First Identification and Phylogenetic Analysis of Porcine Circovirus Type 4 in Fur Animals in Hebei, China
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Treatment
2.2. Viral Genome Extract and Detection
2.3. Viral Genome Sequencing
2.4. Sequence Alignment and Phylogenetic Analysis
3. Results
3.1. First Detected PCV4 in Fur Animals
3.2. PCV4 Co-Infection with PCV2 and PCV3 in Fur Animals
3.3. Tracking Study of PCV4 in Nearby Pig Farms
3.4. Sequence Alignment Analysis of PCV4 Strains
3.5. Phylogenetic Analysis of PCV4 Strains
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tischer, I.; Gelderblom, H.; Vettermann, W.; Koch, M.A. A very small porcine virus with circular single-stranded DNA. Nature 1982, 295, 64–66. [Google Scholar] [CrossRef] [PubMed]
- Palinski, R.; Piñeyro, P.; Shang, P.; Yuan, F.; Guo, R.; Fang, Y.; Byers, E.; Hause, B.M. A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J. Virol. 2017, 91, 1879–1886. [Google Scholar] [CrossRef] [PubMed]
- Rosario, K.; Breitbart, M.; Harrach, B.; Segalés, J.; Delwart, E.; Biagini, P.; Varsani, A. Revisiting the taxonomy of the family Circoviridae: Establishment of the genus Cyclovirus and removal of the genus Gyrovirus. Arch. Virol. 2017, 162, 1447–1463. [Google Scholar] [CrossRef]
- Finsterbusch, T.; Mankertz, A. Porcine circoviruses—Small but powerful. Virus Res. 2009, 143, 177–183. [Google Scholar] [CrossRef] [PubMed]
- Finsterbusch, T.; Steinfeldt, T.; Caliskan, R.; Mankertz, A. Analysis of the subcellular localization of the proteins Rep, Rep’ and Cap of porcine circovirus type 1. Virology 2005, 343, 36–46. [Google Scholar] [CrossRef]
- Hamel, A.L.; Lin, L.L.; Nayar, G.P. Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. J. Virol. 1998, 72, 5262–5267. [Google Scholar] [CrossRef] [PubMed]
- Tischer, I.; Mields, W.; Wolff, D.; Vagt, M.; Griem, W. Studies on epidemiology and pathogenicity of porcine circovirus. Arch. Virol. 1986, 91, 271–276. [Google Scholar] [CrossRef]
- Zhai, S.L.; Chen, S.N.; Xu, Z.H.; Tang, M.H.; Wang, F.G.; Li, X.J.; Sun, B.B.; Deng, S.F.; Hu, J.; Lv, D.H.; et al. Porcine circovirus type 2 in China: An update on and insights to its prevalence and control. Virol. J. 2014, 11, 88. [Google Scholar] [CrossRef]
- Chae, C. A review of porcine circovirus 2-associated syndromes and diseases. Vet. J. 2005, 169, 326–336. [Google Scholar] [CrossRef]
- Chae, C. Postweaning multisystemic wasting syndrome: A review of aetiology, diagnosis and pathology. Vet. J. 2004, 168, 41–49. [Google Scholar] [CrossRef]
- West, K.H.; Bystrom, J.M.; Wojnarowicz, C.; Shantz, N.; Jacobson, M.; Allan, G.M.; Haines, D.M.; Clark, E.G.; Krakowka, S.; McNeilly, F.; et al. Myocarditis and abortion associated with intrauterine infection of sows with porcine circovirus 2. Vet. Diagn. Investig. 1999, 11, 530–532. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.J. Spread like a wildfire—The omnipresence of porcine circovirus type 2 (PCV2) and its ever-expanding association with diseases in pigs. Virus Res. 2012, 164, 1–3. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-infection of swine with Porcine circovirus type 2 and other swine viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef] [PubMed]
- Phan, T.G.; Giannitti, F.; Rossow, S.; Marthaler, D.; Knutson, T.P.; Li, L.; Deng, X.; Resende, T.; Vannucci, F.; Delwart, E. Detection of a novel circovirus PCV3 in pigs with cardiac and multi-systemic inflammation. Virol. J. 2016, 13, 184. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, D.; Wang, J.; Zhu, S.; She, R.; Ren, X.; Tian, J.; Quan, R.; Hou, L.; Li, Z.; et al. Induction of porcine dermatitis and nephropathy syndrome in piglets by infection with Porcine circovirus type 3. J. Virol. 2019, 93, e02045-18. [Google Scholar] [CrossRef]
- Zhang, H.H.; Hu, W.Q.; Li, J.Y.; Liu, T.N.; Zhou, J.Y.; Opriessnig, T.; Xiao, C.T. Novel circovirus species identified in farmed pigs designated as Porcine circovirus 4, Hunan province, China. Transbound. Emerg. Dis. 2020, 67, 1057–1061. [Google Scholar] [CrossRef]
- Tian, R.B.; Zhao, Y.; Cui, J.T.; Zheng, H.H.; Xu, T.; Hou, C.Y.; Wang, Z.Y.; Li, X.S.; Zheng, L.L.; Chen, H.Y. Molecular detection and phylogenetic analysis of Porcine circovirus 4 in Henan and Shanxi Provinces of China. Transbound. Emerg. Dis. 2021, 68, 276–282. [Google Scholar] [CrossRef]
- Chen, N.; Xiao, Y.; Li, X.; Li, S.; Xie, N.; Yan, X.; Li, X.; Zhu, J. Development and application of a quadruplex real-time PCR assay for differential detection of porcine circoviruses (PCV1 to PCV4) in Jiangsu province of China from 2016 to 2020. Transbound. Emerg. Dis. 2021, 68, 1615–1624. [Google Scholar] [CrossRef]
- Sun, W.; Du, Q.; Han, Z.; Bi, J.; Lan, T.; Wang, W.; Zheng, M. Detection and genetic characterization of Porcine circovirus 4 (PCV4) in Guangxi, China. Gene 2021, 773, 145384. [Google Scholar] [CrossRef]
- Wu, H.; Hou, C.; Wang, Z.; Meng, P.; Chen, H.; Cao, H. First complete genomic sequence analysis of Porcine circovirus type 4 (PCV4) in wild boars. Vet. Microbiol. 2022, 273, 109547. [Google Scholar] [CrossRef]
- Ha, Z.; Yu, C.; Xie, C.; Wang, G.; Zhang, Y.; Hao, P.; Li, J.; Li, Z.; Li, Y.; Rong, F.; et al. Retrospective surveillance of Porcine circovirus 4 in pigs in Inner Mongolia, China, from 2016 to 2018. Arch. Virol. 2021, 166, 1951–1959. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, V.G.; Do, H.Q.; Huynh, T.M.; Park, Y.H.; Park, B.K.; Chung, H.C. Molecular-based detection, genetic characterization and phylogenetic analysis of Porcine circovirus 4 from Korean domestic swine farms. Transbound. Emerg. Dis. 2022, 69, 538–548. [Google Scholar] [CrossRef] [PubMed]
- Rakibuzzaman, A.; Ramamoorthy, S. Comparative immunopathogenesis and biology of recently discovered porcine circoviruses. Transbound. Emerg. Dis. 2021, 68, 2957–2968. [Google Scholar] [CrossRef]
- Ge, M.; Hu, W.Q.; Ning, K.M.; Li, S.Y.; Xiao, C.T. The seroprevalence of the newly identified Porcine circovirus type 4 in China investigated by an enzyme-linked immunosorbent assay. Transbound. Emerg. Dis. 2021, 68, 2910–2914. [Google Scholar] [CrossRef]
- Niu, G.; Zhang, X.; Ji, W.; Chen, S.; Li, X.; Yang, L.; Zhang, L.; Ouyang, H.; Li, C.; Ren, L. Porcine circovirus 4 rescued from an infectious clone is replicable and pathogenic in vivo. Transbound. Emerg. Dis. 2022, 69, 1632–1641. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.; Chen, X.M.; Fu, Y.; Ai, Y.; Wang, D.M.; Wei, Z.Y.; Li, X.S.; Zheng, L.L.; Chen, H.Y. Cross-species transmission of an emerging Porcine circovirus 4 (PCV4): First molecular detection and retrospective investigation in dairy cows. Vet. Microbiol. 2022, 273, 109528. [Google Scholar] [CrossRef]
- Song, T.; Hao, J.; Zhang, R.; Tang, M.; Li, W.; Hui, W.; Fu, Q.; Wang, C.; Xin, S.; Zhang, S.; et al. First detection and phylogenetic analysis of porcine circovirus type 2 in raccoon dogs. BMC Vet. Res. 2019, 15, 107. [Google Scholar] [CrossRef]
- Song, T.; Zhang, S.; Hao, J.; Xin, S.; Hui, W.; Tang, M.; Li, W.; Tian, R.; Liu, X.; Rui, P.; et al. First detection and genetic analysis of fox-origin Porcine circovirus type 2. Transbound. Emerg. Dis. 2019, 66, 1–6. [Google Scholar] [CrossRef]
- Meng, X.J. Porcine circovirus type 2 (PCV2): Pathogenesis and interaction with the immune system. Annu. Rev. Anim. Biosci. 2013, 1, 43–64. [Google Scholar] [CrossRef]
- Karuppannan, A.K.; Opriessnig, T. Porcine circovirus type 2 (PCV2) vaccines in the context of current molecular epidemiology. Viruses 2017, 9, 99. [Google Scholar] [CrossRef]
Primer Name | Sequence | Purpose | Size (bp) |
---|---|---|---|
PCV2-F | CTCCGGTAAGCGCCTCCTTG | Detection | 883 |
PCV2-R | GATAGAGAGCTTCTACAGCTG | ||
PCV3-F | TTACTTAGAGAACGGACTTGTAACG | Detection | 649 |
PCV3-R | AAATAGACACAGAGCTATATTCAG | ||
PCV4-F | CGGTGAGTTCCCGTCTGTATTT | Detection | 391 |
PCV4-R | TCACGGGCCACTTCACTCAT |
Fur Animal Species | Total Samples | PCV4-Positive Samples | PCV4-Positive Rate |
---|---|---|---|
Raccoon dog | 108 | 22 | 20.37% |
Fox | 16 | 3 | 18.75% |
Mink | 13 | 7 | 53.85% |
Total | 137 | 32 | 23.36% |
Fur Animal Species | Total Samples | Samples Co-Infectied with PCV4 | |||
---|---|---|---|---|---|
PCV2 | PCV3 | ||||
Raccoon dog | 108 | 8/108 | 7.41% | 10/108 | 9.26% |
Fox | 16 | 1/16 | 6.25% | 1/16 | 6.25% |
Mink | 13 | 4/13 | 30.77% | 3/13 | 23.08% |
Total | 137 | 13/137 | 9.49% | 14/137 | 10.22% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Yan, S.; Ji, Y.; Yang, Y.; Rui, P.; Ma, Z.; Qiu, H.-J.; Song, T. First Identification and Phylogenetic Analysis of Porcine Circovirus Type 4 in Fur Animals in Hebei, China. Animals 2022, 12, 3325. https://doi.org/10.3390/ani12233325
Wang Y, Yan S, Ji Y, Yang Y, Rui P, Ma Z, Qiu H-J, Song T. First Identification and Phylogenetic Analysis of Porcine Circovirus Type 4 in Fur Animals in Hebei, China. Animals. 2022; 12(23):3325. https://doi.org/10.3390/ani12233325
Chicago/Turabian StyleWang, Yanjin, Shijie Yan, Yuting Ji, Yujie Yang, Ping Rui, Zengjun Ma, Hua-Ji Qiu, and Tao Song. 2022. "First Identification and Phylogenetic Analysis of Porcine Circovirus Type 4 in Fur Animals in Hebei, China" Animals 12, no. 23: 3325. https://doi.org/10.3390/ani12233325
APA StyleWang, Y., Yan, S., Ji, Y., Yang, Y., Rui, P., Ma, Z., Qiu, H.-J., & Song, T. (2022). First Identification and Phylogenetic Analysis of Porcine Circovirus Type 4 in Fur Animals in Hebei, China. Animals, 12(23), 3325. https://doi.org/10.3390/ani12233325