Multilocus Sequence Genotype Heterogeneity in Streptococcus uberis Isolated from Bovine Mastitis in the Czech Republic
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Sampling
2.2. Bacterial Isolation and Identification
2.3. Virulence Factors Determination
2.4. Antimicrobial Susceptibility Testing
2.5. Multilocus Sequence Typing
3. Results
3.1. MLST and MLST Genotyping
3.2. Virulence Profiling
3.3. Antimicrobial Resistance Profiling
3.4. Distribution of AMR Profiles and Virulence Profiles in MLST Genotypes
3.5. Heterogeneity of S. uberis within a Herd
3.6. Association of Genotypes with the Source of Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wente, N.; Klocke, D.; Paduch, J.H.; Zhang, Y.; Seeth, M.T.; Zoche-Golob, V.; Reinecke, F.; Mohr, E.; Krömker, V. Associations between Streptococcus uberis strains from the animal environment and clinical bovine mastitis cases. J. Dairy Sci. 2019, 102, 9360–9369. [Google Scholar] [CrossRef] [PubMed]
- Zadoks, R.N.; Gillespie, B.E.; Barkema, H.W.; Sampimon, O.C.; Oliver, S.P.; Schukken, Y.H. Clinical, epidemiological and molecular characteristics of Streptococcus uberis infections in dairy herds. Epidemiol. Infect. 2003, 130, 335–349. [Google Scholar] [CrossRef]
- Zadoks, R.N.; Tikofsky, L.L.; Boor, K.J. Ribotyping of Streptococcus uberis from a dairy’s environment, bovine feces and milk. Vet. Microbiol. 2005, 109, 257–265. [Google Scholar] [CrossRef]
- Kromker, V.; Reinecke, F.; Paduch, J.H.; Grabowski, N. Bovine Streptococcus uberis intramammary infections and mastitis. Clin. Microbial. 2014, 3, 157. [Google Scholar] [CrossRef]
- Phuektes, P.; Mansell, P.D.; Dyson, R.S.; Hooper, N.D.; Dick, J.S.; Browning, G.F. Molecular epidemiology of Streptococcus uberis isolates from dairy cows with mastitis. J. Clin. Microbiol. 2001, 39, 1460–1466. [Google Scholar] [CrossRef]
- Tassi, R.; McNeilly, T.; Fitzpatrick, J.; Fontaine, M.; Reddick, D.; Ramage, C.; Lutton, M.; Schukken, Y.; Zadoks, R. Strain-specific pathogenicity of putative host-adapted and nonadapted strains of Streptococcus uberis in dairy cattle. J. Dairy Sci. 2013, 96, 5129–5145. [Google Scholar] [CrossRef]
- Pryor, S.M.; Cursons, R.T.; Williamson, J.H.; Lacy-Hulbert, S.J. Experimentally induced intramammary infection with multiple strains of Streptococcus uberis. J. Dairy Sci. 2009, 92, 5467–5475. [Google Scholar] [CrossRef]
- Davies, P.L.; Leigh, J.A.; Bradley, A.J.; Archer, S.C.; Emes, R.D.; Green, M.J. Molecular epidemiology of Streptococcus uberis clinical mastitis in dairy herds: Strain heterogeneity and transmission. J. Clin. Microbiol. 2016, 54, 68–74. [Google Scholar] [CrossRef]
- Preez, J.H. Bovine mastitis therapy and why it fails: Continuing education. J. S. Afr. Vet. Assoc. 2000, 71, 201–208. [Google Scholar] [CrossRef]
- Kaczorek, E.; Malaczewska, J.; Wojcik, R.; Siwicki, A.K. Biofilm production and other virulence factors in Streptococcus spp. isolated from clinical cases of bovine mastitis in Poland. BMC Vet. Res. 2017, 13, 398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Käppeli, N.; Morach, M.; Zurfluh, K.; Corti, S.; Nüesch-Inderbinen, M.; Stephan, R. Sequence types and antimicrobial resistance profiles of streptococcus uberis isolated from bovine mastitis. Front. Vet. Sci. 2019, 6, 234. [Google Scholar] [CrossRef] [PubMed]
- Rahman, A.; Bhattacharjee, A.; Tabassum, T.; Islam, M.A.; Hossain, M. Prevalence and population biology of mastitis-causing Streptococcus uberis using an MLST based approach. J. Adv. Biotechnol. Exp. Ther. 2021, 4, 311–321. [Google Scholar] [CrossRef]
- Vezina, B.; Al-harbi, H.; Ramay, H.R.; Soust, M.; Moore, R.J.; Olchowy, T.W.J. Sequence characterisation and novel insights into bovine mastitis-associated Streptococcus uberis in dairy herds. Sci. Rep. 2021, 11, 3046. [Google Scholar] [CrossRef]
- Coffey, T.J.; Pullinger, G.D.; Urwin, R.; Jolley, K.A.; Wilson, S.M.; Maiden, M.C. First Insights into the Evolution of Streptococcus uberis: A Multilocus Sequence Typing Scheme That Enables Investigation of Its Population Biology. Appl. Environ. Microbiol. 2006, 72, 1420–1428. [Google Scholar] [CrossRef] [PubMed]
- Field, T.R.; Ward, P.N.; Pedersen, L.H.; Leigh, J.A. The hyaluronic acid capsule of Streptococcus uberis is not required for the development of infection and clinical mastitis. Infect. Immun. 2003, 71, 132–139. [Google Scholar] [CrossRef] [PubMed]
- Reinoso, E.B.; Lasagno, M.C.; Dieser, S.A.; Odierno, L.M. Distribution of virulence-associated genes in Streptococcus uberis isolated from bovine mastitis. FEMS Microbiol. Lett. 2011, 318, 183–188. [Google Scholar] [CrossRef]
- Smith, A.J.; Kitt, A.J.; Ward, P.N.; Leigh, J.A. Isolation and characterization of a mutant strain of Streptococcus uberis, which fails to utilize a plasmin derived beta-casein peptide for the acquisition of methionine. J. Appl. Microbiol. 2002, 93, 631–639. [Google Scholar] [CrossRef]
- Zadoks, R.N.; Schukken, Y.H.; Wiedmann, M. Multilocus sequence typing of Streptococcus uberis provides sensitive and epidemiologically relevant subtype information and reveals positive selection in the virulence gene pauA. J. Clin. Microbiol. 2005, 43, 2407–2417. [Google Scholar] [CrossRef]
- Hassan, A.A.; Khan, I.U.; Abdulmawjood, A.; Lammler, C. Evaluation of PCR methods for rapid identification and differentiation of Streptococcus uberis and Streptococcus parauberis. J. Clin. Microbiol. 2001, 39, 1618–1621. [Google Scholar] [CrossRef]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals: Second Informational Supplement, 4th ed.; CLSI Document VET01-S2; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013; p. 70. [Google Scholar]
- CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 5th ed.; CLSI Supplement VET01S; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
- EUCAST. European Committee on Antimicrobial Susceptibility Testing, Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 11.0. 2021. Available online: http://www.eucast.org (accessed on 2 May 2022).
- CA-SFM. Comité de l’Antibiogramme de la Société Francaise de Microbiologie—Recommandations Vétérinaries; Société Francaise de Microbiologie: Paris, France, 2018; p. 15. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Silva, N.C.C.; Yang, Y.; Rodrigues, M.X.; Tomazi, T.; Bicalho, R.C. Whole-genome sequencing reveals high genetic diversity of Streptococcus uberis isolated from cows with mastitis. BMC Vet. Res. 2021, 17, 321. [Google Scholar] [CrossRef] [PubMed]
- Tomita, T.; Meehan, B.; Wongkattiya, N.; Malmo, J.; Pullinger, G.; Leigh, J.; Deighton, M. Identification of Streptococcus uberis multilocus sequence types highly associated with mastitis. Appl. Environ. Microbiol. 2008, 74, 114–124. [Google Scholar] [CrossRef] [PubMed]
- Reyes, J.; Rodriguez-Lecompte, J.C.; Blanchard, A.; McClure, J.T.; Sánchez, J. Molecular variability of Streptococcus uberis isolates from intramammary infections in Canadian dairy farms from the Maritime region. Can. J. Vet. Res. 2019, 83, 168–176. [Google Scholar] [PubMed]
- Pullinger, G.D.; López-Benavides, M.; Coffey, T.J.; Williamson, J.H.; Cursons, R.T.; Summers, E.; Lacy-Hulbert, J.; Maiden, M.C.; Leigh, J.A. Application of Streptococcus uberis multilocus sequence typing: Analysis of the population structure detected among environmental and bovine isolates from New Zealand and the United Kingdom. Appl. Environ. Microbiol. 2006, 72, 1429–1436. [Google Scholar] [CrossRef] [PubMed]
- Hossain, M.; Egan, S.A.; Coffey, T.; Ward, P.N.; Wilson, R.; Leigh, J.A.; Emes, R.D. Virulence related sequences; insights provided by comparative genomics of Streptococcus uberis of differing virulence. BMC Genom. 2015, 16, 334. [Google Scholar] [CrossRef]
- Boonyayatra, S.; Tharavichitkul, P.; Oliver, S.P. Virulence-associated genes and molecular typing of Streptococcus uberis associated with bovine mastitis in northern Thailand. Turk. J. Vet. Anim. Sci. 2018, 42, 73–81. [Google Scholar] [CrossRef]
- Abd El-Aziz, N.K.; Ammar, A.M.; El Damaty, H.M.; Abd Elkader, R.A.; Saad, H.A.; El-Kazzaz, W.; Khalifa, E. Environmental Streptococcus uberis Associated with Clinical Mastitis in Dairy Cows: Virulence Traits, Antimicrobial and Biocide Resistance, and Epidemiological Typing. Animals 2021, 11, 1849. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.U.; Hassan, A.A.; Abdulmawjood, A.; Lammler, C.; Wolter, W.; Zschock, M. Identification and epidemiological characterization of Streptococcus uberis isolated from bovine mastitis using conventional and molecular methods. J. Vet. Sci. 2003, 4, 213–224. [Google Scholar] [CrossRef]
Virulence Factor | Genes | Nucleotide Sequence (5′-3′) | Amplicon Size | References |
---|---|---|---|---|
Hyaluronic acid | hasA | GAAAGGTCTGATGCTGATG | 319 | [15] |
TCATCCCCTATGCTTACAG | ||||
Hyaluronic acid | hasB | TCTAGACGCCGATCAAGC | 532 | [15] |
TGAATTCCTATGCGTCGATC | ||||
Hyaluronic acid | hasC | TGCTTGGTGACGATTTGATG | 225 | [15] |
GTCCAATGATAGCAAGGTCAC | ||||
Epithelial cell invasion | sua | ACGCAAGGTGCTCAAGAGTT | 776 | [16] |
TGAACAAGCGATTCGTCAAG | ||||
Surface dehydrogenase protein | gapC | GCTCCTGGTGGAGATGATGT | 200 | [16] |
GTCACCAGTGTAAGCGTGGA | ||||
CAMP factor | cfu | TATCCCGATTTGCAGCCTAC | 205 | [16] |
CCTGGTCAACTTGTGCAACTG | ||||
Solvent active transfer | oppF | GGCCTAACCAAAACGAAACA | 419 | [17] |
GGCTCTGGAATTGCTGAAAG | ||||
Plasminogen activator | pauA/skc | TTCACTGCTGTTACATAACTTTGTG | 976 | [18] |
CCTTTGAAAGTGATGCTCGTG | ||||
S. uberis specific | 16S rRNA ub | CGCATGACAAT GGGTACA | 445 | [19] |
ST a | MLST Allelic Profile b | GCC c | No of Isolates | No of Farms | Virulence Profile d | Resistance Profiles e | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
1135 | 1 | 37 | 4 | 1 | 2 | 1 | 3 | 5 | 9 | 7 | common | S, B, C |
307 | 1 | 1 | 4 | 1 | 2 | 1 | 3 | 5 | 5 | 3 | common | S, A, D |
3 | 2 | cfu+ | A | |||||||||
1436 | 1 | 1 | 1 | 1 | 1 | 1 | 3 | 4 | 3 | common | A | |
316 | 2 | 1 | 4 | 1 | 2 | 1 | 3 | 5 | 3 | 3 | common | S, A, E |
855 | 9 | 1 | 27 | 2 | 39 | 1 | 3 | 3 | 3 | common | S, D, E | |
876 | 1 | 1 | 4 | 1 | 65 | 1 | 3 | 5 | 3 | 3 | common | S, A |
877 | 2 | 1 | 4 | 2 | 2 | 1 | 3 | 3 | 2 | common | S, B, F | |
1437 | 1 | 1 | 4 | 1 | 1 | 1 | 3 | 3 | 3 | common | S, A | |
1438 | 1 | 1 | 4 | 2 | 29 | 1 | 3 | 2 | 2 | common | S, H | |
1439 | 2 | 1 | 4 | 1 | 43 | 1 | 3 | 2 | 2 | common | S | |
1440 | 1 | 1 | 43 | 1 | 43 | 1 | 3 | 2 | 2 | common | S | |
1441 | 40 | 1 | 4 | 1 | 2 | 1 | 3 | 2 | 1 | common | A | |
1442 | 2 | 1 | 27 | 2 | 39 | 4 | 3 | 2 | 1 | common | S | |
22 | 2 | 1 | 2 | 1 | 2 | 1 | 2 | 5 | 1 | 1 | common | A |
63 | 1 | 1 | 5 | 1 | 2 | 1 | 3 | 5 | 1 | 1 | common | S |
308 | 40 | 1 | 4 | 2 | 49 | 1 | 3 | 1 | 1 | common | S | |
319 | 5 | 15 | 5 | 2 | 2 | 1 | 3 | 1 | 1 | cfu+ | S | |
332 | 1 | 1 | 1 | 1 | 2 | 1 | 3 | 1 | 1 | common | S | |
386 | 1 | 2 | 3 | 2 | 1 | 1 | 35 | 1 | 1 | common | L | |
451 | 9 | 1 | 2 | 2 | 7 | 1 | 3 | 143 | 1 | 1 | cfu+ | S |
501 | 1 | 1 | 4 | 2 | 49 | 1 | 3 | 1 | 1 | common | A | |
877 | 2 | 1 | 4 | 2 | 2 | 1 | 3 | 1 | 1 | common | H | |
878 | 2 | 1 | 4 | 1 | 76 | 1 | 3 | 1 | 1 | common | E | |
884 | 8 | 1 | 6 | 4 | 3 | 2 | 3 | 1 | 1 | common | S | |
895 | 5 | 42 | 5 | 2 | 2 | 3 | 3 | 1 | 1 | hasA−, hasB− | S | |
914 | 2 | 1 | 4 | 1 | 65 | 1 | 3 | 1 | 1 | common | G | |
1065 | 2 | 1 | 5 | 1 | 2 | 1 | 3 | 5 | 1 | 1 | common | B |
1127 | 2 | 1 | 5 | 1 | 65 | 1 | 3 | 1 | 1 | common | S | |
1204 | 3 | 6 | 5 | 2 | 10 | 4 | 10 | 1 | 1 | hasA−, hasB− | S | |
1443 | 1 | 4 | 4 | 1 | 5 | 2 | 3 | 1 | 1 | hasA−, hasB− | S | |
1444 | 2 | 2 | 5 | 2 | 3 | 4 | 3 | 1 | 1 | hasA−, hasB−, cfu+ | A | |
1445 | 3 | 1 | 41 | 4 | 5 | 2 | 10 | 1 | 1 | hasA−, hasB− | S | |
1446 | 3 | 25 | 29 | 2 | 5 | 2 | 3 | 1 | 1 | hasA−, hasB− | S | |
1447 | 9 | 1 | 5 | 2 | 29 | 2 | 3 | 1 | 1 | hasA−, hasB− | I | |
1448 | 21 | 2 | 5 | 2 | 3 | 4 | 9 | 1 | 1 | hasA−, hasB−, cfu+ | A | |
1449 | 42 | 30 | 4 | 1 | 70 | 4 | 3 | 1 | 1 | hasA−, hasB−, cfu+, pauA/skc− | L | |
1450 | 42 | 2 | 4 | 22 | 65 | 4 | 10 | 1 | 1 | cfu+ | A | |
1451 | 42 | 30 | 4 | 2 | 70 | 4 | 15 | 1 | 1 | hasA−, hasB−, cfu+, pauA/skc− | H | |
1452 | 42 | 64 | 4 | 2 | 70 | 4 | 15 | 1 | 1 | hasA−, hasB−, pauA/skc- | S | |
1453 | 55 | 30 | 4 | 1 | 88 | 4 | 3 | 1 | 1 | cfu+ | K | |
All other allelic profiles were detected only in one isolate and showed a common virulence profile. |
Sequence Type | No of Isolates | Source | ||||
---|---|---|---|---|---|---|
Acute Mastitis | Subclinical Mastitis | Chronic Mastitis | Healthy Udder | Udder Surface Swabs | ||
ST 1135 | 9 | 6 | 2 | 0 | 1 | 0 |
ST 307 | 9 | 4 | 0 | 3 | 0 | 2 |
ST 1436 | 4 | 1 | 0 | 1 | 1 | 1 |
ST 316 | 3 | 1 | 1 | 0 | 0 | 1 |
ST 876 | 3 | 3 | 0 | 0 | 0 | 0 |
ST 877 | 3 | 3 | 0 | 0 | 0 | 0 |
ST 855 | 3 | 1 | 2 | 0 | 0 | 0 |
ST 1437 | 3 | 2 | 0 | 0 | 0 | 1 |
ST 1438 | 2 | 2 | 0 | 0 | 0 | 0 |
ST 1439 | 2 | 1 | 1 | 0 | 0 | 0 |
ST 1440 | 2 | 2 | 0 | 0 | 0 | 0 |
ST 1442 | 2 | 2 | 0 | 0 | 0 | 0 |
ST 1441 | 2 | 0 | 0 | 0 | 1 | 1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zouharova, M.; Nedbalcova, K.; Kralova, N.; Slama, P.; Matiaskova, K.; Matiasovic, J. Multilocus Sequence Genotype Heterogeneity in Streptococcus uberis Isolated from Bovine Mastitis in the Czech Republic. Animals 2022, 12, 2327. https://doi.org/10.3390/ani12182327
Zouharova M, Nedbalcova K, Kralova N, Slama P, Matiaskova K, Matiasovic J. Multilocus Sequence Genotype Heterogeneity in Streptococcus uberis Isolated from Bovine Mastitis in the Czech Republic. Animals. 2022; 12(18):2327. https://doi.org/10.3390/ani12182327
Chicago/Turabian StyleZouharova, Monika, Katerina Nedbalcova, Natalie Kralova, Petr Slama, Katarina Matiaskova, and Jan Matiasovic. 2022. "Multilocus Sequence Genotype Heterogeneity in Streptococcus uberis Isolated from Bovine Mastitis in the Czech Republic" Animals 12, no. 18: 2327. https://doi.org/10.3390/ani12182327
APA StyleZouharova, M., Nedbalcova, K., Kralova, N., Slama, P., Matiaskova, K., & Matiasovic, J. (2022). Multilocus Sequence Genotype Heterogeneity in Streptococcus uberis Isolated from Bovine Mastitis in the Czech Republic. Animals, 12(18), 2327. https://doi.org/10.3390/ani12182327