Next Article in Journal
Herd Prevalence Estimation of Mycobacterium avium Subspecies paratuberculosis Burden in the Three Main Dairy Production Regions of Germany (PraeMAP)
Previous Article in Journal
Optimization of Emulsification Conditions on Ethanol Extract of Taiwanese Green Propolis Using Polysorbate and Its Immunomodulatory Effects in Broilers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Investigation of Copy Number Variations (CNVs) of the Goat PPP3CA Gene and Their Effect on Litter Size and Semen Quality

1
Key Laboratory of Animal Genetics, College of Animal Science and Technology, Breeding and Reproduction of Shaanxi Province, Northwest A&F University, Yangling 712100, China
2
Shaanxi Provincial Engineering and Technology Research Center of Cashmere Goats, Yulin University, Yulin 719000, China
3
Life Science Research Center, Yulin University, Yulin 719000, China
4
Bijie Animal Husbandry and Veterinary Science Research Institute, Bijie 551700, China
*
Author to whom correspondence should be addressed.
Animals 2022, 12(4), 445; https://doi.org/10.3390/ani12040445
Submission received: 10 December 2021 / Revised: 29 January 2022 / Accepted: 9 February 2022 / Published: 12 February 2022
(This article belongs to the Section Animal Reproduction)

Abstract

:

Simple Summary

PPP3CA is one of the candidate genes for goat reproduction, but no studies have been carried out yet. Therefore, the purpose of this study was to determine the associations between copy number variations in the goat PPP3CA gene and litter size and semen quality in goats, including Shaanbei white cashmere goats (SBWC) (n = 353) and Guizhou Heima (GZHM) goats (n = 64). Based on the association analysis, the results showed that only CNV1 (copy number variation 1) and CNV2 (copy number variation 2) were distinctly related to the first-birth litter size in female goats (p = 7.6802 × 10−11; p = 5.0895 × 10−9), and they were also significantly associated with the semen quality of SBWC goats (p < 0.05). These findings prove that the PPP3CA gene plays an important role in reproduction traits in goats.

Abstract

Copy number variations (CNVs) have many forms of variation structure, and they play an important role in the research of variety diversity, biological evolution and disease correlation. Since CNVs have a greater impact on gene regulation and expression, more studies are being finalized on CNVs in important livestock and poultry species. The protein phosphatase 3 catalytic subunit alpha (PPP3CA) is a key candidate gene involved in the goat fecundity trait, and has important effects on precocious puberty, estrogen signal transduction pathways and oocyte meiosis. Additionally, PPP3CA also has a dephosphorylation effect in the process of spermatogonial stem cell meiosis and spermatogenesis. So far, there is no research on the relationship between the copy number variations of the PPP3CA gene and reproduction traits. Therefore, the purpose of this study was to determine the association between copy number variations in the goat PPP3CA gene and litter size and semen quality in Shaanbei white cashmere goats (SBWC) (n = 353) and Guizhou Heima goats (n = 64). Based on the association analysis, the results showed that only CNV1 and CNV2 within the PPP3CA gene were distinctly related to the first-birth litter size in female goats (p = 7.6802 × 10−11; p = 5.0895 × 10−9, respectively) and they were also significantly associated with the semen quality of SBWC goats (p < 0.05). In addition, individuals with Loss genotypes demonstrated better phenotypic performance compared to those with other types. Therefore, CNV1 and CNV2 of the PPP3CA gene are potentially useful for breeding, as they are linked to important goat reproduction traits.

1. Introduction

Located on chromosome 6, the protein phosphatase 3 catalytic subunit alpha (PPP3CA), was first discovered in brain tissue in 1979, and has a variety of biological functions [1]. To date, the main study of this gene was related to cell growth and development, immune response, neurodevelopmental diseases and spermatogenesis [2,3,4]. Hence, PPP3CA was suggested to be a key candidate gene involved in livestock animals’ reproductive traits [5]. For example, Dias et al. (2015) found that the PPP3CA gene had a crucial effect on precocious puberty [6]. Additionally, a whole-genome selective scanning analysis in 31 Dazu black goats found that the PPP3CA gene was annotated to reproduction-related pathways [7], which had an important influence on the estrogen signal transduction pathway and oocyte meiosis [6]. Previously, Wan et al. (2014) found that the PPP3CA gene played a key role in the control of skeletal muscle fibers, and that it was expressed in various muscle tissues [8]. It can inhibit the expression of fibroblast growth factor 23 (FGF23) and participate in the regulation of skeletal muscle growth and development [9]. In our previous study, a 20 bp indel mutation in the PPP3CA gene affected goat litter size through the differential binding of the reproduction-related transcription factor NF-1 [10]. Several studies had demonstrated that PPP3CA is a potential phosphatase in mouse testes, which may regulate the function of dynein 2 (DNM2) in the acrosome of mature cells, thereby affecting spermatogenesis. At the same time, the inactivation of PPP3CA not only inhibited mouse testis development, but also reduced the number of mature sperm, indicating that this gene plays a vital role in sperm production and testicular development [11,12,13]. Therefore, we hypothesized that PPP3CA might affect litter size and semen quality traits in goats, and could be an effective DNA maker than can be applied in MAS breeding.
Copy number variation (CNV) is the main form of genome structural variation and is an important source of genetic variation and phenotypic differences. Therefore, it plays an essential role in the occurrence and development of complex traits [14,15,16]. In 2004, Sebat et al. studied the CNV of the human genome and found that it was involved in the regulation of neural function, cell growth, metabolism and disease [17]. In terms of the number of mutated nucleotides and the impact on the individual traits of organisms, CNV may be more important for the genetic variation and diversity of organisms than SNPs and InDels. Since CNV has a greater impact on gene regulation and expression, more studies are being conducted on CNV in important livestock and poultry species [18,19,20]. As a critical reproductive trait, litter size and semen quality affect the economic benefits of the goat industry. The average lambing rate of SBWC goats is about 109% and, therefore, it still needs to be improved [21,22]. Consequently, we hope to discover the major genes that affect reproduction in goats. In our previous study, Bi et al. (2021) found five potential copy number variations within the main fecundity Fec B gene, and two of these CNVs could significantly affect goat litter size. It was also found that two InDel loci in the down syndrome cell adhesion molecule like 1 (DSCAML1) gene were related to the semen quality and litter size of goats [23,24].
Here, we selected 353 Shaanbei white cashmere goats (female: n = 307; male: n = 46) from Shaanxi province and Guizhou Heima goats (GZHM) (n = 64) from Guizhou province as experimental samples to analyze the association between copy number variations of the PPP3CA gene and litter size and semen quality to provide a scientific basis for the application of MAS breeding in the goat breeding industry, and thereby improve reproductive traits.

2. Materials and Methods

All experiment procedures were approved by the Faculty Animal Policy and Welfare Committee of Northwest A&F University (FAPWC-NWAFU) and experiments on animals were completely in agreement with the local animal welfare laws and policies (NWAFU-314020038).

2.1. Sample Collection and DNA Isolation

To study the effect of the PPP3CA gene copy number variations in SBWC goats, 353 adult goats (2–3 years old, female goats (n = 307) and male goats (n = 46)) were collected in Shaanxi province, China. In order to study the distribution of the three copy number variations of the PPP3CA gene in another goat breed, we randomly choose Guizhou Heima (GZHM) goats as a control. Hence, we also collected ear samples of adult female GZHM goats (n = 64) in Guizhou province. The Shaanbei white cashmere (SBWC) goats were kept under standard conditions, including the same diet and feeding and management conditions. According to the full pedigree recorded on the farm, the individuals we selected are not related to each other. This means that all individuals of 3–4 generations do not share a common ancestor [25]. In addition, the agricultural technical station provided the first-birth litter size records of female goat (n = 307). All genomic DNA was isolated from ear tissue from 417 samples according to the phenol–chloroform method [24,25]. We use the artificial vagina method to ejaculate the trained ram before semen collection to promote the production of fresh semen, ensure the quality of semen and improve the libido of the breeding ram. Finally, we recorded the amount of ejaculate [26].

2.2. Detection of Various Indicators of Semen Quality

2.2.1. The Determination of Semen Concentration

The semen was diluted at a ratio of 1:100 and counted using a hemocytometer. The sperm count was observed in the five squares on the hemocytometer under a microscope, and this allowed us to calculate the sperm concentration [26].

2.2.2. The Determination of the Percentage of Viable Sperm

Semen samples were diluted 100 times with 0.9% sodium chloride solution, then mixed evenly, and dropped onto a glass slide on a constant temperature table (adjust the temperature to 37–38 °C) and covered with a clean cover glass. Next, we examined the number of sperm in a linear motion under the microscope and calculated the sperm motility [27].

2.2.3. The Determination of Sperm Deformity Rate

The examination of the sperm deformity rate involved smearing the semen so that it could be observed directly under the microscope, and then staining it with common staining solution (methylene blue) or red and blue ink. Then, we washed it with water and dried it for microscopic examination. We examined at least 200 sperm cells, and the percentage of deformity was calculated [28].

2.2.4. The Determination of Sperm Plasma Membrane Integrity

The integrity of the sperm plasma membrane was detected using the HOST hypotonic swelling method. The centrifuge tube and permeate were preheated, 10 μL of semen was added to 100 μL hypotonic solution, and the cells were incubated in a water bath at 37 °C for 30 min. Spermatozoa were observed under a microscope. Sperm with bent tails are sperm with the intact plasma membrane, while sperm with uncurved tails are sperm with an incomplete plasma membrane. We counted 200 spermatozoa in a certain field of view, repeated the count twice, and calculated the average percentage of swollen spermatozoa [29].

2.3. Primer Design and CNV Detection

In this study, we used the Animal Omics Database (http://animal.nwsuaf.edu.cn/ accessed on 10 September 2021) to search for CNVs of the goat PPP3CA gene (NC_030813.1) and found that there are three CNV mutations in the introns of the PPP3CA gene (Table 1) [30]. The quantitative PCR primer pairs (CNV1, CNV2 and CNV3) were used to detect the copy number variations of the PPP3CA gene in different individuals, and they were designed using Primer Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ accessed on 12 September 2021). Following a previous study, the MC1R gene was used as internal control [20]. Additionally, all primers’ pair sequence information is shown in Table 2. The quantitative real-time polymerase chain reaction (qPCR) amplification reaction system volume (10 μL) and the procedure are as described in our previous studies [23,31].

2.4. Copy Number Analysis and Statistical Analyses

First, we used CNVcaller software to analyze the resequencing results of the database and identify the position of repeated breakpoints in the PPP3CA gene region in goats [32]. Then, we amplified each sample via qPCR with three replicates for each pair of primers. Subsequently, the qPCR results of the copy number of the PPP3CA gene were analyzed using the 2*2∆CT method, where ∆CT = Cttarget − Ctinternal, Cttarget is the number of cycles when the target gene amplification reaches the threshold and Ctinternal is the cycle number when the internal reference gene amplification reaches the threshold. The CNVs were divided into three types, Gain (2 × 2∆CT ≥ 3), Loss (2 × 2∆CT < 2), and Medium (2 × 2∆CT = 2) [20,23].
The following model was used for the association analysis of CNV types and litter size and semen quality: Yijk = µ + Si + Gl + eijk, where Yijk was the trait measured for each animal, µ was the overall population mean, Si was the effect of age, Gl was the copy number variation type of each point and eijk was the random error [33]. A one-way ANOVA was used to analyze the association between litter size, semen quality and CNV types in the SPSS software.

3. Results

3.1. qPCR Primer Detection

Three CNVs within the goat PPP3CA, namely, CNV1 (NC_030813.1 g.23732401–23735200, intron), CNV2 (NC_030813.1 g.23742401–23744400, intron) and CNV3 (NC_030813.1 g.23759601-23761600, intron), were detected in SBWC goats (n = 353 and GZHM goats (n = 64) (Table 1 and Table 2). Additionally, the gene structure of the goat PPP3CA gene was drawn as shown in Figure 1. The melting curves of the three CNV mutant primers of the PPP3CA gene and the MC1R gene are shown in Figure 2. It shows that the dissolution peak patterns of the PPP3CA gene and the internal reference gene MC1R gene are single, and the dissolution temperature is above 80 °C, indicating that the quantitative primers belong to a specific amplification and have a good amplification efficiency.

3.2. Distribution of Different CNV Types in Goats

In order to determine the distribution of the PPP3CA gene copy number in SBWC goats, we chose 307 female goats and 46 male goats, and 64 female GZHM goats. According to the 2 × 2∆CT method, we divided the CNV types into three classes, including Loss type (0~2), Medium type (2) and Gain type (>2). As shown in Table 3, CNV1 and CNV2 displayed three types (Loss, Medium and Gain) in both male and female SBWC goats, while CNV3 had only one type (Gain) in male goats. In addition, in order to determine the distribution of copy number variations of the PPP3CA gene in different goat breeds, we detected the copy number of the PPP3CA gene in GZHM goats. The results showed that CNVs within the PPP3CA gene displayed different distributions in two populations.

3.3. Association Analysis of CNV Type and Goat Litter Size

Since no reproductive trait records were available in GZHM goats, we only used association analysis to explore the relationship between different CNV types and litter size in 307 female SBWC goats. The statistical analyses showed that CNV1 and CNV2 were significantly associated with goat litter size (p = 7.6802 × 10−11; p = 5.0895 × 10−9, respectively). For CNV1, the Loss genotype had the higher litter size compared to the Gain and Medium genotypes. And for CNV2, the Medium genotype had the highest litter size compared to the Gain and Loss genotypes. Meanwhile, there was no significant difference between CNV3 and litter size (p = 0.487) (Table 4).

3.4. Association Analysis of CNV Type and Goat Semen Quality

Herein, we examined the association of the PPP3CA gene copy number variations with the corresponding individual semen quality in 46 Shaanbei white cashmere goats (male) using the one-way ANOVA method. As shown in Table 5, CNV1 was correlated with ejaculation volume (EV; p = 0.035), semen concentration (SC; p = 0.048), sperm viability (SV; p = 0.026) and live sperm count (LS; p = 2.3 × 10−4). Moreover, CNV2 was significantly correlated with semen concentration (SC; p = 0.030) and live sperm count (LS; p = 0.005) (Table 5).

4. Discussion

As one of the most important economic traits in large-scale breeding, goat reproductive traits account for a large proportion of the overall income of breeders. However, the low heritability of reproductive traits, the long cycle, the slow breeding progress and the complex relationship with growth traits are the main reasons for the economic disadvantages of goat breeding [34,35]. With the development of biotechnology, marker-assisted selection (MAS) has been widely used in goat breeding to rapidly enhance goat reproductive performance. Several natural genetic variations, including SNPs, InDels and CNVs, have been identified. As an important source of genome structural variation, CNV has a large mutation segment, which causes huge genetic effects on individuals, thus providing a molecular basis for the study of important economic traits of livestock and poultry. Currently, researchers are conducting classification studies based on copy numbers by identifying the differences in the time threshold number in the qPCR cycle. In this study, the intention was to explore the effects of three CNVs in the PPP3CA gene on litter size and semen quality in goats.
Protein phosphatase 3 (PPP3), also known as calcineurin (calcineurin, CaN), is the only Ser/threonine regulated by Ca2 +/calmodulin (CaM) [36]. The protein phosphatase, which is widely present in a variety of eukaryotic cells, plays a key role in the cellular response mediated by the Ca2+/CaN/NFAT signaling pathway [37]. The PPP3CA gene can play a role in spermatogonial stem cell meiosis and spermatogenesis through dephosphorylation, thereby affecting male reproduction [13]. At present, there are relatively few studies on the effect of this gene on reproductive traits. Bai et al. (2021) found that the 20 bp indel polymorphism may affect the litter size by binding to the reproduction-related transcription factor NF-1 in goats [10]. Based on these findings, we speculated that PPP3CA is a candidate gene for reproductive traits in goats.
On the basis of the Animal Omics Database (http://animal.nwsuaf.edu.cn/ accessed on 8 September 2021) built by the Jiangyu team of our college (College of Animal Science and Technology, Northwest A&F University), the CNVcaller software was used to analyze the existing whole-genome resequencing results. Additionally, the results found that there are breakpoints in this group of Shaanbei white cashmere (SBWC) goats. Therefore, the DNA sequencing results and bioinformation analysis proved that the CNVs within the PPP3CA gene region in SBWC are available, and there are several variable changes in CNV region. Additionally, the same CNV regions within this gene were also analyzed in other goat breeds using whole-genome resequencing and bioinformatic analysis (Supplementary Table S1). Since the whole-genome re-sequencing method and bioinformatic analysis are expensive and time-consuming, in this study, we detected the potential CNVs in big sample size of goats (n > 400) using the qPCR method, which is efficient and time-saving.
Herein, we examined the potential CNVs of the PPP3CA gene in SBWC female and male goats (n = 353) and the female GZHM goats (n = 64) for the first time. We found that among the three CNVs, CNV1 and CNV2 were significantly associated with first-born litter size (p < 0.01). For CNV1 and CNV2, individuals with Loss and Medium genotypes had advantages in goat litter size, respectively. In the male group (n = 46), we also detected the copy number variations of the PPP3CA gene. CNV1 and CNV2 displayed three types (Gain, Medium and Loss), while CNV3 had only one type (Gain). This phenomenon may be due to the difference between our selected groups and the intensity of artificial selection. To analyze the associations between CNVs and semen quality, we recorded 46 male goats’ ejaculate volume, sperm concentration, sperm motility, sperm deformity rate, plasma membrane integrity rate, live sperm count and other indicators to measure semen quality. The results showed that CNV1 was correlated with ejaculation volume (EV; p = 0.035), semen concentration (SC; p = 0.048), sperm viability (SV; p = 0.026) and live sperm count (LS; p = 2.3 × 10−4). Moreover, CNV2 was significantly correlated with semen concentration (SC; p = 0.030) and live sperm count (LS; p = 0.005). The individuals with the Loss copy number had more SC and LS than individuals with the other two types, suggesting that Loss-type individuals performed better than the other two individuals in terms of semen quality. Although China has abundant resources for goat breeding, poor fecundity restricts the development of the goat industry. From this perspective, CVN1 and CNV2 may be suitable for further selection and breeding. The role of the PPP3CA gene in goat reproduction, as well as a series of signal transduction and regulation mechanisms in vivo, is still unclear, so further research is needed.
It is known that cAMP acts through protein kinases (PKA), and the absence of cAMP or PKA leads to insufficient sperm motility and male infertility [38]. PPP3CA is one of the genes in the PKA pathway, and the variation in its intron region may affect the combination ability of DNA sequence and transcription factors, thereby indirectly affecting the litter size and semen quality of goats. So far, some introns contain transcriptional regulatory sequences that bind transcriptional regulators to control the rate of transcription. Furthermore, changes in the intron sequence may also affect splicing patterns and, thus, affect phenotype [39]. For example, Kang et al. (2019) found that mutations in the intron region of the goat MARCH1 gene regulate ovarian expression levels and affect the litter size [40]. However, the underlying molecular mechanism of CNV1 and CNV2 of the PPP3CA gene on the litter size and semen quality of goats requires further investigation.

5. Conclusions

Based on the association analysis, the results showed that only CNV1 (copy number variation 1) and CNV2 (copy number variation 2) were distinctly related to the first-birth litter size in female goats (p = 7.6802 × 10−11; p = 5.0895 × 109, respectively) and were also significantly associated with the semen quality of SBWC goats (p < 0.05). In addition, individuals with Loss genotypes demonstrated better phenotypic performance compared to those with other types. Therefore, CNV1 and CNV2 of the PPP3CA gene are potentially useful for breeding, as they are linked to important goat reproduction traits.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani12040445/s1. Table S1: CNVcaller software analysis in different goat breeds.

Author Contributions

Resources, Y.B., T.Z., N.L., C.P. and H.Z.; Conducting experiment, Y.B., T.Z., N.L. and C.W. Project administration, X.L. and C.P.; Data curation, Y.B. and Z.G.; Writing—original draft, Y.B.; Writing—review and editing, X.L. and Z.G. All authors have read and agreed to the published version of the manuscript.

Funding

The West Light Foundation (2021-NWSUAF-GZG) and The National Natural Science Foundation of China (No.31172184; No.31760650).

Institutional Review Board Statement

All animal tests performed in this study were conducted under the supervision and guidance of the Animal Welfare Committee of Northwestern Agricultural and Forestry University (NWAFU-314020038), and all procedures were in accordance with their specifications.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are available upon request from corresponding author.

Acknowledgments

We are very grateful to Lei Qu and his team from Shaanxi Province Engineering and Technology Research Center of Cashmere Goats (Shaanxi, China), and Yulin University for their support during sample collection and data recording. At the same time, we would like to thanks Weiwei Fu for her analysis of the resequencing results, which further verified the existence of CNVs in the PPP3CA gene. We also greatly appreciate the Life Science Research Core Services (LSRCS) of Northwest A&F University (Northern Campus) for providing us with the platform.

Conflicts of Interest

The authors have no conflict of interest with this reported study. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Tash, J.S.; Krinks, M.; Patel, J.; Means, R.L.; Klee, C.B.; Means, A.R. Identification, characterization, and functional correlation of calmodulin-dependent protein phosphatase in sperm. J. Cell Biol. 1988, 106, 1625–1633. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Rydzanicz, M.; Wachowska, M.; Cook, E.C.; Lisowski, P.; Kuźniewska, B.; Szymańska, K.; Diecke, S.; Prigione, A.; Szczałuba, K.; Szybińska, A.; et al. Novel calcineurin A (PPP3CA) variant associated with epilepsy, constitutive enzyme activation and downregulation of protein expression. Eur. J. Hum. Genet. 2019, 27, 61–69. [Google Scholar] [CrossRef] [PubMed]
  3. Daei-Farshbaf, N.; Aflatoonian, R.; Amjadi, F.S.; Nikniyaz, H.; Taleahmad, S.; Bakhtiyari, M. Identification of calcineurin as a predictor of oocyte quality and fertilization competence based on microarray data. Comput. Biol. Chem. 2021, 94, 107561. [Google Scholar] [CrossRef] [PubMed]
  4. Panneerselvam, S.; Wang, J.; Zhu, W.; Dai, H.; Pappas, J.G.; Rabin, R.; Low, K.J.; Rosenfeld, J.A.; Emrick, L.; Xiao, R.; et al. PPP3CA truncating variants clustered in the regulatory domain cause early-onset refractory epilepsy. Clin Genet. 2021, 100, 227–233. [Google Scholar] [CrossRef]
  5. Islam, R.; Liu, X.; Gebreselassie, G.; Abied, A.; Ma, Q.; Ma, Y. Genome-wide association analysis reveals the genetic locus for high reproduction trait in Chinese Arbas cashmere goat. Genes Genom. 2020, 42, 893–899. [Google Scholar] [CrossRef]
  6. Dias, M.M.; Souza, F.R.; Takada, L.; Feitosa, F.L.; Costa, R.B.; Diaz, I.D.; Cardoso, D.F.; Tonussi, R.L.; Baldi, F.; Albuquerque, L.G.; et al. Study of lipid metabolism-related genes as candidate genes of sexual precocity in Nellore cattle. Genet. Mol. Res. 2015, 14, 234–243. [Google Scholar] [CrossRef]
  7. E, G.X.; Zhao, Y.J.; Huang, Y.F. Selection signatures of litter size in Dazu black goats based on a whole genome sequencing mixed pools strategy. Mol. Biol. Rep. 2019, 46, 5517–5523. [Google Scholar] [CrossRef]
  8. Wan, L.; Ma, J.; Xu, G.; Wang, D.; Wang, N. Molecular cloning, structural analysis and tissue expression of protein phosphatase 3 catalytic subunit alpha isoform (PPP3CA) gene in Tianfu goat muscle. Int. J. Mol. Sci. 2014, 15, 2346–2358. [Google Scholar] [CrossRef] [Green Version]
  9. Bär, L.; Großmann, C.; Gekle, M.; Föller, M. Calcineurin inhibitors regulate fibroblast growth factor 23 (FGF23) synthesis. Naunyn Schmiedebergs Arch. Pharmacol. 2017, 390, 1117–1123. [Google Scholar] [CrossRef]
  10. Bai, Y.; Li, J.; Zhu, H.; Liu, J.; Dong, S.; Li, L.; Qu, L.; Chen, H.; Song, X.; Lan, X. Deletion mutation within the goat PPP3CA gene identified by GWAS significantly affects litter size. Reprod. Fertil. Dev. 2021, 33, 476–483. [Google Scholar] [CrossRef] [PubMed]
  11. Martin, L.J.; Chen, H.; Liao, X.; Allayee, H.; Shih, D.M.; Lee, G.S.; Hovland, D.N.; Robbins, W.A., Jr.; Carnes, K.; Hess, R.A.; et al. FK506, a calcineurin inhibitor, prevents cadmium-induced testicular toxicity in mice. Toxicol. Sci. 2007, 100, 474–485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Reid, A.T.; Lord, T.; Stanger, S.J.; Roman, S.D.; McCluskey, A.; Robinson, P.J.; Aitken, R.J.; Nixon, B. Dynamin regulates specific membrane fusion events necessary for acrosomal exocytosis in mouse spermatozoa. J. Biol. Chem. 2012, 287, 37659–37672. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Redgrove, K.A.; Bernstein, I.R.; Pye, V.J.; Mihalas, B.P.; Sutherland, J.M.; Nixon, B.; McCluskey, A.; Robinson, P.J.; Holt, J.E.; McLaughlin, E.A. Dynamin 2 is essential for mammalian spermatogenesis. Sci. Rep. 2016, 6, 35084. [Google Scholar] [CrossRef] [PubMed]
  14. Di Gerlando, R.; Mastrangelo, S.; Moscarelli, A.; Tolone, M.; Sutera, A.M.; Portolano, B.; Sardina, M.T. Genomic structural diversity in local goats: Analysis of copy-number variations. Animals 2020, 10, 1040. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, X.; Zhang, S.; Tang, Q.; Jiang, E.; Wang, K.; Lan, X.; Pan, C. Goat sperm associated antigen 17 protein gene (SPAG17): Small and large fragment genetic variation detection, association analysis, and mRNA expression in gonads. Genomics 2020, 112, 5115–5121. [Google Scholar] [CrossRef] [PubMed]
  16. Yang, L.; Niu, Q.; Zhang, T.; Zhao, G.; Zhu, B.; Chen, Y.; Zhang, L.; Gao, X.; Gao, H.; Liu, G.E.; et al. Genomic sequencing analysis reveals copy number variations and their associations with economically important traits in beef cattle. Genomics 2021, 113, 812–820. [Google Scholar] [CrossRef] [PubMed]
  17. Sebat, J.; Lakshmi, B.; Troge, J.; Alexander, J.; Young, J.; Lundin, P.; Månér, S.; Massa, H.; Walker, M.; Chi, M.; et al. Large-scale copy number polymorphism in the human genome. Science 2004, 305, 525–528. [Google Scholar] [CrossRef] [Green Version]
  18. Liu, M.; Woodward-Greene, J.; Kang, X.; Pan, M.G.; Rosen, B.; Van Tassell, C.P.; Chen, H.; Liu, G.E. Genome-wide CNV analysis revealed variants associated with growth traits in African indigenous goats. Genomics 2020, 112, 1477–1480. [Google Scholar] [CrossRef]
  19. Kang, X.; Li, M.; Liu, M.; Liu, S.; Pan, M.G.; Wiggans, G.R.; Rosen, B.D.; Liu, G.E. Copy number variation analysis reveals variants associated with milk production traits in dairy goats. Genomics 2020, 112, 4934–4937. [Google Scholar] [CrossRef] [PubMed]
  20. Li, L.; Yang, P.; Shi, S.; Zhang, Z.; Shi, Q.; Xu, J.; He, H.; Lei, C.; Wang, E.; Chen, H.; et al. Association analysis to copy number variation (CNV) of Opn4 gene with growth traits of goats. Animals 2020, 10, 441. [Google Scholar] [CrossRef] [Green Version]
  21. Wang, Z.; Wang, C.; Guo, Y.; She, S.; Wang, B.; Jiang, Y.; Bai, Y.; Song, X.; Li, L.; Shi, L.; et al. Screening of deletion variants within the goat PRDM6 gene and its effects on growth traits. Animals 2020, 10, 208. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Xu, Z.; Wang, X.; Zhang, Z.; An, Q.; Wen, Y.; Wang, D.; Liu, X.; Li, Z.; Lyu, S.; Li, L.; et al. Copy number variation of CADM2 gene revealed its association with growth traits across Chinese Capra hircus (goat) populations. Gene 2020, 741, 144519. [Google Scholar] [CrossRef] [PubMed]
  23. Bi, Y.; Feng, W.; Kang, Y.; Wang, K.; Yang, Y.; Qu, L.; Chen, H.; Lan, X.; Pan, C. Detection of mRNA expression and copy number variations within the goat FecB gene associated with litter size. Front. Vet. Sci. 2021, 8, 758705. [Google Scholar] [CrossRef] [PubMed]
  24. Wang, K.; Kang, Z.; Jiang, E.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Genetic effects of DSCAML1 identified in genome-wide association study revealing strong associations with litter size and semen quality in goat (Capra hircus). Theriogenology 2020, 146, 20–25. [Google Scholar] [CrossRef] [PubMed]
  25. Hui, Y.; Zhang, Y.; Wang, K.; Pan, C.; Chen, H.; Qu, L.; Song, X.; Lan, X. Goat DNMT3B: An indel mutation detection, association analysis with litter size and mRNA expression in gonads. Theriogenology 2020, 147, 108–115. [Google Scholar] [CrossRef]
  26. Gangwar, C.; Mishra, A.K.; Gururaj, K.; Kumar, A.; Kharche, S.D.; Saraswat, S.; Kumar, R.; Ramachandran, N. Semen quality and total microbial load: An association study in important Indian Goat breeds during different seasons. Andrologia 2021, 53, e13995. [Google Scholar] [CrossRef]
  27. Campbell, R.C.; Dott, H.M.; Glover, T.D. Nigrosin eosin as a stain for differentiating live and dead spermatozoa. J. Agric. Sci. 1956, 48, 1–8. [Google Scholar] [CrossRef]
  28. Abril-Sánchez, S.; Crosignani, N.; Freitas-de-Melo, A.; Terrazas, A.; Damián, J.P.; Beracochea, F.; Silveira, P.; Ungerfeld, R. Sedation or anaesthesia decrease the stress response to electroejaculation and improve the quality of the collected semen in goat bucks. Animal 2018, 12, 2598–2608. [Google Scholar] [CrossRef]
  29. Jeyendran, R.S.; Van der Ven, H.H.; Perez-Pelaez, M.; Crabo, B.G.; Zaneveld, L.J. Development of an assay to assess the functional integrity of the human sperm membrane and its relationship to other semen characteristics. J. Reprod. Fertil. 1984, 70, 219–228. [Google Scholar] [CrossRef] [Green Version]
  30. Li, R.; Fu, W.; Su, R.; Tian, X.; Du, D.; Zhao, Y.; Zheng, Z.; Chen, Q.; Gao, S.; Cai, Y.; et al. Towards the complete goat pan-genome by recovering missing genomic segments from the reference genome. Front. Genet. 2019, 10, 1169. [Google Scholar] [CrossRef]
  31. Shi, S.Y.; Li, L.J.; Zhang, Z.J.; Wang, E.Y.; Wang, J.; Xu, J.W.; Liu, H.B.; Wen, Y.F.; He, H.; Lei, C.Z.; et al. Copy number variation of MYLK4 gene and its growth traits of Capra hircus (goat). Anim. Biotechnol. 2020, 31, 532–537. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, X.; Zheng, Z.; Cai, Y.; Chen, T.; Li, C.; Fu, W.; Jiang, Y. CNVcaller: Highly efficient and widely applicable software for detecting copy number variations in large populations. Gigascience 2017, 6, 1–12. [Google Scholar] [CrossRef] [PubMed]
  33. Huang, Y.; Su, P.; Akhatayeva, Z.; Pan, C.; Zhang, Q.; Lan, X. Novel InDel variations of the Cry2 gene are associated with litter size in Australian White sheep. Theriogenology 2022, 179, 155–161. [Google Scholar] [CrossRef] [PubMed]
  34. Kang, Z.; Bai, Y.; Lan, X.; Zhao, H. Goat AKAP12: Indel mutation detection, association analysis with litter size and alternative splicing variant expression. Front. Genet. 2021, 12, 648256. [Google Scholar] [CrossRef] [PubMed]
  35. Bai, Y.; Yuan, R.; Luo, Y.; Kang, Z.; Zhu, H.; Qu, L.; Lan, X.; Song, X. Exploration of genetic variants within the goat A-Kinase anchoring protein 12 (AKAP12) gene and their effects on growth traits. Animals 2021, 11, 2090. [Google Scholar] [CrossRef] [PubMed]
  36. Miyata, H.; Satouh, Y.; Mashiko, D.; Muto, M.; Nozawa, K.; Shiba, K.; Fujihara, Y.; Isotani, A.; Inaba, K.; Ikawa, M. Sperm calcineurin inhibition prevents mouse fertility with implications for male contraceptive. Science 2015, 350, 442–445. [Google Scholar] [CrossRef] [PubMed]
  37. Rusnak, F.; Mertz, P. (2000). Calcineurin: Form and function. Physiol. Rev. 2000, 80, 1483–1521. [Google Scholar] [CrossRef]
  38. Dey, S.; Eisa, A.; Kline, D.; Wagner, F.F.; Abeysirigunawardena, S.; Vijayaraghavan, S. Roles of glycogen synthase kinase 3 alpha and calcineurin in regulating the ability of sperm to fertilize eggs. FASEB J. 2020, 34, 1247–1269. [Google Scholar] [CrossRef] [Green Version]
  39. Akhatayeva, Z.; Mao, C.; Jiang, F.; Pan, C.; Lin, C.; Hao, K.; Lan, T.; Chen, H.; Zhang, Q.; Lan, X. Indel variants within the PRL and GHR genes associated with sheep litter size. Reprod. Domest. Anim. 2020, 55, 1470–1478. [Google Scholar] [CrossRef]
  40. Kang, Z.; Jiang, E.; Wang, K.; Pan, C.; Chen, H.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X. Goat membrane associated ring-CH-type finger 1 (MARCH1) mRNA expression and association with litter size. Theriogenology 2019, 128, 8–16. [Google Scholar] [CrossRef]
Figure 1. Gene structure of the goat PPP3CA gene.
Figure 1. Gene structure of the goat PPP3CA gene.
Animals 12 00445 g001
Figure 2. Melting curve of CNV1 (a), CNV2 (b) and CNV3 (c) sites of the PPP3CA and MC1R (d) genes.
Figure 2. Melting curve of CNV1 (a), CNV2 (b) and CNV3 (c) sites of the PPP3CA and MC1R (d) genes.
Animals 12 00445 g002
Table 1. The CNV loci of the goat PPP3CA gene.
Table 1. The CNV loci of the goat PPP3CA gene.
PrimersStartEndLengthLocationReference Sequence
CNV123732401237352002799intronNC_030813.1
CNV223742401237444001999intronNC_030813.1
CNV323759601237616001999intronNC_030813.1
Table 2. Primers used for detection of the CNV mutations and the relative expression of PPP3CA.
Table 2. Primers used for detection of the CNV mutations and the relative expression of PPP3CA.
PrimersSequences (5′-3′)Sizes (bp)
CNV1F: CCTCTGCCTACTCTTTCCTGC106
R: GGGGGAAATGGTCCCCAAA
CNV2F: AGAGGGAACCTCCATGGTCA108
R: CCAAGCCTCAACTCACTCCA
CNV3F: CCGACTCCCCCTGAAGTAGT199
R: TCTCCAGCAATGTTAGGCTGT
MC1RF: GGCCTGAGAGGGGAATCACA126
R: AGTGGGTCTCTGGATGGAGG
Table 3. Typical frequencies of copy number variations within the PPP3CA gene in different goat breeds.
Table 3. Typical frequencies of copy number variations within the PPP3CA gene in different goat breeds.
BreedLociSizesTypic Frequencies
GainMediumLoss
SBWC goat (female)CNV13000.363 (n = 109)0.187 (n = 56)0.450 (n = 135)
CNV23070.861 (n = 206)0.153 (n = 47)0.176 (n = 54)
CNV33010.781 (n = 235)0.056 (n = 17)0.163 (n = 49)
SBWC goat (male)CNV1460.370 (n = 17)0.522 (n = 24)0.108 (n = 5)
CNV2460.783 (n = 36)0.130 (n = 6)0.087 (n = 4)
CNV3461.000 (n = 46)--
GZHM goat (female)CNV1640.047 (n = 3)0.734 (n = 47)0.219 (n = 14)
CNV2640.094 (n = 6)0.703 (n = 45)0.203 (n = 13)
CNV3640.875 (n = 56)0.109 (n = 7)0.016 (n = 1)
Table 4. Statistical association analysis of three CNVs of PPP3CA with litter sizes in goats.
Table 4. Statistical association analysis of three CNVs of PPP3CA with litter sizes in goats.
MutationsSizesGainMediumLossp-Values
CNV13001.40 B ± 0.05 (n = 109)1.25 B ± 0.06
(n = 56)
1.72 A ± 0.04 (n = 135)7.6802 × 10−11
CNV23071.40 B ± 0.03
(n = 206)
1.79 A ± 0.06
(n = 47)
1.74 A ± 0.06
(n = 54)
5.0895 × 10−9
CNV33011.50 ± 0.03
(n = 235)
1.41 ± 0.12
(n = 17)
1.57 ± 0.07
(n = 49)
0.487
Note: Values with different letters (A, B) within the same row differ significantly at (p < 0.01); data represented as means ± standard error.
Table 5. Statistical association analysis of two CNVs of PPP3CA with semen quality in goats.
Table 5. Statistical association analysis of two CNVs of PPP3CA with semen quality in goats.
MutationsParameters Genotypes p-Values
GainMediumLoss
CNV1EV0.94 ± 0.09 ab
(n = 17)
0.75 b ± 0.05
(n = 24)
1.12 a ± 0.18
(n = 5)
0.035
SC292.94 b ± 3.46
(n = 17)
271.10 b ± 3.37
(n = 24)
465.20 a ± 6.03
(n = 5)
0.047
SV 50.90 B ± 0.03
(n = 17)
54.60 b ± 0.04
(n = 24)
74.00 Aa ± 0.04
(n = 5)
0.026
SdR 34.00 ± 0.04
(n = 17)
27.50 ± 0.04
(n = 24)
21.10 ± 0.05
(n = 5)
0.320
SaR 82.90 ± 0.02
(n = 15)
91.60 ± 0.01
(n = 22)
92.40 ± 0.03
(n = 5)
0.169
LS151.30 B ± 2.18
(n = 17)
147.20 B ± 1.77
(n = 24)
343.30 A ± 5.01
(n = 5)
2.3 × 10−4
CNV2EV0.82 ± 0.57
(n = 36)
1.00 ± 0.12
(n = 6)
0.83 ± 0.14
(n = 4)
0.141
SC269.50 b ± 2.64
(n = 36)
373.10 ab ± 5.08
(n = 6)
468.10 a ± 6.41
(n = 4)
0.030
SV53.30 ± 0.27
(n = 36)
60.80 ± 0.07
(n = 6)
65.00 ± 0.12
(n = 4)
0.315
SdR 31.30 ± 0.03
(n = 36)
19.90 ± 0.05
(n = 6)
24.80 ± 0.05
(n = 4)
0.343
SPR90.70 ± 0.02
(n = 33)
82.80 ± 0.03
(n = 5)
77.80 ± 0.12
(n = 4)
0.157
LS146.30 B ± 1.54
(n = 36)
215.80 AB ± 2.82
(n = 6)
314.10 A ± 5.14
(n = 4)
0.005
Note: EV, Ejaculation volume (mL); SC, Semen concentration(million/mL); SV, Sperm viability (%); SdR, Sperm deformity rate (%); SPR, Sperm plasma membrane integrity rate (%); LS, Live sperm count (million/mL). Values with different letters (a, b/A, B) within the same row differ significantly at (p < 0.05/p < 0.01); data represented as means ± standard error.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Bai, Y.; Zhang, T.; Liu, N.; Wang, C.; Guo, Z.; Pan, C.; Zhu, H.; Lan, X. Investigation of Copy Number Variations (CNVs) of the Goat PPP3CA Gene and Their Effect on Litter Size and Semen Quality. Animals 2022, 12, 445. https://doi.org/10.3390/ani12040445

AMA Style

Bai Y, Zhang T, Liu N, Wang C, Guo Z, Pan C, Zhu H, Lan X. Investigation of Copy Number Variations (CNVs) of the Goat PPP3CA Gene and Their Effect on Litter Size and Semen Quality. Animals. 2022; 12(4):445. https://doi.org/10.3390/ani12040445

Chicago/Turabian Style

Bai, Yangyang, Taiyuan Zhang, Nuan Liu, Congliang Wang, Zhengang Guo, Chuanying Pan, Haijing Zhu, and Xianyong Lan. 2022. "Investigation of Copy Number Variations (CNVs) of the Goat PPP3CA Gene and Their Effect on Litter Size and Semen Quality" Animals 12, no. 4: 445. https://doi.org/10.3390/ani12040445

APA Style

Bai, Y., Zhang, T., Liu, N., Wang, C., Guo, Z., Pan, C., Zhu, H., & Lan, X. (2022). Investigation of Copy Number Variations (CNVs) of the Goat PPP3CA Gene and Their Effect on Litter Size and Semen Quality. Animals, 12(4), 445. https://doi.org/10.3390/ani12040445

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop