.90 ± 1.18 |
9.5% | 8201.70 ± 354.10 b | 2233.20 ± 89.34 | 28.27 ± 0.86 |
p-Value | |||
Types of PKC | 0.0586 | 0.9191 | 0.4974 |
Level of Oil | <0.0001 | 0.8876 | 0.1198 |
PKC × Oil | 0.4964 | 0.5042 | 0.4469 |
Diet | Duodenum, µm | Jejunum, µm | Ileum, µm | |||
---|---|---|---|---|---|---|
Villi Height | Crypt Depth | Villi Height | Crypt Depth | Villi Height | Crypt Depth | |
Type of PKC | ||||||
PKC | 1178.61 ± 42.50 b | 190.19 ± 7.00 | 1077.32 ± 24.79 | 146.85 ± 3.91 b | 804.54 ± 20.13 | 139.26 ± 4.57 b |
LPKC | 1401.12 ± 54.51 a | 180.21 ± 4.49 | 1073.58 ± 31.69 | 166.30 ± 5.61 a | 803.95 ± 24.10 | 158.71 ± 6.04 a |
Level of Oil | ||||||
5% | 1165.19 ± 45.17 b | 187.86 ± 6.70 | 1052.23 ± 26.02 | 157.29 ± 4.82 | 784.83 ± 19.66 | 148.92 ± 4.85 |
9.5% | 1414.54 ± 48.11 a | 182.54 ± 5.16 | 1098.67 ± 29.50 | 155.86 ± 6.00 | 823.66 ± 23.44 | 149.04 ± 6.81 |
p-Value | ||||||
Type of PKC | 0.0003 | 0.2482 | 0.9274 | 0.0103 | 0.9580 | 0.0193 |
Level of Oil | <0.0001 | 0.5348 | 0.2634 | 0.8418 | 0.2279 | 0.9883 |
PKC × Oil | 0.7879 | 0.4416 | 0.8558 | 0.9212 | 0.5993 | 0.9410 |
Diet | mRNA Expression of Transporter, Folds Change | |||||
---|---|---|---|---|---|---|
SGLT-1 | SGLT-5 | Pep-T1 | r-BAT | EAAT3 | FABP1 | |
Types of PKC | ||||||
PKC | 1.49 ± 0.06 | 1.40 ± 0.05 a | 0.46 ± 0.02 | 1.35 ± 0.07 b | 1.55 ± 0.07 b | 4.65 ± 0.18 a |
LPKC | 1.38 ± 0.07 | 1.07 ± 0.06 b | 0.47 ± 0.03 | 1.79 ± 0.08 a | 2.04 ± 0.09 a | 3.39 ± 0.16 b |
Level of Oil | ||||||
Low | 1.00 ± 0.03 b | 0.98 ± 0.04 b | 0.38 ± 0.01 b | 1.26 ± 0.05 b | 1.33 ± 0.07 b | 3.74 ± 0.22 b |
High | 1.87 ± 0.06 a | 1.49 ± 0.04 a | 0.56 ± 0.02 a | 1.88 ± 0.07 a | 2.25 ± 0.11 a | 4.30 ± 0.19 a |
p-Value | ||||||
Types of PKC | 0.0831 | <0.0001 | 0.8092 | <0.0001 | <0.0001 | <0.0001 |
Level of Oil | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | 0.0159 |
PKC × Oil | 0.0897 | 0.2219 | 0.5101 | 0.0897 | 0.2617 | 0.2404 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hakim, A.H.; Zulkifli, I.; Farjam, A.S.; Awad, E.A.; Ramiah, S.K. Impact of Feeding Fermented Palm Kernel Cake and High Dietary Fat on Nutrient Digestibility, Enzyme Activity, Intestinal Morphology and Intestinal Nutrient Transporters mRNA Expression in Broiler Chickens under Hot and Humid Conditions. Animals 2022, 12, 882. https://doi.org/10.3390/ani12070882
Hakim AH, Zulkifli I, Farjam AS, Awad EA, Ramiah SK. Impact of Feeding Fermented Palm Kernel Cake and High Dietary Fat on Nutrient Digestibility, Enzyme Activity, Intestinal Morphology and Intestinal Nutrient Transporters mRNA Expression in Broiler Chickens under Hot and Humid Conditions. Animals. 2022; 12(7):882. https://doi.org/10.3390/ani12070882
Chicago/Turabian StyleHakim, Ali Hanafiah, Idrus Zulkifli, Abdoreza Soleimani Farjam, Elmutaz Atta Awad, and Suriyah Kumari Ramiah. 2022. "Impact of Feeding Fermented Palm Kernel Cake and High Dietary Fat on Nutrient Digestibility, Enzyme Activity, Intestinal Morphology and Intestinal Nutrient Transporters mRNA Expression in Broiler Chickens under Hot and Humid Conditions" Animals 12, no. 7: 882. https://doi.org/10.3390/ani12070882