Molecular Sexing and Species Detection of Antlered European Hunting Game for Forensic Purposes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
2.2. Marker Selection and Primer Design
2.3. Singleplex Reactions and Sequencing Analysis
2.4. Multiplex Amplification and Detection
2.5. Basic Validation
2.6. Field Samples—Mock Cases
3. Results
3.1. Marker Selection and Primer Design
3.2. Singleplex Reactions, Sequencing and GenBank Submission
3.3. PCR Based Multiplex Design and Detection
3.4. Developmental Validation
3.4.1. Species Specificity
3.4.2. Sensitivity, Mixtures and Case-Type Samples
3.4.3. Field Samples—Mock Cases
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Moore, M.K.; Frazier, K. Humans Are Animals, too. Critical Commonalities and Differences Between Human and Wildlife Forensic Genetics. J. Forensic Sci. 2019, 64, 1603–1621. [Google Scholar] [CrossRef] [PubMed]
- Blecher, A.S.; Ganswindt, A.; Scheun, J. Scales of our lives: Sex identification of Temminck’s pangolin (Smutsia temminckii) using scales retrieved out of the illegal wildlife trade. Gen. Comp. Endocrinol. 2021, 308, 113782. [Google Scholar] [CrossRef] [PubMed]
- Tobe, S.S.; Linacre, A.M.T. A multiplex assay to identify 18 European mammal species from mixtures using the mitochondrial cytochrome b gene. Electrophoresis 2008, 29, 340–347. [Google Scholar] [CrossRef] [PubMed]
- Pereira, F.; Carneiro, J.; Matthiesen, R.; van Asch, B.; Pinto, N.; Gusmão, L.; Amorim, A. Identification of species by multiplex analysis of variable-length sequences. Nucleic Acids. Res. 2010, 38, 203. [Google Scholar] [CrossRef]
- Ramón-Laca, A.; Linacre, A.M.; Gleeson, D.M.; Tobe, S.S. Identification multiplex assay of 19 terrestrial mammal species present in New Zealand. Electrophoresis 2013, 34, 3370–3376. [Google Scholar] [CrossRef]
- Hrovatin, K.; Kunej, T. Genetic sex determination assays in 53 mammalian species: Literature analysis and guidelines for reporting standardization. Ecol. Evol. 2018, 8, 1009–1018. [Google Scholar] [CrossRef]
- Bilton, T.P.; Chappell, A.J.; Clarke, S.M.; Brauning, R.; Dodds, K.G.; McEwan, J.C.; Rowe, S.J. Using genotyping-by-sequencing to predict gender in animals. Anim. Genet. 2019, 50, 307–310. [Google Scholar] [CrossRef]
- Mori, C.; Matsumura, S. Current issues for mammalian species identification in forensic science: A review. Int. J. Legal Med. 2021, 135, 3–12. [Google Scholar] [CrossRef]
- Poetsch, M.; Seefeldt, S.; Maschke, M.; Lignitz, E. Analysis of microsatellite polymorphism in red deer, roe deer, and fallow deer possible employment in forensic applications. Forensic Sci. Int. 2001, 116, 1–8. [Google Scholar] [CrossRef]
- Eliason, S. From the King’s deer to a capitalist commodity: A social historical analysis of the poaching law. Int. J. Comp. Appl. 2012, 36, 133–148. [Google Scholar] [CrossRef]
- Szabolcsi, Z.; Egyed, B.; Zenke, P.; Padar, Z.; Borsy, A.; Steger, V.; Pasztor, E.; Csanyi, S.; Buzas, Z.; Orosz, L. Constructing STR Multiplexes for Individual Identification of Hungarian Red Deer. J. Forensic Sci. 2014, 59, 1090–1099. [Google Scholar] [CrossRef]
- Iyengar, A. Forensic DNA analysis for animal protection and biodiversity conservation: A review. J. Nat. Conserv. 2014, 22, 195–205. [Google Scholar] [CrossRef]
- Zenke, P.; Egyed, B.; Padar, Z. Wildlife protection: Demonstrability of Wildlife crime with forensic DNA analysis. Casework applications. Hung. Vet. J. 2017, 139, 631–639. [Google Scholar]
- Morf, N.V.; Kopps, A.M.; Nater, A.; Lendvay, B.; Vasiljevic, N.; Webster, L.M.I.; Fautley, R.G.; Ogden, R.; Kratzer, A. STRoe deer: A validated forensic STR profiling system for the European roe deer (Capreolus capreolus). Forensic Sci. Int. 2021, 1, 100023. [Google Scholar] [CrossRef]
- Hamlin, B.C.; Meredith, E.P.; Rodzen, J.; Strand, J.M. OdoPlex: An STR multiplex panel optimized and validated for forensic identification and sex determination of North American mule deer (Odocoileus hemionus) and white-tailed deer (Odocoileus virginianus). Forensic Sci. Int. 2021, 1, 100026. [Google Scholar] [CrossRef]
- Bana, N.Á.; Nyiri, A.; Nagy, J.; Frank, K.; Nagy, T.; Stéger, V.; Schiller, M.; Lakatos, P.; Sugár, L.; Horn, P.; et al. The red deer Cervus elaphus genome CerEla1.0: Sequencing, annotating, genes, and chromosomes. Mol. Genet. Genom. 2018, 293, 665–684. [Google Scholar] [CrossRef]
- Sim, Z.; Monderman, L.; Hildebrand, D.; Packer, T.; Jobin, R.M. Development and implementation of a STR based forensic typing system for moose (Alces alces). Forensic Sci. Int. Genet. 2021, 53, 102536. [Google Scholar] [CrossRef]
- Hungarian Ministry of Agriculture. 79/2004. (V. 04.) FVM Order. Available online: https://njt.hu/jogszabaly/2004-79-20-82 (accessed on 22 November 2021).
- Eurohunting Hunting Organization LTD. Hunting in Hungary. Hunting Seasons. Available online: https://eurohunting.hu/en/information/hunting-seasons/ (accessed on 22 November 2021).
- Északerdő, P.L.C. Hunting Tourism. Available online: http://www.eszakerdo.hu/angol/menu/vadinfo_eng.html/ (accessed on 22 November 2021).
- Queirós, J.; Gortázar, C.; Alves, P.C. Deciphering Anthropogenic Effects on the Genetic Background of the Red Deer in the Iberian Peninsula. Front. Ecol. Evol. 2020, 8, 147. [Google Scholar] [CrossRef]
- Gouda, S.; Kerry, R.G.; Das, A.; Chauhan, N.S. Wildlife forensics: A boon for species identification and conservation implications. Forensic Sci. Int. 2020, 317, 110530. [Google Scholar] [CrossRef]
- Linacre, A. Animal Forensic Genetics. Genes 2021, 12, 515. [Google Scholar] [CrossRef]
- Smart, U.; Cihlar, J.C.; Budowle, B. International Wildlife Trafficking: A perspective on the challenges and potential forensic genetics solutions. Forensic Sci. Int. Genet. 2021, 54, 102551. [Google Scholar] [CrossRef] [PubMed]
- Pfeiffer, I.; Brenig, B. X- and Y-chromosome specific variants of the amelogenin gene allow sex determination in sheep (Ovis aries) and European red deer (Cervus elaphus). BMC Genet. 2005, 6, 16. [Google Scholar] [CrossRef] [PubMed]
- Han, S.H.; Cho, I.C.; Lee, S.S.; Tandang, L.; Lee, H.; Oh, H.S.; Kim, B.S.; Oh, M.Y. Identification of Species and Sex of Korean Roe Deer (Capreolus pygargus tianschanicus) Using SRY and CYTB Genes. Integr. Biosci. 2007, 11, 165–168. [Google Scholar] [CrossRef][Green Version]
- Qiao, Y.; Zou, F.; Wei, K.; Yue, B. A Rapid Sex-Identification Test for the Forest Musk Deer (Moschus berezovskii) Based on the ZFX/ZFY Gene. Zool. Sci. 2007, 24, 493–495. [Google Scholar] [CrossRef]
- Kim, B.J.; Lee, Y.S.; An, J.; Park, H.; Okumura, H.; Lee, H.; Min, M. Species and sex identification of the Korean goral (Nemorhaedus caudatus) by molecular analysis of non-invasive samples. Mol. Cells 2008, 26, 314–318. [Google Scholar]
- Barbosa, A.M.; Fernández-García, J.L.; Carranza, J. A new marker for rapid Sex Identification of red deer (Cervus Elaphus). Hystrix It. J. Mamm. 2009, 20, 169–172. [Google Scholar]
- Gurgul, A.; Radko, A.; Słota, E. Characteristics of X- and Y-chromosome specific regions of the amelogenin gene and a PCR-based method for sex identification in red deer (Cervus elaphus). Mol. Biol. Rep. 2010, 37, 2915–2918. [Google Scholar] [CrossRef]
- Paul, S.; Ghosh, T.; Pandav, B.; Mohan, D.; Habib, B.; Nigam, P.; Mondol, S. Rapid molecular assays for species and sex iden-tification of swamp deer and other coexisting cervids in human-dominated landscapes of the Terai region and upper Gangetic plains, northern India: Implications in understanding species distribution and population parameters. J. Genet. 2019, 98, 44. [Google Scholar]
- Linacre, A.; Gusmao, L.; Hecht, W.; Hellmann, A.P.; Mayr, W.R.; Parson, W.; Prinz, M.; Schneider, P.M.; Morling, N. ISFG: Recommendations regarding the use of non-human (animal) DNA in forensic genetic investigations. Forensic Sci. Int. Genet. 2011, 5, 501–505. [Google Scholar] [CrossRef]
- Amorim, A. Nonhuman forensic genetics. Forensic Sci. Int. Genet. 2019, 7, 44–46. [Google Scholar] [CrossRef]
- Wilson, P.J.; White, B.N. Sex identification of elk (Cervus elaphus canadensis), moose (Alces alces), and white-tailed deer (Odocoileus virginianus) using the polymerase chain reaction. J. Forensic Sci. 1998, 43, 477–482. [Google Scholar] [CrossRef]
- Cadamuro, V.C.; Bouakaze, C.; Croze, M.; Schiavinato, S.; Tonasso, L.; Ge’rard, P.; Fausser, J.L.; Gibert, M.; Dugoujon, J.M.; Braga, J.; et al. Determined about sex: Sex-testing in 45 primate species using a 2Y/1X sex-typing assay. Forensic Sci. Int. Genet. 2015, 14, 96–107. [Google Scholar] [CrossRef]
- Strah, R.; Kunej, T. Molecular sexing assays in 114 mammalian species: In silico sequence reanalysis and a unified graphical visualization of diagnostic tests. Ecol. Evol. 2019, 9, 5018–5028. [Google Scholar] [CrossRef]
- Johnson, R.N.; Wilson-Wilde, L.; Linacre, A. Current and future directions of DNA in wildlife forensic science. Forensic Sci. Int. Genet. 2014, 10, 1–11. [Google Scholar] [CrossRef]
- Meiklejohn, K.A.; Burnham-Curtis, M.K.; Straughan, D.J.; Giles, J.; Moore, M.K. Current methods, future directions and considerations of DNA-based taxonomic identification in wildlife forensics. Forensic Sci. Int. 2021, 1, 100030. [Google Scholar] [CrossRef]
- Kanthaswamy, S. Review: Domestic animal forensic genetics biological evidence, genetic markers, analytical approaches and challenges. Anim. Genet. 2015, 46, 473–484. [Google Scholar] [CrossRef]
- Kurland, J.; Pires, S.F.; McFann, S.C.; Moreto, W.D. Wildlife crime: A conceptual integration, literature review, and methodological critique. Crime Sci. 2017, 6, 1. [Google Scholar] [CrossRef]
- Gudmannsson, P.; Berge, J.; Druid, H.; Ericsson, G.; Eriksson, A. A Unique Fatal Moose Attack Mimicking Homicide. J. Forensic Sci. 2018, 63, 622–625. [Google Scholar] [CrossRef]
- Shadrach, B.; Commane, M.; Hren, C.; Warshawsky, I. A Rare Mutation in the Primer Binding Region of the Amelogenin Gene Can Interfere with Gender Identification. J. Mol. Diagn. 2004, 6, 401–405. [Google Scholar] [CrossRef]
- Pajares, G.; Álvarez, I.; Fernández, I.; Pérez-pardal, L.; Goyache, F.; Royo, L.J. A sexing protocol for wild ruminants based on PCR amplification of amelogenin genes AMELX and AMELY (short communication). Arch. Tierz. Dummerstorf 2007, 50, 442–446. [Google Scholar] [CrossRef]
- Frank, K.; Bana, N.Á.; Bleier, N.; Sugár, L.; Nagy, J.; Wilhelm, J.; Kálmán, Z.; Barta, E.; Orosz, L.; Horn, P.; et al. Mining the red deer genome (CerEla1.0) to develop X-and Y-chromosome-linked STR markers. PLoS ONE 2020, 15, 0242506. [Google Scholar] [CrossRef]
- Tobe, S.S.; Linacre, A. DNA typing in wildlife crime: Recent developments in species identification. Forensic Sci. Med. Pathol. 2010, 6, 195–206. [Google Scholar] [CrossRef]
- Parkanyi, V.; Ondruska, L.; Vasicek, D.; Slamecka, J. Multilevel D-loop PCR identification of hunting game. Appl. Transl. Genom. 2013, 3, 1–7. [Google Scholar] [CrossRef][Green Version]
- Druml, B.; Hochegger, R.; Cichna-Markl, M. Duplex real-time PCR assay for the simultaneous determination of the roe deer (Capreolus capreolus) and deer (sum of fallow deer, red deer and sika deer) content in game meat products. Food Control 2015, 57, 370–376. [Google Scholar] [CrossRef]
- Ramón-Laca, A.; Gleeson, D.; Yockney, I.; Perry, M.; Nugent, G.; Forsyth, D.M. Reliable discrimination of 10 ungulate species using high resolution melting analysis of faecal DNA. PLoS ONE 2014, 9, 92043. [Google Scholar] [CrossRef]
- Mei, M.; Chen, R.; Gao, X.; Cao, Y.; Weng, W.; Duan, Y.; Tan, X.; Liu, Z. Establishment and application of a 10-plex liquid bead array for the simultaneous rapid detection of animal species. J. Sci. Food Agric. 2020, 100, 325–334. [Google Scholar] [CrossRef]
- Kaltenbrunner, M.; Hochegger, R.; Cichna-Markl, M. Tetraplex real-time PCR assay for the simultaneous identification and quantification of roe deer, red deer, fallow deer and sika deer for deer meat authentication. Food Chem. 2018, 269, 486–494. [Google Scholar] [CrossRef]
- The Scientific Working Group on DNA Analysis Methods (SWGDAM), SWGDAM Validation Guidelines for DNA Analysis Methods Approved 12/05/2016. Available online: https://www.swgdam.org/publications (accessed on 14 November 2021).
- SWFS Technical Working Group. Standards and Guidelines for Wildlife Forensic Analysis, 3rd ed.; Lucy, M.I., Ed.; Society for Wildlife Forensic Science: Springfield, MA, USA, 2018; p. 21. [Google Scholar]
- Marshall, H.D.; Johnstone, K.A.; Carr, S.M. Species-specific oligonucleotides and multiplex PCR for forensic discrimination of two species of scallops, Placopecten magellanicus and Chlamys islandica. Forensic Sci. Int. 2007, 167, 1–7. [Google Scholar] [CrossRef]
- Kim, M.J.; Lee, Y.M.; Suh, S.M.; Kim, H.Y. Species Identification of Red Deer (Cervus elaphus), Roe Deer (Capreolus capreolus), and Water Deer (Hydropotes inermis) Using Capillary Electrophoresis-Based Multiplex PCR. Foods 2020, 9, 982. [Google Scholar] [CrossRef]
- Koehler, A.V.; Zhang, Y.; Wang, T.; Haydon, S.R.; Gasser, R.B. Multiplex PCRs for the specific identification of marsupial and deer species from faecal samples as a basis for non-invasive epidemiological studies of parasites. Parasit. Vectors 2020, 13, 144. [Google Scholar] [CrossRef]
- Ogden, R.; Dawnay, N.; McEwing, R. Wildlife DNA forensics—Bridging the gap between conservation genetics and law enforcement. Endanger. Species Res. 2009, 9, 179–195. [Google Scholar] [CrossRef]
- Yang, F.; Ding, F.; Chen, H.; He, M.; Zhu, S.; Ma, X.; Jiang, L.; Li, H. DNA Barcoding for the Identification and Authentication of Animal Species in Traditional Medicine. Evid. Based Complement Alternat. Med. 2018, 18, 5160254. [Google Scholar] [CrossRef] [PubMed]
- Kaltenbrunner, M.; Hochegger, R.; Cichna-Markl, M. Design of Mismatch Primers to Identify and Differentiate Closely Related (Sub)Species: Application to the Authentication of Meat Products. Methods Mol. Biol. 2022, 2392, 65–82. [Google Scholar] [PubMed]
- Iacolina, L.; Corlatti, L.; Buzan, E.; Safner, T.; Šprem, N. Hybridisation in European ungulates: An overview of the current status, causes, and consequences. Mam. Rev. 2019, 49, 45–59. [Google Scholar] [CrossRef]
- Świsłocka, M.; Czajkowska, M.; Matosiuk, M.; Saveljev, A.P.; Ratkiewicz, M.; Borkowska, A. No evidence for recent introgressive hybridization between the European and Siberian roe deer in Poland. Mamm. Biol. 2019, 97, 59–63. [Google Scholar] [CrossRef]
- Šprem, N.; Stipoljev, S.; Ugarković, D.; Buzan, E. First genetic analysis of introduced axis deer from Croatia. Mamm. Biol. 2021, 101, 1121–1125. [Google Scholar] [CrossRef]
- Russell, T.; Cullingham, C.; Ball, M.; Pybus, M.; Coltman, D. Extent and direction of introgressive hybridization of mule and white-tailed deer in western Canada. Evol. Appl. 2021, 14, 1914–1925. [Google Scholar] [CrossRef]
- Štohlová Putnová, L.; Štohl, R.; Ernst, M.; Svobodová, K. A Microsatellite Genotyping-Based Genetic Study of Interspecific Hybridization between the Red and Sika Deer in the Western Czech Republic. Animals 2021, 11, 1701. [Google Scholar] [CrossRef]
- McDevitt, A.D.; Edwards, C.J.; O’Toole, P.; O’Sullivan, P.; O’Reilly, C.; Carden, R.F. Genetic structure of, and hybridisation between, red (Cervus elaphus) and sika (Cervus nippon) deer in Ireland. Mamm. Biol. 2009, 74, 263–273. [Google Scholar] [CrossRef]
- Smith, S.L.; Carden, R.F.; Coad, B.; Birkitt, T.; Pemberton, J.M. A survey of the hybridisation status of Cervus deer species on the island of Ireland. Conserv. Genet. 2014, 15, 823–835. [Google Scholar] [CrossRef][Green Version]
- Smith, S.L.; Senn, H.V.; Pérez-Espona, S.; Wyman, M.T.; Heap, E.; Pemberton, J. Introgression of exotic Cervus (nippon and canadensis) into red deer (Cervus elaphus) populations in Scotland and the English Lake District. Ecol. Evol. 2018, 8, 2122–2134. [Google Scholar] [CrossRef]
- Fan, H.; Wang, T.; Li, Y.; Liu, H.; Dong, Y.; Zhang, R.; Wang, H. Development and validation of a 1 K sika deer (Cervus nippon) SNP Chip. BMC Genom. Data 2021, 22, 35. [Google Scholar] [CrossRef]
- McFarlane, S.E.; Pemberton, J.M. Admixture mapping reveals loci for carcass mass in red deer x sika hybrids in Kintyre, Scotland. G3 Bethesda 2021, 11, 274. [Google Scholar] [CrossRef]
- Amorim, A.; Pereira, F.; Alves, C.; Garcia, O. Species assignment in forensics and the challenge of hybrids. Forensic Sci. Int. Genet. 2020, 48, 102333. [Google Scholar] [CrossRef]
- Lorenzini, R.; Fanelli, R.; Tancredi, F.; Siclari, A.; Garofalo, L. Matching STR and SNP genotyping to discriminate between wild boar, domestic pigs and their recent hybrids for forensic purposes. Sci. Rep. 2020, 10, 3188. [Google Scholar] [CrossRef]


| Marker | Primer Sequences 5′-3′ and Fluorescent Dye | Primer μM | Size in Base Pair (by Species) | GenBank Accession Numbers |
|---|---|---|---|---|
| AmelX/Y | F: 6-FAM_CAACACCACCAGCCAAAC | 1 | X: 194 (Ce, Dd, Cc) | MW876193-MW876195 |
| R: AATATcGGAGGCAGAGGT | Y: 140 (Ce) 149 (Dd, Cc) | MW876196 MW876197-MW876198 | ||
| SRY | F: 6-FAM_TCAGCAAGCAGCTGGGGTAT | 0.4 | 113 (Ce, Dd, Cc) | MW876187- MW876189 |
| R: ATAGCCCGGGTATTTGTCTC | ||||
| Cytb | F: GGgGCATCAATatTTTTcATcTGtcTgTTtA | 0.5 | 176 (Ce) | MW876190 |
| F: CTTTATCTGCCTATTCATCCATGTT | 0.5 | 162 (Dd) | MW876191 | |
| F: GACGTcAACTATGGtTGAATTATCCGATAtATACAT | 0.5 | 218 (Cc) | MW876192 | |
| R-univ: 6-FAM_GTTGCTCCTCAaAATGATATTTGTCC | 1.5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zenke, P.; Zorkóczy, O.K.; Lehotzky, P.; Ózsvári, L.; Pádár, Z. Molecular Sexing and Species Detection of Antlered European Hunting Game for Forensic Purposes. Animals 2022, 12, 246. https://doi.org/10.3390/ani12030246
Zenke P, Zorkóczy OK, Lehotzky P, Ózsvári L, Pádár Z. Molecular Sexing and Species Detection of Antlered European Hunting Game for Forensic Purposes. Animals. 2022; 12(3):246. https://doi.org/10.3390/ani12030246
Chicago/Turabian StyleZenke, Petra, Orsolya Krisztina Zorkóczy, Pál Lehotzky, László Ózsvári, and Zsolt Pádár. 2022. "Molecular Sexing and Species Detection of Antlered European Hunting Game for Forensic Purposes" Animals 12, no. 3: 246. https://doi.org/10.3390/ani12030246
APA StyleZenke, P., Zorkóczy, O. K., Lehotzky, P., Ózsvári, L., & Pádár, Z. (2022). Molecular Sexing and Species Detection of Antlered European Hunting Game for Forensic Purposes. Animals, 12(3), 246. https://doi.org/10.3390/ani12030246

