Effect of Maternal Catalase Supplementation on Reproductive Performance, Antioxidant Activity and Mineral Transport in Sows and Piglets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Animals, and Management
2.2. Diets
2.3. Sample Collection
2.4. Sample Analysis
2.4.1. Antioxidant Indicators in Serum of Farrowing Sow, Umbilical Cord, and Neonatal Piglet
2.4.2. Mineral Concentration in Plasma of Farrowing Sow, Umbilical Cord, and Neonatal Piglet
2.4.3. Quantitative Real-Time Transcription PCR (RT-qPCR)
2.5. Statistical Analysis
3. Results
3.1. Reproductive Performance of Sows
3.2. Antioxidant Enzyme Activities in Serum of Farrowing Sows, Umbilical Cords, and Neonatal Piglets
3.3. mRNA Expression of Genes Related to the Mineral Transport in the Placenta
3.4. Effects of CAT on Serum Mineral Elements of Farrowing Sows and Their Neonatal Piglets
3.5. mRNA Expression of Genes Related to Antioxidant Function in the Placenta, Jejunum, and Ileum
4. Discussion
4.1. Effects of Maternal CAT Supplementation on Reproductive Performance of Sows
4.2. Maternal CAT Supplementation Regulated Antioxidant Enzyme Activities of Sows and Neonatal Piglets
4.3. mRNA Expression of Genes Related to Mineral Transporters in Placenta
4.4. Effects of CAT on Serum Mineral Elements of Farrowing Sows and Offspring
4.5. mRNA Expression of Genes Related to Antioxidant Enzymes in the Placenta, Jejunum, and Ileum
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Wu, X.; Yin, Y.L.; Liu, Y.Q.; Liu, X.D.; Liu, Z.Q.; Li, T.J.; Huang, R.L.; Ruan, Z.; Deng, Z.Y. Effect of dietary arginine and N-carbamoylglutamate supplementation on reproduction and gene expression of eNOS, VEGFA and PlGF1 in placenta in late pregnancy of sows. Anim. Reprod. Sci. 2012, 132, 187–192. [Google Scholar] [CrossRef] [PubMed]
- Campos, P.H.; Silva, B.A.; Donzele, J.L.; Oliveira, R.F.; Knol, E.F. Effects of sow nutrition during gestation on within-litter birth weight variation: A review. Animal 2012, 6, 797–806. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Y.; Kim, S.W. Oxidative stress status and reproductive performance of sows during gestation and lactation under different thermal environments. Asian-Australas. J. Anim. Sci. 2020, 33, 722–731. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.; Wei, H.; Sun, H.; Ao, J.; Long, G.; Jiang, S.; Peng, J. Effects of Dietary Supplementation of Oregano Essential Oil to Sows on Oxidative Stress Status, Lactation Feed Intake of Sows, and Piglet Performance. Biomed. Res. Int. 2015, 2015, 525218. [Google Scholar] [CrossRef] [Green Version]
- Berchieri-Ronchi, C.B.; Zhao, Y.; Correa, C.R.; Ferreira, A.L.D.; Yeum, K.J.; Kim, S.W. Oxidative stress status of high prolific sows during pregnancy and lactation. FASEB J. 2010, 24, 535.8. [Google Scholar] [CrossRef]
- Hussain, T.; Murtaza, G.; Metwally, E.; Kalhoro, D.H.; Kalhoro, M.S.; Rahu, B.A.; Sahito, R.G.A.; Yin, Y.; Yang, H.; Chughtai, M.I.; et al. The Role of Oxidative Stress and Antioxidant Balance in Pregnancy. Mediat. Inflamm. 2021, 2021, 9962860. [Google Scholar] [CrossRef]
- Belkacemi, L.; Nelson, D.M.; Desai, M.; Ross, M.G. Maternal undernutrition influences placental-fetal development. Biol. Reprod. 2010, 83, 325–331. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Q.; Li, J.; Cao, M.; Li, Y.; Zhuo, Y.; Fang, Z.; Che, L.; Xu, S.; Feng, B.; Lin, Y.; et al. Dietary supplementation of Bacillus subtilis PB6 improves sow reproductive performance and reduces piglet birth intervals. Anim. Nutr. 2020, 6, 278–287. [Google Scholar] [CrossRef]
- Sharma, P.; Jha, A.B.; Dubey, R.S.; Pessarakli, M. Reactive oxygen species, oxidative damage, and antioxidative defense mechanism in plants under stressful conditions. J. Bot. 2012, 2012, 1–26. [Google Scholar] [CrossRef] [Green Version]
- Cejas, P.; Casado, E.; Belda-Iniesta, C.; De Castro, J.; Espinosa, E.; Redondo, A.; Sereno, M.; García-Cabezas, M.Á.; Vara, J.A.; Domínguez-Cáceres, A. Implications of oxidative stress and cell membrane lipid peroxidation in human cancer (Spain). Cancer Causes Control 2004, 15, 707–719. [Google Scholar] [CrossRef]
- Arikan, S.; Konukoğlu, D.; Arıkan, Ç.; Akçay, T.; Davas, I. Lipid peroxidation and antioxidant status in maternal and cord blood. Gynecol. Obstet. Investig. 2001, 51, 145–149. [Google Scholar] [CrossRef]
- Argüelles, S.; Machado, M.J.; Ayala, A.; Machado, A.; Hervias, B. Correlation between circulating biomarkers of oxidative stress of maternal and umbilical cord blood at birth. Free Radic. Res. 2006, 40, 565–570. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Piao, L.; Jin, H.; Nogoy, K.M.C.; Zhang, J.; Sun, B.; Jin, Y.; Lee, D.H.; Choi, S.H.; Smith, S.B.; et al. Effects of dietary glucose oxidase, catalase, or both supplementation on reproductive performance, oxidative stress, fecal microflora and apoptosis in multiparous sows. Anim. Biosci. 2022, 35, 75–86. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhao, X.; Jiang, X.; Chen, L.; Hong, L.; Zhuo, Y.; Lin, Y.; Fang, Z.; Che, L.; Feng, B.; et al. Effects of dietary supplementation with exogenous catalase on growth performance, oxidative stress, and hepatic apoptosis in weaned piglets challenged with lipopolysaccharide. J. Anim. Sci. 2020, 98, skaa067. [Google Scholar] [CrossRef]
- Halas, V.; Nochta, I. Mannan oligosaccharides in nursery pig nutrition and their potential mode of action. Animals 2012, 2, 261–274. [Google Scholar] [CrossRef] [Green Version]
- Tan, B.L.; Norhaizan, M.E.; Liew, W.P.; Sulaiman Rahman, H. Antioxidant and Oxidative Stress: A Mutual Interplay in Age-Related Diseases. Front. Pharmacol. 2018, 9, 1162. [Google Scholar] [CrossRef] [Green Version]
- Skrajnowska, D.; Bobrowska-Korczak, B.; Tokarz, A.; Bialek, S.; Jezierska, E.; Makowska, J. Copper and resveratrol attenuates serum catalase, glutathione peroxidase, and element values in rats with DMBA-induced mammary carcinogenesis. Biol. Trace Elem. Res. 2013, 156, 271–278. [Google Scholar] [CrossRef] [Green Version]
- Shazia, Q.; Mohammad, Z.H.; Rahman, T.; Shekhar, H.U. Correlation of oxidative stress with serum trace element levels and antioxidant enzyme status in Beta thalassemia major patients: A review of the literature. Anemia 2012, 2012, 270923. [Google Scholar] [CrossRef] [Green Version]
- Goff, J.P. Invited review: Mineral absorption mechanisms, mineral interactions that affect acid-base and antioxidant status, and diet considerations to improve mineral status. J. Dairy Sci. 2018, 101, 2763–2813. [Google Scholar] [CrossRef]
- Chen, J.; Li, F.; Yang, W.; Jiang, S.; Li, Y. Supplementation with Exogenous Catalase from Penicillium notatum in the Diet Ameliorates Lipopolysaccharide-Induced Intestinal Oxidative Damage through Affecting Intestinal Antioxidant Capacity and Microbiota in Weaned Pigs. Microbiol. Spectr. 2021, 9, e00654-21. [Google Scholar] [CrossRef]
- Li, Y.; Zhao, X.; Zhang, L.; Zhan, X.; Liu, Z.; Zhuo, Y.; Lin, Y.; Fang, Z.; Che, L.; Feng, B. Effects of a diet supplemented with exogenous catalase from penicillium notatum on intestinal development and microbiota in weaned piglets. Microorganisms 2020, 8, 391. [Google Scholar] [CrossRef] [Green Version]
- Gao, L.; Lin, X.; Xie, C.; Zhang, T.; Wu, X.; Yin, Y. The time of calcium feeding affects the productive performance of sows. Animals 2019, 9, 337. [Google Scholar] [CrossRef] [Green Version]
- National Research Council. Nutrient Requirements of Swine, 11th revised ed.; The National Academies Press: Washington, DC, USA, 2012; Volume 1, p. 420. [Google Scholar] [CrossRef] [Green Version]
- Gao, L.; Xie, C.; Liang, X.; Li, Z.; Li, B.; Wu, X.; Yin, Y. Yeast-based nucleotide supplementation in mother sows modifies the intestinal barrier function and immune response of neonatal pigs. Anim. Nutr. 2021, 7, 84–93. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.M.; Liu, Y.L.; Zhou, X.; Zhang, Y.; Wu, X.; Yin, Y.L. Maternal supplementation with uridine influences fatty acid and amino acid constituents of offspring in a sow-piglet model. Br. J. Nutr. 2020, 125, 743–756. [Google Scholar] [CrossRef]
- Myrie, S.B.; MacKay, D.S.; Van Vliet, B.N.; Bertolo, R.F. Early programming of adult blood pressure in the low birth weight Yucatan miniature pig is exacerbated by a post-weaning high-salt-fat-sugar diet. Br. J. Nutr. 2012, 108, 1218–1225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, X.; Gao, L.; Zhou, K.; Li, X.; Lin, X.; Wan, D.; Xiong, X.; Liu, G.; Yin, Y. Deposition and transport of trace mineral elements were affected by stocking density in fattening pigs. J. Trace Elem. Med. Biol. 2018, 50, 566–571. [Google Scholar] [CrossRef]
- Deng, D.; Yao, K.; Chu, W.; Li, T.; Huang, R.; Yin, Y.; Liu, Z.; Zhang, J.; Wu, G. Impaired translation initiation activation and reduced protein synthesis in weaned piglets fed a low-protein diet. J. Nutr. Biochem. 2009, 20, 544–552. [Google Scholar] [CrossRef]
- Meng, Q.; Guo, T.; Li, G.; Sun, S.; He, S.; Cheng, B.; Shi, B.; Shan, A. Dietary resveratrol improves antioxidant status of sows and piglets and regulates antioxidant gene expression in placenta by Keap1-Nrf2 pathway and Sirt1. J. Anim. Sci. Biotechnol. 2018, 9, 34. [Google Scholar] [CrossRef]
- Wan, D.; Zhang, Y.; Wu, X.; Lin, X.; Shu, X.; Zhou, X.; Du, H.; Xing, W.; Liu, H.; Li, L. Maternal dietary supplementation with ferrous N-carbamylglycinate chelate affects sow reproductive performance and iron status of neonatal piglets. Animal 2018, 12, 1372–1379. [Google Scholar] [CrossRef]
- D’Eath, R.B.; Jarvis, S.; Baxter, E.M.; Houdijk, J. Mitigating hunger in pregnant sows. In Advances in Pig Welfare; Špinka, M., Ed.; Woodhead Publishing: Cambridge, UK, 2018; pp. 199–234. [Google Scholar]
- Berchieri-Ronchi, C.B.; Kim, S.W.; Zhao, Y.; Correa, C.R.; Yeum, K.J.; Ferreira, A.L. Oxidative stress status of highly prolific sows during gestation and lactation. Animal 2011, 5, 1774–1779. [Google Scholar] [CrossRef] [Green Version]
- Göransson, L. The effect of feed allowance in late pregnancy on the occurrence of agalactia post partum in the sow. Zent. Vet. A 1989, 36, 505–513. [Google Scholar] [CrossRef]
- Cheng, C.; Wei, H.; Yu, H.; Xu, C.; Jiang, S.; Peng, J. Metabolic Syndrome During Perinatal Period in Sows and the Link With Gut Microbiota and Metabolites. Front. Microbiol. 2018, 9, 1989. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.; Wu, Z.; Huang, Z.; Hao, X.; Zhang, L.; Hu, C.; Wei, J.; Deng, J.; Tan, C. Maternal supply of cysteamine alleviates oxidative stress and enhances angiogenesis in porcine placenta. J. Anim. Sci. Biotechnol. 2021, 12, 91. [Google Scholar] [CrossRef] [PubMed]
- Hao, Y.; Xing, M.; Gu, X. Research Progress on Oxidative Stress and Its Nutritional Regulation Strategies in Pigs. Animals 2021, 11, 1384. [Google Scholar] [CrossRef] [PubMed]
- Sharma, D.; Shastri, S.; Sharma, P. Intrauterine Growth Restriction: Antenatal and Postnatal Aspects. Clin. Med. Insights Pediatr. 2016, 10, 67–83. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. Board-invited review: Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci. 2006, 84, 2316–2337. [Google Scholar] [CrossRef]
- Torres-Cuevas, I.; Parra-Llorca, A.; Sánchez-Illana, A.; Nuñez-Ramiro, A.; Kuligowski, J.; Cháfer-Pericás, C.; Cernada, M.; Escobar, J.; Vento, M. Oxygen and oxidative stress in the perinatal period. Redox Biol. 2017, 12, 674–681. [Google Scholar] [CrossRef]
- Luo, Z.; Luo, W.; Li, S.; Zhao, S.; Sho, T.; Xu, X.; Zhang, J.; Xu, W.; Xu, J. Reactive oxygen species mediated placental oxidative stress, mitochondrial content, and cell cycle progression through mitogen-activated protein kinases in intrauterine growth restricted pigs. Reprod. Biol. 2018, 18, 422–431. [Google Scholar] [CrossRef]
- Hracsko, Z.; Orvos, H.; Novak, Z.; Pal, A.; Varga, I.S. Evaluation of oxidative stress markers in neonates with intra-uterine growth retardation. Redox Rep. 2008, 13, 11–16. [Google Scholar] [CrossRef] [Green Version]
- Abramov, J.P.; Wells, P.G. Embryoprotective role of endogenous catalase in acatalasemic and human catalase-expressing mouse embryos exposed in culture to developmental and phenytoin-enhanced oxidative stress. Toxicol. Sci. 2011, 120, 428–438. [Google Scholar] [CrossRef]
- Wells, P.G.; McCallum, G.P.; Chen, C.S.; Henderson, J.T.; Lee, C.J.; Perstin, J.; Preston, T.J.; Wiley, M.J.; Wong, A.W. Oxidative stress in developmental origins of disease: Teratogenesis, neurodevelopmental deficits, and cancer. Toxicol. Sci. 2009, 108, 4–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ansar, M.; Ivanciuc, T.; Garofalo, R.P.; Casola, A. Increased lung catalase activity confers protection against experimental RSV infection. Sci. Rep. 2020, 10, 3653. [Google Scholar] [CrossRef] [PubMed]
- Pizzino, G.; Irrera, N.; Cucinotta, M.; Pallio, G.; Mannino, F.; Arcoraci, V.; Squadrito, F.; Altavilla, D.; Bitto, A. Oxidative stress: Harms and benefits for human health. Oxid. Med. Cell. Longev. 2017, 2017, 8416763. [Google Scholar] [CrossRef] [PubMed]
- Crinelli, R.; Zara, C.; Smietana, M.; Retini, M.; Magnani, M.; Fraternale, A. Boosting GSH Using the Co-Drug Approach: I-152, a Conjugate of N-acetyl-cysteine and β-mercaptoethylamine. Nutrients 2019, 11, 1291. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Xie, Y.; Yang, W.; Yang, Z.; Jiang, S.; Zhang, C.; Zhang, G. Alfalfa polysaccharide prevents H2O2-induced oxidative damage in MEFs by activating MAPK/Nrf2 signaling pathways and suppressing NF-κB signaling pathways. Sci. Rep. 2019, 9, 1782. [Google Scholar] [CrossRef] [Green Version]
- Hu, C.; Yuan, Y.V.; Kitts, D.D. Antioxidant activities of the flaxseed lignan secoisolariciresinol diglucoside, its aglycone secoisolariciresinol and the mammalian lignans enterodiol and enterolactone in vitro. Food Chem. Toxicol. 2007, 45, 2219–2227. [Google Scholar] [CrossRef]
- Zhao, M.-X.; Wen, J.-L.; Wang, L.; Wang, X.-P.; Chen, T.-S. Intracellular catalase activity instead of glutathione level dominates the resistance of cells to reactive oxygen species. Cell Stress Chaperones 2019, 24, 609–619. [Google Scholar] [CrossRef]
- Suzuki, Y.; Kovacs, C.S.; Takanaga, H.; Peng, J.B.; Landowski, C.P.; Hediger, M.A. Calcium channel TRPV6 is involved in murine maternal–fetal calcium transport. J. Bone Miner. Res. 2008, 23, 1249–1256. [Google Scholar] [CrossRef] [Green Version]
- Bernucci, L.; Henriquez, M.; Diaz, P.; Riquelme, G. Diverse calcium channel types are present in the human placental syncytiotrophoblast basal membrane. Placenta 2006, 27, 1082–1095. [Google Scholar] [CrossRef]
- Nazıroğlu, M. Molecular role of catalase on oxidative stress-induced Ca2+ signaling and TRP cation channel activation in nervous system. J. Recept. Signal Transduct. 2012, 32, 134–141. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.; Prohaska, J.R.; Thiele, D.J. Essential role for mammalian copper transporter Ctr1 in copper homeostasis and embryonic development. Proc. Natl. Acad. Sci. USA 2001, 98, 6842–6847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, Y.M.; Gybina, A.A.; Pyatskowit, J.W.; Gitschier, J.; Prohaska, J.R. Copper transport protein (Ctr1) levels in mice are tissue specific and dependent on copper status. J. Nutr. 2006, 136, 21–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ooi, C.E.; Rabinovich, E.; Dancis, A.; Bonifacino, J.; Klausner, R. Copper-dependent degradation of the Saccharomyces cerevisiae plasma membrane copper transporter Ctr1p in the apparent absence of endocytosis. EMBO J. 1996, 15, 3515–3523. [Google Scholar] [CrossRef]
- Yang, Y.; Wu, Z.; Chen, Y.; Qiao, J.; Gao, M.; Yuan, J.; Nie, W.; Guo, Y. Magnesium deficiency enhances hydrogen peroxide production and oxidative damage in chick embryo hepatocyte in vitro. BioMetals 2006, 19, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.F.; Ding, H.; Jiao, R.Q.; Wu, X.X.; Kong, L.D. Possibility of magnesium supplementation for supportive treatment in patients with COVID-19. Eur. J. Pharmacol. 2020, 886, 173546. [Google Scholar] [CrossRef]
- Barbagallo, M.; Belvedere, M.; Dominguez, L.J. Magnesium homeostasis and aging. Magnes. Res. 2009, 22, 235–246. [Google Scholar] [CrossRef] [Green Version]
- Zheltova, A.A.; Kharitonova, M.V.; Iezhitsa, I.N.; Spasov, A.A. Magnesium deficiency and oxidative stress: An update. BioMedicine 2016, 6, 20. [Google Scholar] [CrossRef]
- Mohammed, K.A.; Goji, A.D.T.; Tanko, Y.; Muhammed, A.; Salisu, I.A. Protective Effects of Magnesium Chloride on Liver Enzymes and Biomarkers of Oxidative Stress in high fat diet fed Rats. Niger. J. Physiol. Sci. 2019, 34, 149–157. [Google Scholar]
- Caspi, R.; Altman, T.; Billington, R.; Dreher, K.; Foerster, H.; Fulcher, C.A.; Holland, T.A.; Keseler, I.M.; Kothari, A.; Kubo, A.; et al. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of Pathway/Genome Databases. Nucleic Acids Res. 2014, 42, D459–D471. [Google Scholar] [CrossRef] [Green Version]
- Fanni, D.; Gerosa, C.; Nurchi, V.; Manchia, M.; Saba, L.; Coghe, F.; Crisponi, G.; Gibo, Y.; Van Eyken, P.; Fanos, V. The role of magnesium in pregnancy and in fetal programming of adult diseases. Biol. Trace Elem. Res. 2021, 199, 3647–3657. [Google Scholar] [CrossRef]
- Zafar, N.; Khan, M.A. Effects of dietary magnesium supplementation on growth, feed utilization, nucleic acid ratio and antioxidant status of fingerling Heteropneustes fossilis. Anim. Feed Sci. Technol. 2021, 273, 114819. [Google Scholar] [CrossRef]
- Liu, Y.; Guo, Y.; Wang, Z.; Nie, W. Effects of source and level of magnesium on catalase activity and its gene expression in livers of broiler chickens. Arch. Anim. Nutr. 2007, 61, 292–300. [Google Scholar] [CrossRef] [PubMed]
- Chakraborti, S.; Chakraborti, T.; Mandal, M.; Mandal, A.; Das, S.; Ghosh, S. Protective role of magnesium in cardiovascular diseases: A review. Mol. Cell. Biochem. 2002, 238, 163–179. [Google Scholar] [CrossRef] [PubMed]
- Bray, T.M.; Bettger, W.J. The physiological role of zinc as an antioxidant. Free Radic. Biol. Med. 1990, 8, 281–291. [Google Scholar] [CrossRef]
- Powell, S.R. The antioxidant properties of zinc. J. Nutr. 2000, 130, 1447S–1454S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.S.; Noh, S.K.; Koo, S.I. Marginal zinc deficiency lowers the lymphatic absorption of alpha-tocopherol in rats. J. Nutr. 1998, 128, 265–270. [Google Scholar] [CrossRef] [Green Version]
- Olechnowicz, J.; Tinkov, A.; Skalny, A.; Suliburska, J. Zinc status is associated with inflammation, oxidative stress, lipid, and glucose metabolism. J. Physiol. Sci. 2018, 68, 19–31. [Google Scholar] [CrossRef] [Green Version]
- DiSilvestro, R.A. Zinc in relation to diabetes and oxidative disease. J. Nutr. 2000, 130, 1509S–1511S. [Google Scholar] [CrossRef]
- Shah, A.A.; Khan, M.S.; Khan, S.; Ahmad, N.; Alhidary, I.A.; Khan, R.U.; Shao, T. Effect of different levels of alpha tocopherol on performance traits, serum antioxidant enzymes, and trace elements in Japanese quail (Coturnix coturnix japonica) under low ambient temperature. Rev. Bras. Zootec. 2016, 45, 622–626. [Google Scholar] [CrossRef] [Green Version]
- Coassin, M.; Ursini, F.; Bindoli, A. Antioxidant effect of manganese. Arch. Biochem. Biophys. 1992, 299, 330–333. [Google Scholar] [CrossRef]
- Owumi, S.E.; Dim, U.J. Manganese suppresses oxidative stress, inflammation and caspase-3 activation in rats exposed to chlorpyrifos. Toxicol. Rep. 2019, 6, 202–209. [Google Scholar] [CrossRef] [PubMed]
- Marklund, S.L. Extracellular superoxide dismutase and other superoxide dismutase isoenzymes in tissues from nine mammalian species. Biochem. J. 1984, 222, 649–655. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chelikani, P.; Fita, I.; Loewen, P.C. Diversity of structures and properties among catalases. Cell. Mol. Life Sci. 2004, 61, 192–208. [Google Scholar] [CrossRef] [PubMed]
- Camello-Almaraz, C.; Gomez-Pinilla, P.J.; Pozo, M.J.; Camello, P.J. Mitochondrial reactive oxygen species and Ca2+ signaling. Am. J. Physiol. Cell Physiol. 2006, 291, C1082–C1088. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kowaltowski, A.J.; Castilho, R.F.; Vercesi, A.E. Opening of the mitochondrial permeability transition pore by uncoupling or inorganic phosphate in the presence of Ca2+ is dependent on mitochondrial-generated reactive oxygen species. FEBS Lett. 1996, 378, 150–152. [Google Scholar] [CrossRef] [Green Version]
- Gaetke, L.M.; Chow, C.K. Copper toxicity, oxidative stress, and antioxidant nutrients. Toxicology 2003, 189, 147–163. [Google Scholar] [CrossRef] [PubMed]
- Cinar, M.; Yildirim, E.; Yigit, A.A.; Yalcinkaya, I.; Duru, O.; Kisa, U.; Atmaca, N. Effects of dietary supplementation with vitamin C and vitamin E and their combination on growth performance, some biochemical parameters, and oxidative stress induced by copper toxicity in broilers. Biol. Trace Elem. Res. 2014, 158, 186–196. [Google Scholar] [CrossRef]
- Pourahmad, J.; O’Brien, P.J. A comparison of hepatocyte cytotoxic mechanisms for Cu2+ and Cd2+. Toxicology 2000, 143, 263–273. [Google Scholar] [CrossRef]
- Bremner, I. Manifestations of copper excess. Am. J. Clin. Nutr. 1998, 67, 1069S–1073S. [Google Scholar] [CrossRef]
- Ognik, K.; Sembratowicz, I.; Cholewinska, E.; Jankowski, J.; Kozlowski, K.; Juskiewicz, J.; Zdunczyk, Z. The effect of administration of copper nanoparticles to chickens in their drinking water on the immune and antioxidant status of the blood. Anim. Sci. J. 2018, 89, 579–588. [Google Scholar] [CrossRef]
- Ajuwon, O.; Idowu, O.; Afolabi, S.; Kehinde, B.; Oguntola, O.; Olatunbosun, K. The effects of dietary copper supplementation on oxidative and antioxidant systems in broiler chickens. Arch. Zootec. 2011, 60, 275–282. [Google Scholar] [CrossRef] [Green Version]
- Sanchez, W.; Palluel, O.; Meunier, L.; Coquery, M.; Porcher, J.M.; Ait-Aissa, S. Copper-induced oxidative stress in three-spined stickleback: Relationship with hepatic metal levels. Environ. Toxicol. Pharmacol. 2005, 19, 177–183. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Romeo, M.; Bennani, N.; Gnassia-Barelli, M.; Lafaurie, M.; Girard, J.P. Cadmium and copper display different responses towards oxidative stress in the kidney of the sea bass Dicentrarchus labrax. Aquat. Toxicol. 2000, 48, 185–194. [Google Scholar] [CrossRef] [PubMed]
- Craig, P.M.; Wood, C.M.; McClelland, G.B. Oxidative stress response and gene expression with acute copper exposure in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. Comp. Physiol. 2007, 293, R1882–R1892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Esmaeili, L.; Perez, M.G.; Jafari, M.; Paquin, J.; Ispas-Szabo, P.; Pop, V.; Andruh, M.; Byers, J.; Mateescu, M.A. Copper complexes for biomedical applications: Structural insights, antioxidant activity and neuron compatibility. J. Inorg. Biochem. 2019, 192, 87–97. [Google Scholar] [CrossRef] [PubMed]
- Khayat, S.; Fanaei, H.; Ghanbarzehi, A. Minerals in pregnancy and lactation: A review article. J. Clin. Diagn. Res. 2017, 11, QE01. [Google Scholar] [CrossRef]
- Chang, Z.; Zhang, H.; Dong, H.; Mehmood, K.; Ijaz, M.; Ahmad, H.I.; Naeem, M.A.; Wu, Q.; Nabi, F.; Zhu, H. Effect of CuSO4 and nano copper on serum antioxidant capacity in Weaned piglets. J. Biol. Regul. Homeost. Agents 2018, 32, 219–224. [Google Scholar]
- Rossipal, E.; Krachler, M.; Li, F.; Micetic-Turk, D. Investigation of the transport of trace elements across barriers in humans: Studies of placental and mammary transfer. Acta Paediatr. 2000, 89, 1190–1195. [Google Scholar] [CrossRef]
- Chakraborty, I.; Kunti, S.; Bandyopadhyay, M.; Dasgupta, A.; Chattopadhyay, G.D.; Chakraborty, S. Evaluation of serum zinc level and plasma SOD activity in senile cataract patients under oxidative stress. Indian J. Clin. Biochem. 2007, 22, 109. [Google Scholar] [CrossRef] [Green Version]
Items | Content, % |
---|---|
Ingredient | |
Corn | 60.6 |
Soybean meal | 11.80 |
Soybean hull | 15.00 |
Rice bran | 7.00 |
CaHPO4 | 1.60 |
Limestone | 1.10 |
Soybean oil | 0.80 |
Acidifier | 0.50 |
Sodium bicarbonate | 0.25 |
Lysine (70%) | 0.22 |
Threonine | 0.10 |
NaCl | 0.40 |
Methionine | 0.05 |
Mold inhibitor | 0.08 |
Choline chloride | 0.10 |
Mineral premix 1 | 0.20 |
Vitamins premix 2 | 0.20 |
Total | 100 |
Chemical composition % 3 | |
Digestible energy (Kcal/kg) | 3050 |
Crude protein (%) | 12.5 |
Calcium (%) | 0.9 |
Phosphorus (%) | 0.65 |
Available phosphorus (%) | 0.41 |
Lysine (%) | 0.68 |
Methionine (%) | 0.26 |
Threonine (%) | 0.57 |
Crude fiber (%) | 8.0 |
Crude fat (%) | 3.4 |
Target Gene | Accession NO. | Nucleotide Sequence of Primer (5′-3′) | Size (bp) |
---|---|---|---|
ATP2B | XM_021091182.1 | F: CTGGTTGGATTGAAGGTGCT | 123 |
R: GCTCCTGCTCAATTCGACTC | |||
TRPV6 | XM_021078898.1 | F: CTAACAAGCTGGGCCATTTC | 119 |
R: GCTGTACATGAAGGGCAGGT | |||
CACNA2D1 | XM_021102233.1 | F: TGTACCTGGATGCACTGGAA | 122 |
R: TCCCATCACACCAAGAATCA | |||
S100G | NM_214140.2 | F: TCCTGCAGAACTGAAGAGCA | 133 |
R: TAGGGTTCTCGGACCTTTCA | |||
SLC30A7 | XM_005655460.2 | F: CCTCTTTAACGGTGCTCTCG | 119 |
R: CATGAAAGTGTCCGTGTCCA | |||
SLC30A9 | NM_001137632.1 | F: ATTAGGCGTGGTCTCAGCAT | 119 |
R: TTACTGACGGGTCGTTCTCC | |||
SLC39A4 | XM_021090449.1 | F: AGCTCAGCCAGTCAGAGAGG | 123 |
R: TGACGTAGTGGGTAGCAGCA | |||
SLC39A14 | XM_005657235.3 | F: AGGATGAAAGGAAGGGCAGT | 114 |
R: TACCCGATCTGGATCTGTCC | |||
CCS | NM_001001866.1 | F: CTTCAGGATGGAGGATGAGC | 119 |
R: TCCCGGTGATCTTGGATAAG | |||
ATP7A | XM_013990938.2 | F: TCTGGCAGCACTGTTATTGC | 116 |
R: GCCTCCTCCACAAGTTTGAC | |||
ATP7B | XM_021065286.1 | F: TATGACCCTTCCTGCGTCTC | 121 |
R: ACCTGGCATCTGTTCCTGTC | |||
MT-2b | XM_003355808.4 | F: TCCTGCAAATGCAAAGACTG | 119 |
R: CACTTGTCCGAGGCTCCTT | |||
CTR1 | NM_214100.3 | F: CGCAAATCACAAGTCAGCAT | 129 |
R: CACTGTCTGCAGGAGGTGAG | |||
GPX1 | NM_214201.1 | F: TGGGGAGATCCTGAATTG | 184 |
R: GATAAACTTGGGGTCGGT | |||
GPX4 | NM_214407.1 | F: GATTCTGGCCTTCCCTTGC | 173 |
R: TCCCCTTGGGCTGGACTTT | |||
CAT | XM_021081498.1 | F: CGAAGGCGAAGGTGTTTG | 370 |
R: AGTGTGCGATCCATATCC | |||
Cu/Zn SOD | NM_001190422.1 | F: CCAGTGCAGGTCCTCACTTCAATC | 172 |
R: CGGCCAATGATGGAATGGTCTCC | |||
MnSOD | NM_214127.2 | F: GGACAAATCTGAGCCCTAACG | 159 |
R: CCTTGTTGAAACCGAGCC | |||
β-actin | XM_003357928.4 | F: CGTTGGCTGGTTGAGAATC | 132 |
R: CGGCAAGACAGAAATGACAA |
Items | Dietary Pretreatment | p-Value | |
---|---|---|---|
CON Group | CAT Group | ||
Total born | 12.31 ± 0.98 | 12.31 ± 0.67 | 1.00 |
Born alive | 11.00 ± 0.77 | 11.08 ± 0.58 | 0.94 |
Birth (alive) litter weight (kg) | 15.26 ± 1.02 | 15.82 ± 0.66 | 0.65 |
Mean weight of born alive per piglet (kg) | 1.40 ± 0.07 | 1.47 ± 0.09 | 0.57 |
Birth mortality (%) 1 | 8.50 ± 0.03 | 8.59 ± 0.03 | 0.98 |
IUGR rate (%) 2 | 3.89 ± 0.02 b | 0.85 ± 0.03 a | 0.03 |
Items | Dietary Treatment | p-Value | |
---|---|---|---|
CON Group | CAT Group | ||
Sow Serum on Farrowing Day | |||
Ca (ug/mL) | 256.05 ± 19.04 b | 392.24 ± 45.62 a | 0.031 |
P (ug/mL) | 411.99 ± 28.10 | 411.88 ± 17.99 | 0.997 |
Mg (mmol/L) | 0.66 ± 0.09 | 0.51 ± 0.12 | 0.363 |
Cu (ug/mL) | 6.04 ± 0.28 | 6.38 ± 0.38 | 0.480 |
Mn (ug/mL) | 0.12 ± 0.06 b | 0.30 ± 0.03 a | 0.014 |
Zn (ug/mL) | 0.60 ± 0.09 b | 2.93 ± 0.43 a | 0.001 |
Umbilical Cord Serum | |||
Ca (ug/mL) | 774.44 ± 166.77 | 783.43 ± 41.38 | 0.951 |
P (ug/mL) | 365.46 ± 53.57 | 291.37 ± 23.87 | 0.214 |
Mg (mmol/L) | 0.86 ± 0.09 a | 0.53 ± 0.10 b | 0.042 |
Cu (ug/mL) | 0.93 ± 0.21 | 0.98 ± 0.20 | 0.874 |
Mn (ug/mL) | 0.22 ± 0.03 b | 1.14 ± 0.03 a | 0.000 |
Zn (ug/mL) | 7.42 ± 0.82 a | 5.24 ± 0.37 b | 0.024 |
Neonatal Piglet Serum | |||
Ca (ug/mL) | 316.06 ± 21.28 b | 646.63 ± 71.66 a | 0.001 |
P (ug/mL) | 270.03 ± 34.04 | 339.89 ± 46.46 | 0.258 |
Mg (mmol/L) | 0.58 ± 0.03 b | 0.75 ± 0.05 a | 0.008 |
Cu (ug/mL) | 0.47 ± 0.10 b | 0.81 ± 0.12 a | 0.046 |
Mn (ug/mL) | 0.06 ± 0.01 b | 0.97 ± 0.05 a | 0.000 |
Zn (ug/mL) | 3.39 ± 0.46 | 4.35 ± 1.34 | 0.460 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, G.; Zhou, T.; Ren, F.; Sun, J.; Deng, D.; Huang, X.; Wassie, T.; Qazi, I.H.; Wu, X. Effect of Maternal Catalase Supplementation on Reproductive Performance, Antioxidant Activity and Mineral Transport in Sows and Piglets. Animals 2022, 12, 828. https://doi.org/10.3390/ani12070828
Guo G, Zhou T, Ren F, Sun J, Deng D, Huang X, Wassie T, Qazi IH, Wu X. Effect of Maternal Catalase Supplementation on Reproductive Performance, Antioxidant Activity and Mineral Transport in Sows and Piglets. Animals. 2022; 12(7):828. https://doi.org/10.3390/ani12070828
Chicago/Turabian StyleGuo, Guanglun, Tiantian Zhou, Fengyun Ren, Jingzhan Sun, Dun Deng, Xingguo Huang, Teketay Wassie, Izhar Hyder Qazi, and Xin Wu. 2022. "Effect of Maternal Catalase Supplementation on Reproductive Performance, Antioxidant Activity and Mineral Transport in Sows and Piglets" Animals 12, no. 7: 828. https://doi.org/10.3390/ani12070828