Maternal Dietary Supplementation with γ-Aminobutyric Acid Alleviated Oxidative Stress in Gestating Sows and Their Offspring by Regulating GABRP
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Diets, and Experimental Design
2.2. Sample Collection
2.3. Oxidative Stress Evaluation
2.4. Cell Culture and Treatment
2.5. Cell Viability Assay
2.6. RNA Isolation, cDNA Synthesis, and Real-Time Quantitative PCR (RT-qPCR)
2.7. Statistical Analysis
3. Results
3.1. Effects of Maternal Supplementation with GABA during Late Gestation on Litter’s Characteristics of the Sows
3.2. Effects of Maternal Supplementation with GABA during Late Gestation on Plasma Oxidative Stress of Sows
3.3. Effects of Maternal Supplementation with GABA during Late Gestation on Plasma Oxidative Stress of Piglets
3.4. Effects of GABA on H2O2-Induced Cell Viability of pTr-2 Cells
3.5. Effects of GABA on H2O2-Induced Antioxidant Parameters of pTr-2 Cells
3.6. Effects of GABA on Gene Expression of CAT, SOD-1, Nrf2, and GABRP in H2O2-Induced pTr-2 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Al-Gubory, K.H.; Fowler, P.A.; Garrel, C. The roles of cellular reactive oxygen species, oxidative stress and antioxidants in pregnancy outcomes. Int. J. Biochem. Cell Biol. 2010, 42, 1634–1650. [Google Scholar] [CrossRef]
- Biondi, C.; Pavan, B.; Lunghi, L.; Florini, S.; Vesce, F. The role and modulation of the oxidative balance in pregnancy. Curr. Pharm. Des. 2005, 11, 2075–2089. [Google Scholar] [CrossRef] [PubMed]
- Pereira, A.C.; Martel, F. Oxidative stress in pregnancy and fertility pathologies. Cell Biol. Toxicol. 2014, 30, 301–312. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.; Yang, S.; Chen, F.; Guan, W.; Zhang, S. Nutritional strategies to alleviate oxidative stress in sows. Anim. Nutr. 2022, 9, 60–73. [Google Scholar] [CrossRef] [PubMed]
- Case, G.V.; Storey, K.M.; Parmeley, L.E.; Schulz, L.C. Effects of maternal nutrient restriction during the periconceptional period on placental development in the mouse. PLoS ONE 2021, 16, e0244971. [Google Scholar]
- Hart, B.; Morgan, E.; Alejandro, E.U. Nutrient sensor signaling pathways and cellular stress in fetal growth restriction. J. Mol. Endocrinol. 2019, 62, R155–R165. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Bazer, F.W.; Satterfield, M.C.; Li, X.; Wang, X.; Johnson, G.A.; Burghardt, R.C.; Dai, Z.; Wang, J.; Wu, Z. Impacts of arginine nutrition on embryonic and fetal development in mammals. Amino Acids 2013, 45, 241–256. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Burghardt, R.C.; Johnson, G.A.; Kim, S.W.; Li, X.L.; Satterfield, M.C.; Spencer, T.E. Impacts of amino acid nutrition on pregnancy outcome in pigs: Mechanisms and implications for swine production. J. Anim. Sci. 2010, 88 (Suppl. 13), E195–E204. [Google Scholar] [CrossRef]
- Gootwine, E. Placental hormones and fetal-placental development. Anim. Reprod. Sci. 2004, 82-83, 551–566. [Google Scholar] [CrossRef]
- Strumpf, D.; Mao, C.A.; Yamanaka, Y.; Ralston, A.; Chawengsaksophak, K.; Beck, F.; Rossant, J. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development 2005, 132, 2093–2102. [Google Scholar] [CrossRef]
- Bhagat, K.; Singh, J.V.; Pagare, P.P.; Kumar, N.; Sharma, A.; Kaur, G.; Kinarivala, N.; Gandu, S.; Singh, H.; Sharma, S.; et al. Rational approaches for the design of various GABA modulators and their clinical progression. Mol. Divers. 2021, 25, 551–601. [Google Scholar] [CrossRef]
- Cheng, J.B.; Zheng, N.; Sun, X.Z.; Li, S.L.; Wang, J.Q.; Zhang, Y.D. Feeding rumen-protected gamma-aminobutyric acid enhances the immune response and antioxidant status of heat-stressed lactating dairy cows. J. Therm. Biol. 2016, 60, 103–108. [Google Scholar] [CrossRef]
- Fan, Z.Y.; Chen, Y.H.; Wang, J.J.; Deng, J.P.; Hou, D.X.; Li, T.J.; Yang, L.Y.; Liu, Z.H.; Wu, X.S. Determination of GABA(A alpha 1) and GABA(B1) receptor subunits expression in tissues of gilts during the late gestation. Mol. Biol. Rep. 2013, 40, 1377–1384. [Google Scholar] [CrossRef]
- Gladkevich, A.; Korf, J.; Hakobyan, V.P.; Melkonyan, K.V. The peripheral GABAergic system as a target in endocrine disorders. Auton. Neurosci.-Basic Clin. 2006, 124, 1–8. [Google Scholar] [CrossRef]
- Chen, J.; Mao, Y.Q.; Guo, K.; Wu, H.S.; Song, X.Z.; Qu, M.R.; Lan, L.T.; Luo, J.R. The synergistic effect of traditional Chinese medicine prescription and rumen-protected gamma-aminobutyric acid on beef cattle under heat stress. J. Anim. Physiol. Anim. Nutr. 2021, 105, 807–815. [Google Scholar] [CrossRef]
- Li, J.P.; Jiang, M.W.; Han, Q.X.; Peng, R.B.; Jiang, X.M. Effects of gamma-aminobutyric acid supplementation on the growth performance, serum biochemical indices and antioxidant status of pharaoh cuttlefish, Sepia pharaonis. Aquac. Nutr. 2020, 26, 1026–1034. [Google Scholar] [CrossRef]
- Urrutia, A.; Garcia-Angulo, V.A.; Fuentes, A.; Caneo, M.; Legue, M.; Urquiza, S.; Delgado, S.E.; Ugalde, J.; Burdisso, P.; Calixto, A. Bacterially produced metabolites protect C. elegans neurons from degeneration. PLoS Biol. 2020, 18, e3000638. [Google Scholar] [CrossRef]
- Lu, J.J.; Zhang, Q.; Tan, D.M.; Luo, W.P.; Zhao, H.; Ma, J.; Liang, H.; Tan, Y. GABA A receptor pi subunit promotes apoptosis of HTR-8/SVneo trophoblastic cells: Implications in preeclampsia. Int. J. Mol. Med. 2016, 38, 105–112. [Google Scholar] [CrossRef]
- Sadeghi, H.; Taylor, H.S. HOXA10 regulates endometrial GABA(A) pi receptor expression and membrane translocation. Am. J. Physiol.-Endocrinol. Metab. 2010, 298, E889–E893. [Google Scholar] [CrossRef]
- Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. BOARD-INVITED REVIEW: Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci. 2006, 84, 2316–2337. [Google Scholar] [CrossRef]
- Cheng, X.H.; Chapple, S.J.; Patel, B.; Puszyk, W.; Sugden, D.; Yin, X.K.; Mayr, M.; Siow, R.C.M.; Mann, G.E. Gestational diabetes mellitus impairs Nrf2-mediated adaptive antioxidant defenses and redox signaling in fetal endothelial cells in utero. Diabetes 2013, 62, 4088–4097. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berchieri-Ronchi, C.B.; Kim, S.W.; Zhao, Y.; Correa, C.R.; Yeum, K.J.; Ferreira, A.L.A. Oxidative stress status of highly prolific sows during gestation and lactation. Animal 2011, 5, 1774–1779. [Google Scholar] [CrossRef] [PubMed]
- Vannucchi, C.I.; Jordao, A.A.; Vannucchi, H. Antioxidant compounds and oxidative stress in female dogs during pregnancy. Res. Vet. Sci. 2007, 83, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Levy, R.; Smith, S.D.; Chandler, K.; Sadovsky, Y.; Nelson, M. Apoptosis in human cultured trophoblasts is enhanced by hypoxia and diminished by epidermal growth factor. Am. J. Physiol. Cell Physiol. 2000, 278, C982–C988. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Luo, W.L.; Li, S.H.; Zhao, S.; Sho, T.; Xu, X.; Zhang, J.; Xu, W.N.; Xu, J.X. Reactive oxygen species mediated placental oxidative stress, mitochondrial content, and cell cycle progression through mitogen-activated protein kinases in intrauterine growth restricted pigs. Reprod. Biol. 2018, 18, 422–431. [Google Scholar] [CrossRef]
- Lanoix, D.; Lacasse, A.A.; Reiter, R.J.; Vaillancourt, C. Melatonin: The watchdog of villous trophoblast homeostasis against hypoxia/reoxygenation-induced oxidative stress and apoptosis. Mol. Cell. Endocrinol. 2013, 381, 35–45. [Google Scholar] [CrossRef]
- Hashemzadeh, M.; Zendehdel, M.; Babapour, V.; Panahi, N. Interaction between central GABAA receptor and dopaminergic system on food intake in neonatal chicks: Role of D-1 and GABA(A) receptors. Int. J. Neurosci. 2018, 128, 361–368. [Google Scholar] [CrossRef]
- Hu, H.; Bai, X.; Shah, A.A.; Dai, S.F.; Wang, L.K.; Hua, J.L.; Che, C.Y.; He, S.J.; Wen, A.Y.; Jiang, J.P. Interactive effects of glutamine and gamma-aminobutyric acid on growth performance and skeletal muscle amino acid metabolism of 22-42-day-old broilers exposed to hot environment. Int. J. Biometeorol. 2016, 60, 907–915. [Google Scholar] [CrossRef]
- Xie, X.Z.; Liang, C.; Li, M.H.; Chen, Z. Effects of GABA on the thymus cytokines of Wenchang Chickens submitted to heat stress. Braz. J. Poult. Sci. 2017, 19, 143–149. [Google Scholar] [CrossRef]
- Abdouh, M. 5-HT1A-mediated promotion of mitogen-activated T and B cell survival and proliferation is associated with increased translocation of NF-κB to the nucleus. Brain Behav. Immun. 2004, 18, 24–34. [Google Scholar] [CrossRef]
- Gaukroger, C.H.; Edwards, S.A.; Walshaw, J.; Nelson, A.; Adams, I.P.; Stewart, C.J.; Kyriazakis, I. Shifting sows: Longitudinal changes in the periparturient faecal microbiota of primiparous and multiparous sows. Animal 2021, 15, 100135. [Google Scholar] [CrossRef]
- Zhang, Q.; Pi, J.B.; Woods, C.G.; Andersen, M.E. A systems biology perspective on Nrf2-mediated antioxidant response. Toxicol. Appl. Pharmacol. 2010, 244, 84–97. [Google Scholar] [CrossRef]
- Yu, M.; Wei, Z.Y.; Xu, Z.H.; Pan, J.Q.; Chen, J.H. Oxidative damage and Nrf2 translocation induced by toxicities of deoxynivalenol on the placental and embryo on gestation day 12.5 d and 18.5 d. Toxins 2018, 10, 370. [Google Scholar] [CrossRef]
- Xie, Z.X.; Xia, S.F.; Qiao, Y.; Shi, Y.H.; Le, G.W. Effect of GABA on oxidative stress in the skeletal muscles and plasma free amino acids in mice fed high-fat diet. J. Anim. Physiol. Anim. Nutr. 2015, 99, 492–500. [Google Scholar] [CrossRef]
- Zhu, Z.H.; Shi, Z.G.; Xie, C.L.; Gong, W.B.; Hu, Z.X.; Peng, Y.D. A novel mechanism of Gamma-aminobutyric acid (GABA) protecting human umbilical vein endothelial cells (HUVECs) against H2O2-induced oxidative injury. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2019, 217, 68–75. [Google Scholar] [CrossRef]
- Pugliero, S.; Lima, D.Y.; Rodrigues, A.M.; Bogsan, C.S.B.; Rogero, M.M.; Punaro, G.R.; Higa, E.M.S. Kefir reduces nitrosative stress and upregulates Nrf2 in the kidney of diabetic rats. Int. Dairy J. 2021, 114, 104909. [Google Scholar] [CrossRef]
- Vnukov, V.V.; Gutsenko, O.I.; Milyutina, N.P.; Kornienko, I.V.; Ananyan, A.A.; Plotnikov, A.A.; Panina, S.B. SkQ1 regulates expression of Nrf2, ARE-controlled genes encoding antioxidant enzymes, and their activity in cerebral cortex under oxidative stress. Biochem.-Mosc. 2017, 82, 942–952. [Google Scholar] [CrossRef]
- Zhuang, Y.; Wu, H.R.; Wang, X.X.; He, J.Y.; He, S.P.; Yin, Y.L. Resveratrol attenuates oxidative stress-induced intestinal barrier injury through PI3K/Akt-mediated Nrf2 signaling pathway. Oxidative Med. Cell. Longev. 2019, 2019, 7591840. [Google Scholar] [CrossRef]
- Kao, L.C.; Tulac, S.; Lobo, S.; Imani, B.; Yang, J.P.; Germeyer, A.; Osteen, K.; Taylor, R.N.; Lessey, B.A.; Giudice, L.C. Global gene profiling in human endometrium during the window of implantation. Endocrinology 2002, 143, 2119–2138. [Google Scholar] [CrossRef]
- Quezada, M.; Henriquez, S.; Vargas, M.; Cardenas, H.; Tapia, A.; Rios, M.; Salvatierra, A.M.; Orihuela, P.A.; Croxatto, H.B.; Velasquez, L. Proenkephalin A and the gamma-aminobutyric acid A receptor pi subunit: Expression, localization, and dynamic changes in human secretory endometrium. Fertil. Steril. 2006, 86, 1750–1757. [Google Scholar] [CrossRef]
Items | CON |
---|---|
Corn | 60.00 |
Wheat bran | 16.00 |
Soybean meal | 19.00 |
Soybean oil | 1.00 |
Premix 1 | 4.00 |
Nutrient levels 2 | |
DM | 90.41 |
DE (MJ/kg) | 3159 |
CP | 15.97 |
EE | 2.36 |
Calcium | 0.83 |
Total phosphorus | 0.47 |
L-Lysine | 0.86 |
L-Methionine | 0.23 |
L-Tryptophan | 0.18 |
L-Threonine | 0.59 |
NDF | 18.15 |
ADF | 5.09 |
Genes | Sequences 5′-3′ | Tm, °C |
---|---|---|
Nrf2 | F: GAAAGCCCAGTCTTCATTGC R: TTGGAACCGTGCTAGTCTCA | 52 |
SOD-1 | F: ACCTGGGCAATGTGACTG R: TCCAGCATTTCCCGTCT | 52 |
CAT | F: AACTGTCCCTTCCGTGCTA R: CCTGGGTGACATTATCTTCG | 52 |
GABRP | F: CGGATCAGCGGCTAGTGTT R: CGGTGACTTCGTGGAGGAA | 55 |
Items | CON | GABA | p Value |
---|---|---|---|
Total piglets (n) | 12.50 ± 1.30 | 12.63 ± 0.59 | 0.93 |
Live piglets (n) | 11.75 ± 1.29 | 12.13 ± 0.44 | 0.78 |
Stillborn (n) | 0.75 ± 0.31 | 0.50 ± 0.26 | 0.55 |
Total litter weight (live, kg) | 16.06 ± 1.83 | 18.79 ± 1.06 | 0.22 |
Average birth weight (live, kg) | 1.38 ± 0.07 | 1.57 ± 0.10 | 0.14 |
IUGR piglets a (n) | 1.00 ±0.38 | 0.25 ±0.16 | 0.09 |
Items | CON | CON(CV) | GABA | GABA(CV) | p Value |
---|---|---|---|---|---|
Sows | |||||
CAT (U/mL) | 19.42 ± 1.91 | 0.2944 | 19.67 ± 1.50 | 0.2294 | 0.92 |
GSH-Px (U/mL) | 696.70 ± 59.54 | 0.2564 | 582.70 ± 58.91 | 0.3033 | 0.19 |
SOD (U/mL) | 62.32 ± 2.84 | 0.1368 | 72.42 ± 2.57 | 0.1064 | 0.02 |
MDA (nmol/L) | 7.20 ± 0.38 | 0.1474 | 6.61 ±0.43 | 0.1828 | 0.32 |
Piglets | |||||
CAT (U/mL) | 19.42 ± 1.94 | 0.2450 | 21.30 ± 1.51 | 0.1737 | 0.46 |
GSH-Px (U/mL) | 663.90 ± 21.85 | 0.0806 | 779.80 ± 44.00 | 0.1382 | 0.04 |
SOD (U/mL) | 64.98 ± 3.56 | 0.1344 | 69.90 ± 3.98 | 0.1394 | 0.38 |
MDA (nmol/L) | 7.56 ± 0.58 | 0.1882 | 7.48 ± 0.55 | 0.1788 | 0.93 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Jiang, L.; Pang, J.; Wu, Y.; Pi, Y.; Zang, J.; Wang, J.; Han, D. Maternal Dietary Supplementation with γ-Aminobutyric Acid Alleviated Oxidative Stress in Gestating Sows and Their Offspring by Regulating GABRP. Animals 2022, 12, 2539. https://doi.org/10.3390/ani12192539
Liu X, Jiang L, Pang J, Wu Y, Pi Y, Zang J, Wang J, Han D. Maternal Dietary Supplementation with γ-Aminobutyric Acid Alleviated Oxidative Stress in Gestating Sows and Their Offspring by Regulating GABRP. Animals. 2022; 12(19):2539. https://doi.org/10.3390/ani12192539
Chicago/Turabian StyleLiu, Xiaoyi, Lili Jiang, Jiaman Pang, Yujun Wu, Yu Pi, Jianjun Zang, Junjun Wang, and Dandan Han. 2022. "Maternal Dietary Supplementation with γ-Aminobutyric Acid Alleviated Oxidative Stress in Gestating Sows and Their Offspring by Regulating GABRP" Animals 12, no. 19: 2539. https://doi.org/10.3390/ani12192539
APA StyleLiu, X., Jiang, L., Pang, J., Wu, Y., Pi, Y., Zang, J., Wang, J., & Han, D. (2022). Maternal Dietary Supplementation with γ-Aminobutyric Acid Alleviated Oxidative Stress in Gestating Sows and Their Offspring by Regulating GABRP. Animals, 12(19), 2539. https://doi.org/10.3390/ani12192539