Alterations in Intestinal Antioxidant and Immune Function and Cecal Microbiota of Laying Hens Fed on Coated Sodium Butyrate Supplemented Diets
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Animals, and Diet
2.2. Sample Collection
2.3. Intestine and Serum Parameters Measurements
2.4. Total RNA Isolation, and Quantitative Real-Time PCR (qRT-PCR)
2.5. Cecal SCFAs Concentration Analysis
2.6. DNA Extraction, 16S rRNA Gene Sequencing and Data Analysis
2.7. Statistical Analysis
3. Results
3.1. Intestinal Oxidation Status
3.2. Intestinal Barrier Function and Gene Expression of Inflammatory Cytokines
3.3. SCFAs Concentrations
3.4. Relationship among SCFAs, Intestinal Inflammatory Cytokines, and Antioxidant Indexes
3.5. Microbial Composition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Chen, Z.; Dai, J.; Yang, P.; Xu, W.; Ai, Q.; Zhang, W.; Zhang, Y.; Zhang, Y.; Mai, K. Sodium butyrate supplementation in high-soybean meal diets for turbot (Scophthalmus maximus L.): Effects on inflammatory status, mucosal barriers and microbiota in the intestine. Fish Shellfish. Immunol. 2019, 88, 65–75. [Google Scholar] [CrossRef] [PubMed]
- Cabezón, R.; Benítez-Ribas, D. Therapeutic potential of tolerogenic dendritic cells in IBD: From animal models to clinical application. Clin. Dev. Immunol. 2013, 2013, 789814. [Google Scholar] [CrossRef]
- Wu, P.; Tian, L.; Zhou, X.Q.; Jiang, W.D.; Liu, Y.; Jiang, J.; Xie, F.; Kuang, S.Y.; Tang, L.; Tang, W.N.; et al. Sodium butyrate enhanced physical barrier function referring to Nrf2, JNK and MLCK signaling pathways in the intestine of young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2018, 73, 121–132. [Google Scholar] [CrossRef]
- Starkey, J.D. Triennial Growth Symposium--A role for vitamin D in skeletal muscle development and growth. J. Anim. Sci. 2014, 92, 887–892. [Google Scholar] [CrossRef]
- Hoste, H.; Torres-Acosta, J.F.; Sandoval-Castro, C.A.; Mueller-Harvey, I.; Sotiraki, S.; Louvandini, H.; Thamsborg, S.M.; Terrill, T.H. Tannin containing legumes as a model for nutraceuticals against digestive parasites in livestock. Vet. Parasitol. 2015, 212, 5–17. [Google Scholar] [CrossRef]
- Elnesr, S.S.; Alagawany, M.; Elwan, H.A.M.; Fathi, M.A.; Farag, M.R. Effect of sodium butyrate on intestinal health of poultry-a review. Ann. Anim. Sci. 2020, 20, 29–41. [Google Scholar] [CrossRef] [Green Version]
- Henagan, T.M.; Stefanska, B.; Fang, Z.; Navard, A.M.; Ye, J.; Lenard, N.R.; Devarshi, P.P. Sodium butyrate epigenetically modulates high-fat diet-induced skeletal muscle mitochondrial adaptation, obesity and insulin resistance through nucleosome positioning. Br. J. Pharmacol. 2015, 172, 2782–2798. [Google Scholar] [CrossRef]
- Hamer, H.M.; Jonkers, D.; Venema, K.; Vanhoutvin, S.; Troost, F.J.; Brummer, R.J. Review article: The role of butyrate on colonic function. Aliment. Pharmacol. Ther. 2008, 27, 104–119. [Google Scholar] [CrossRef]
- Sauer, J.; Richter, K.K.; Pool-Zobel, B.L. Physiological concentrations of butyrate favorably modulate genes of oxidative and metabolic stress in primary human colon cells. J. Nutr. Biochem. 2007, 18, 736–745. [Google Scholar] [CrossRef]
- Chang, P.V.; Hao, L.; Offermanns, S.; Medzhitov, R. The microbial metabolite butyrate regulates intestinal macrophage function via histone deacetylase inhibition. Proc. Natl. Acad. Sci. USA 2014, 111, 2247–2252. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.C.; Shen, Z.J.; Cao, S.T.; Zhang, Q.H.; Peng, Y.; Hong, Q.H.; Feng, J.; Hu, C.H. Effects of tributyrin on growth performance, intestinal microflora and barrier function of weaned pigs. Anim. Feed Sci. Technol. 2019, 258. [Google Scholar] [CrossRef]
- Yang, X.; Yin, F.; Yang, Y.; Lepp, D.; Yu, H.; Ruan, Z.; Yang, C.; Yin, Y.; Hou, Y.; Leeson, S.; et al. Dietary butyrate glycerides modulate intestinal microbiota composition and serum metabolites in broilers. Sci. Rep. 2018, 8, 4940. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Angelakis, E. Weight gain by gut microbiota manipulation in productive animals. Microb. Pathog. 2017, 106, 162–170. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Xu, L.; Sun, X.; Wan, X.; Sun, G.; Jiang, R.; Li, W.; Tian, Y.; Liu, X.; Kang, X. Characteristics of the fecal microbiota of high- and low-yield hens and effects of fecal microbiota transplantation on egg production performance. Res. Vet. Sci. 2020, 129, 164–173. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Y.; Wei, K.; He, J.; Ding, N.; Hua, J.; Zhou, T.; Niu, F.; Zhou, G.; Shi, T.; et al. Review: Effect of Gut Microbiota and Its Metabolite SCFAs on Radiation-Induced Intestinal Injury. Front. Cell Infect. Microbiol. 2021, 11, 577236. [Google Scholar] [CrossRef]
- Mallo, J.J.; Balfagón, A.; Gracia, M.I.; Honrubia, P.; Puyalto, M. Evaluation of different protections of butyric acid aiming for release in the last part of the gastrointestinal tract of piglets. J. Anim. Sci. 2012, 90 (Suppl. 4), 227–229. [Google Scholar] [CrossRef]
- Miao, S.S.; Zhou, W.T.; Li, H.Y.; Zhu, M.K.; Dong, X.Y.; Zou, X.T. Effects of coated sodium butyrate on production performance, egg quality, serum biochemistry, digestive enzyme activity, and intestinal health of laying hens. Ital. J. Anim. Sci. 2021, 20, 1452–1461. [Google Scholar] [CrossRef]
- Miao, L.; Gong, Y.; Li, H.; Xie, C.; Xu, Q.; Dong, X.; Elwan, H.A.M.; Zou, X. Alterations in cecal microbiota and intestinal barrier function of laying hens fed on fluoride supplemented diets. Ecotox. Environ. Saf. 2020, 193, 110372. [Google Scholar] [CrossRef]
- Wang, Y.; Sun, J.; Zhong, H.; Li, N.; Xu, H.; Zhu, Q.; Liu, Y. Effect of probiotics on the meat flavour and gut microbiota of chicken. Sci. Rep. 2017, 7, 6400. [Google Scholar] [CrossRef]
- Jian, H.F.; Miao, S.S.; Liu, Y.T.; Wang, X.M.; Xu, Q.Q.; Zhou, W.T.; Li, H.Y.; Dong, X.Y.; Zou, X.T. Dietary valine ameliorated gut health and accelerated the development of nonalcoholic fatty liver disease of laying hens. Oxid. Med. Cell Longev. 2021, 23, 4704771. [Google Scholar] [CrossRef]
- Ma, X.; Fan, P.X.; Li, L.S.; Qiao, S.Y.; Zhang, G.L.; Li, D.F. Butyrate promotes the recovering of intestinal wound healing through its positive effect on the tight junctions. J. Anim. Sci. 2012, 4, 266–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Russo, I.; Luciani, A.; De Cicco, P.; Troncone, E.; Ciacci, C. Butyrate attenuates lipopolysaccharide-induced inflammation in intestinal cells and Crohn’s mucosa through modulation of antioxidant defense machinery. PLoS ONE 2012, 7, e32841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, Y.; Fang, Z.F.; Che, L.Q.; Xu, S.Y.; Wu, D.; Wu, C.M.; Wu, X.Q. Use of sodium butyrate as an alternative to dietary fiber: Effects on the embryonic development and anti-oxidative capacity of rats. PLoS ONE 2014, 9, e97838. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Zhang, W.H.; Gao, F.; Zhou, G.H. Micro-encapsulated sodium butyrate attenuates oxidative stress induced by corticosterone exposure and modulates apoptosis in intestinal mucosa of broiler chickens. Anim. Prod. Sci. 2015, 55, 587–594. [Google Scholar] [CrossRef]
- Zhang, Z.; Liu, D.; Yi, B.; Liao, Z.; Tang, L.; Yin, D.; He, M. Taurine supplementation reduces oxidative stress and protects the liver in an iron-overload murine model. Mol. Med. Rep. 2014, 10, 2255–2262. [Google Scholar] [CrossRef] [Green Version]
- Cao, W.; Xiao, L.; Liu, G.; Fang, T.; Wu, X.; Jia, G.; Zhao, H.; Chen, X.; Wu, C.; Cai, J.; et al. Dietary arginine and N-carbamylglutamate supplementation enhances the antioxidant statuses of the liver and plasma against oxidative stress in rats. Food Funct. 2016, 7, 2303–2311. [Google Scholar] [CrossRef]
- Mihara, M.; Uchiyama, M. Determination of malonaldehyde precursor in tissues by thiobarbituric acid test. Anal. Biochem. 1978, 86, 271–278. [Google Scholar] [CrossRef]
- Arrieta, M.C.; Bistritz, L.; Meddings, J.B. Alterations in intestinal permeability. Gut 2006, 55, 1512–1520. [Google Scholar] [CrossRef] [Green Version]
- Andrews, C.; McLean, M.H.; Durum, S.K. Cytokine tuning of intestinal epithelial function. Front. Immunol. 2018, 9, 1270. [Google Scholar] [CrossRef]
- Ma, T.Y.; Iwamoto, G.K.; Hoa, N.T.; Akotia, V.; Pedram, A.; Boivin, M.A.; Said, H.M. TNF-alpha-induced increase in intestinal epithelial tight junction permeability requires NF-kappa B activation. Am. J. Physiol. Gastrointest. Liver Physiol. 2004, 286, G367–G376. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.S.; Tato, C.M.; Joyce-Shaikh, B.; Gulen, M.F.; Cayatte, C.; Chen, Y.; Blumenschein, W.M.; Judo, M.; Ayanoglu, G.; McClanahan, T.K.; et al. Interleukin-23-independent IL-17 production regulates intestinal epithelial permeability. Immunity 2015, 43, 727–738. [Google Scholar] [CrossRef] [Green Version]
- Zhang, H.; Du, M.; Yang, Q.; Zhu, M.J. Butyrate suppresses murine mast cell proliferation and cytokine production through inhibiting histone deacetylase. J. Nutr. Biochem. 2016, 27, 299–306. [Google Scholar] [CrossRef]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef]
- Lorén, V.; Cabré, E.; Ojanguren, I.; Domènech, E.; Pedrosa, E.; García-Jaraquemada, A.; Mañosa, M.; Manyé, J. Interleukin-10 enhances the intestinal epithelial barrier in the presence of Corticosteroids through p38 MAPK activity in Caco-2 monolayers: A possible mechanism for steroid responsiveness in ulcerative colitis. PLoS ONE 2015, 19, e0130921. [Google Scholar] [CrossRef] [Green Version]
- Zheng, L.; Kelly, C.J.; Battista, K.D.; Schaefer, R.; Lanis, J.M.; Alexeev, E.E.; Wang, R.X.; Onyiah, J.C.; Kominsky, D.J.; Colgan, S.P. Microbial-Derived Butyrate Promotes Epithelial Barrier Function through IL-10 Receptor-Dependent Repression of Claudin-2. J. Immunol. 2017, 199, 2976–2984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kominsky, D.J.; Campbell, E.L.; Ehrentraut, S.F.; Wilson, K.E.; Kelly, C.J.; Glover, L.E.; Collins, C.B.; Bayless, A.J.; Saeedi, B.; Dobrinskikh, E.; et al. IFN-γ-mediated induction of an apical IL-10 receptor on polarized intestinal epithelia. J. Immunol. 2014, 192, 1267–1276. [Google Scholar] [CrossRef] [Green Version]
- Quiros, M.; Nishio, H.; Neumann, P.A.; Siuda, D.; Brazil, J.C.; Azcutia, V.; Hilgarth, R.; O’Leary, M.N.; Garcia-Hernandez, V.; Leoni, G.; et al. Macrophage-derived IL-10 mediates mucosal repair by epithelial WISP-1 signaling. J. Clin. Investig. 2017, 127, 3510–3520. [Google Scholar] [CrossRef] [PubMed]
- Gerritsen, J.; Smidt, H.; Rijkers, G.T.; de Vos, W.M. Intestinal microbiota in human health and disease: The impact of probiotics. Genes Nutr. 2011, 6, 209–240. [Google Scholar] [CrossRef] [Green Version]
- Topping, D.L.; Clifton, P.M. Short-chain fatty acids and human colonic function: Roles of resistant starch and nonstarch polysaccharides. Physiol. Rev. 2001, 81, 1031–1064. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Cao, C.; Ren, B.; Zhang, B.; Huang, Q.; Li, C. Structural characterization and in vitro fermentation of a novel polysaccharide from Sargassum thunbergii and its impact on gut microbiota. Carbohydr. Polym. 2018, 183, 230–239. [Google Scholar] [CrossRef]
- Fukuda, S.; Toh, H.; Hase, K.; Oshima, K.; Nakanishi, Y.; Yoshimura, K.; Tobe, T.; Clarke, J.M.; Topping, D.L.; Suzuki, T.; et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 2011, 469, 543–547. [Google Scholar] [CrossRef] [PubMed]
- González-Bosch, C.; Boorman, E.; Zunszain, P.A.; Mann, G.E. Short-chain fatty acids as modulators of redox signaling in health and disease. Redox Biol. 2021, 47, 102165. [Google Scholar] [CrossRef] [PubMed]
- Fu, X.; Liu, Z.; Zhu, C.; Mou, H.; Kong, Q. Nondigestible carbohydrates, butyrate, and butyrate-producing bacteria. Crit. Rev. Food Sci. Nutr. 2019, 59, S130–S152. [Google Scholar] [CrossRef] [PubMed]
- Salvi, P.S.; Cowles, R.A. Butyrate and the Intestinal Epithelium: Modulation of Proliferation and Inflammation in Homeostasis and Disease. Cells 2021, 10, 1775. [Google Scholar] [CrossRef]
- Hoyles, L.; Snelling, T.; Umlai, U.K.; Nicholson, J.K.; Carding, S.R.; Glen, R.C.; McArthur, S. Microbiome-host systems interactions: Protective effects of propionate upon the blood-brain barrier. Microbiome 2018, 6, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Safari, R.; Hoseinifar, S.H.; Dadar, M.; Nejadmoghaddam, S.; Doan, H.V. Effect of dietary sodium acetate on skin mucus immune parameters and expression of gene related to growth, immunity and antioxidant system in common carp (Cyprinus carpio) intestine. Ann. Anim. Sci. 2020, 20, 1441–1452. [Google Scholar] [CrossRef]
- Zou, X.; Ji, J.; Qu, H.; Wang, J.; Shu, D.M.; Wang, Y.; Liu, T.F.; Li, Y.; Luo, C.L. Effects of sodium butyrate on intestinal health and gut microbiota composition during intestinal inflammation progression in broilers. Poult. Sci. 2019, 98, 4449–4456. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Tran, N.T.; Ji, P.; Sun, Z.; Wen, X.; Li, S. Effects of prebiotic mixtures on growth performance, intestinal microbiota and immune response in juvenile chu’s croaker, Nibea coibor. Fish Shellfish. Immunol. 2019, 89, 564–573. [Google Scholar] [CrossRef] [PubMed]
- Videnska, P.; Sedlar, K.; Lukac, M.; Faldynova, M.; Gerzova, L.; Cejkova, D.; Sisak, F.; Rychlik, I. Succession and replacement of bacterial populations in the caecum of egg laying hens over their whole life. PLoS ONE 2014, 9, e115142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lopetuso, L.R.; Scaldaferri, F.; Petito, V.; Gasbarrini, A. Commensal Clostridia: Leading players in the maintenance of gut homeostasis. Gut Pathog. 2013, 5, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, T.; Wu, W.; Tu, Y.; Zhang, N.; Diao, Q. Resveratrol affectsin vitro rumen fermentation, methane production and prokaryotic community composition in a time- and diet-specific manner. Microb. Biotechnol. 2020, 13, 1118–1131. [Google Scholar] [CrossRef] [Green Version]
- Vacca, M.; Celano, G.; Calabrese, F.M.; Portincasa, P.; Gobbetti, M.; De Angelis, M. The controversial role of human gut Lachnospiraceae. Microorganisms 2020, 8, 573. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Yan, L.; Chen, H.; Wu, N.; Wang, W.; Wang, D. Cyclocarya paliurus polysaccharides alleviate type 2 diabetic symptoms by modulating gut microbiota and short-chain fatty acids. Phytomedicine 2020, 77, 153268. [Google Scholar] [CrossRef] [PubMed]
- Kleessen, B.; Kroesen, A.J.; Buhr, H.J.; Blaut, M. Mucosal and invading bacteria in patients with inflammatory bowel disease compared with controls. Scand J. Gastroenterol. 2002, 37, 1034–1041. [Google Scholar] [CrossRef] [PubMed]
- Lucke, K.; Miehlke, S.; Jacobs, E.; Schuppler, M. Prevalence of Bacteroides and Prevotella spp. in ulcerative colitis. J. Med. Microbiol. 2006, 55, 617–624. [Google Scholar] [CrossRef] [PubMed]
- Xing, S.C.; Chen, J.Y.; Chen, Y.X.; Wu, R.T.; Huang, C.B.; Zhang, Y.; Mi, J.D.; Liao, X.D. The combination of lead and bacillus coagulans R11 increased the concentration of alpha-Solanine in the cecum of laying hens and the pathogens abundance decreased. Front. Microbiol. 2020, 11, 585197. [Google Scholar] [CrossRef] [PubMed]
- Wright, D.P.; Rosendale, D.I.; Robertson, A.M. Prevotella enzymes involved in mucin oligosaccharide degradation and evidence for a small operon of genes expressed during growth on mucin. FEMS Microbiol. Lett. 2000, 190, 73–79. [Google Scholar] [CrossRef]
Ingredients | Value | Nutrient Level 3 | Value |
---|---|---|---|
Corn, % | 62 | Metabolism energy, MJ/kg | 10.99 |
Soybean meal, % | 24.5 | Crude protein, % | 15.67 |
Soybean oil, % | 0.5 | Lysine, % | 0.80 |
Limestone, % | 8 | Methionine, % | 0.34 |
Premix 1,2, % | 5 | Calcium, % | 3.69 |
Total | 100 | Total phosphorus, % | 0.54 |
Target Gene | Primer | Primer Sequence (5′-3′) | Product Length | Accession No. |
---|---|---|---|---|
β-Actin | Forward | TCCCTGGAGAAGAGCTATGAA | 113 bp | NM_205518.1 |
Reverse | CAGGACTCCATACCCAAGAAAG | |||
IL-10 | Forward | CCAGGGACGATGAACTTAACA | 251 bp | NM_001004414.2 |
Reverse | GATGGCTTTGCTCCTCTTCT | |||
IL-1β | Forward | CTTCACCCTCAGCTTTCACG | 137 bp | XM_015297469.2 |
Reverse | CCCTCCCATCCTTACCTTCT | |||
IL-6 | Forward | TTCAGAGTGACCTACACAGGC | 146 bp | XM_015281283.2 |
Reverse | GATGCTTTATCATGCGCTGC | |||
TNF-α | Forward | GACAGCCTATGCCAACAAGTA | 244 bp | AY765397.1 |
Reverse | TCCACATCTTTCAGAGCATCAA |
Items | Control | S500 | p-Value |
---|---|---|---|
coverage | 1.00 | 1.00 | 0.590 |
chao | 934.67 | 959.08 | 0.438 |
sobs | 809.50 | 839.33 | 0.364 |
shannon | 4.97 | 5.00 | 0.669 |
simpson | 0.02 | 0.02 | 0.445 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Miao, S.; Hong, Z.; Jian, H.; Xu, Q.; Liu, Y.; Wang, X.; Li, Y.; Dong, X.; Zou, X. Alterations in Intestinal Antioxidant and Immune Function and Cecal Microbiota of Laying Hens Fed on Coated Sodium Butyrate Supplemented Diets. Animals 2022, 12, 545. https://doi.org/10.3390/ani12050545
Miao S, Hong Z, Jian H, Xu Q, Liu Y, Wang X, Li Y, Dong X, Zou X. Alterations in Intestinal Antioxidant and Immune Function and Cecal Microbiota of Laying Hens Fed on Coated Sodium Butyrate Supplemented Diets. Animals. 2022; 12(5):545. https://doi.org/10.3390/ani12050545
Chicago/Turabian StyleMiao, Sasa, Zuopeng Hong, Huafeng Jian, Qianqian Xu, Yating Liu, Xiaoming Wang, Yan Li, Xinyang Dong, and Xiaoting Zou. 2022. "Alterations in Intestinal Antioxidant and Immune Function and Cecal Microbiota of Laying Hens Fed on Coated Sodium Butyrate Supplemented Diets" Animals 12, no. 5: 545. https://doi.org/10.3390/ani12050545