Wild Carnivore Survey of Echinococcus Species in Slovenia
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Methods
2.2.1. Age Determination
2.2.2. Molecular Methods
2.2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Beaver, P.C.; Jung, R.C.; Cupp, E.W. Clinical Parasitology, 9th ed.; Lea & Febiger: Philadelphia, PA, USA, 1984. [Google Scholar]
- Nakao, M.; Lavikainen, A.; Yanagida, T.; Ito, A. Phylogenetic systematics of the genus Echinococcus (Cestoda: Taeniidae). Int. J. Parasitol. 2013, 43, 1017–1029. [Google Scholar] [CrossRef] [PubMed]
- Thompson, R.C.A. Biology and systematics of Echinococcus. Adv. Parasitol. 2017, 95, 65–109. [Google Scholar] [CrossRef] [PubMed]
- Šoba, B.; Gašperšič, Š.; Keše, D.; Kotar, T. Molecular characterization of Echinococcus granulosus sensu lato from humans in Slovenia. Pathogens 2020, 9, 562. [Google Scholar] [CrossRef] [PubMed]
- Vuitton, D.A.; McManus, D.P.; Rogan, M.T.; Romig, T.; Gottstein, B.; Naidich, A.; Tuxun, T.; Hao, W.; Menezes da Silva, A.; World Association of Echinococcosis. International consensus on terminology to be used in the field of echinococcoses. Parasite 2020, 27, 41. [Google Scholar] [CrossRef]
- Alvares Rojas, C.A.; Romig, T.; Lightowlers, M.W. Echinococcus granulosus sensu lato genotypes infecting humans—Review of current knowledge. Int. J. Parasitol. 2014, 44, 9–18. [Google Scholar] [CrossRef]
- Bouwknegt, M.; Devleesschauwer, B.; Graham, H.; Robertson, L.J.; van der Giessen, J.W. The Euro-Fbp Workshop Participants. Prioritisation of food-borne parasites in Europe, 2016. Eurosurveillance 2018, 23, 17-00161. [Google Scholar] [CrossRef]
- Woolsey, I.D.; Miller, A.L. Echinococcus granulosus sensu lato and Echinococcus multilocularis: A review. Res. Vet. Sci. 2021, 135, 517–522. [Google Scholar] [CrossRef]
- Craig, P.; Mastin, A.; van Kesteren, F.; Boufana, B. Echinococcus granulosus: Epidemiology and state-of-the-art of diagnostics in animals. Vet. Parasitol. 2015, 213, 132–148. [Google Scholar] [CrossRef]
- Balog, T.; Nagy, G.; Halász, T.; Csányi, E.; Zomborsszky, Z.; Csivincsik, Á. The occurrence of Echinococcus spp. in golden jackal (Canis aureus) in southwestern Hungary: Should we need to rethink its expansion? Parasitol. Int. 2021, 80, 102214. [Google Scholar] [CrossRef]
- Vuitton, D.A.; Zhou, H.; Bresson-Hadni, S.; Wang, Q.; Piarroux, M.; Raoul, F.; Giraudoux, P. Epidemiology of alveolar echinococcosis with particular reference to China and Europe. Parasitology 2003, 127, S87–S107. [Google Scholar] [CrossRef]
- Kapel, C.M.; Torgerson, P.R.; Thompson, R.C.; Deplazes, P. Reproductive potential of Echinococcus multilocularis in experimentally infected foxes, dogs, raccoon dogs and cats. Int. J. Parasitol. 2006, 36, 79–86. [Google Scholar] [CrossRef] [PubMed]
- Otero-Abad, B.; Torgerson, P.R. A systematic review of the epidemiology of echinococcosis in domestic and wild animals. PLoS Negl. Trop. Dis. 2013, 7, e2249. [Google Scholar] [CrossRef]
- Sindičić, M.; Bujanić, M.; Štimac, I.; Martinković, F.; Tuškan, N.; Špehar, M.; Konjević, D. First identification of Echinococcus multilocularis in golden jackals in Croatia. Acta Parasitol. 2018, 63, 654–656. [Google Scholar] [CrossRef] [PubMed]
- Miljević, M.; Lalošević, D.; Simin, V.; Blagojević, J.; Čabrilo, B.; Bjelić Čabrilo, O. Intestinal helminth infections in the golden jackal (Canis aureus L.) from Vojvodina: Hotspot area of multilocular echinococcosis in Serbia. Acta Vet. Hung. 2021, 69, 274–281. [Google Scholar] [CrossRef]
- Oksanen, A.; Siles-Lucas, M.; Karamon, J.; Possenti, A.; Conraths, F.J.; Romig, T.; Wysocki, P.; Mannocci, A.; Mipatrini, D.; La Torre, G.; et al. The geographical distribution and prevalence of Echinococcus multilocularis in animals in the European Union and adjacent countries: A systematic review and meta-analysis. Parasites Vectors 2016, 9, 519. [Google Scholar] [CrossRef] [PubMed]
- European Food Safety Authority and European Centre for Disease Prevention and Control (EFSA and ECDC). The European Union One Health 2018 Zoonoses Report. EFSA J. 2019, 17, e05926. [Google Scholar] [CrossRef]
- Vergles Rataj, A.; Bidovec, A.; Zele, D.; Vengust, G. Echinococcus multilocularis in the red fox (Vulpes vulpes) in Slovenia. Eur. J. Wildl. Res. 2010, 56, 819–822. [Google Scholar] [CrossRef]
- Administration of the Republic of Slovenia for Food Safety, Veterinary and Plant Protection (UVHVVR). Letno Poročilo o Zoonozah in Povzročiteljih Zoonoz; Annual Report on Zoonoses in Slovenia, 2018; UVHVVR: Ljubljana, Slovenia, 2020. Available online: https://www.gov.si/assets/organi-v-sestavi/UVHVVR/Varna-hrana/Porocila-bioloska-varnost/Nacionalno-porocilo-monitoringa-zoonoz-2020.pdf (accessed on 7 July 2022).
- Roulichova, J.; Andera, M. Simple method of age determination in red foxes, Vulpes vulpes. Folia Zool. 2007, 56, 440–444. [Google Scholar]
- Bandelj, P.; Logar, K.; Usenik, A.M.; Vengust, M.; Ocepek, M. An improved qPCR protocol for rapid detection and quantification of Clostridium difficile in cattle feces. FEMS Microbiol. Lett. 2013, 341, 115–121. [Google Scholar] [CrossRef]
- Knapp, J.; Millon, L.; Mouzon, L.; Umhang, G.; Raoul, F.; Ali, Z.S.; Combes, B.; Comte, S.; Gbaguidi-Haore, H.; Grenouillet, F.; et al. Real time PCR to detect the environmental faecal contamination by Echinococcus multilocularis from red fox stools. Vet. Parasitol. 2014, 201, 40–47. [Google Scholar] [CrossRef]
- Maksimov, P.; Bergmann, H.; Wassermann, M.; Romig, T.; Gottstein, B.; Casulli, A.; Conraths, F.J. Species Detection within the Echinococcus granulosus sensu lato complex by novel probe-based real-time PCRs. Pathogens 2020, 9, 791. [Google Scholar] [CrossRef] [PubMed]
- Grech-Angelini, S.; Richomme, C.; Peytavin de Garam, C.; Boucher, J.M.; Maestrini, O.; Grenouillet, F.; Casabianca, F.; Boué, F.; Umhang, G. Identification and molecular characterization of Echinococcus canadensis G6/7 in dogs from Corsica, France. Parasitol. Res. 2019, 118, 1313–1319. [Google Scholar] [CrossRef]
- Wilson, I.G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 1997, 63, 3741–3751. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing: c2013; R Foundation for Statistical Computing: Vienna, Austria, 2013; Available online: http://www.R-project.org/ (accessed on 18 July 2022).
- Deplazes, P.; Rinaldi, L.; Alvarez Rojas, C.A.; Torgerson, P.R.; Harandi, M.F.; Romig, T.; Antolova, D.; Schurer, J.M.; Lahmar, S.; Cringoli, G.; et al. Global Distribution of Alveolar and Cystic Echinococcosis. Adv. Parasitol. 2017, 95, 315–493. [Google Scholar] [CrossRef] [PubMed]
- Romig, T.; Deplazes, P.; Jenkins, D.; Giraudoux, P.; Massolo, A.; Craig, P.S.; Wassermann, M.; Takahashi, K.; de la Rue, M. Ecology and life cycle patterns of Echinococcus species. In Echinococcus and Echinococcosis, Part A; Thompson, R.C.A., Deplazes, P., Lymbery, A.J., Eds.; Elsevier: Amsterdam, The Netherlands, 2017; Volume 95, pp. 213–314. [Google Scholar] [CrossRef]
- FAO—Food and Agriculture Organization of the UN; WHO. Multicriteria-Based Ranking for Risk Management of Food-borne Parasites; Microbiological Risk Assessment Series; WHO: Geneva, Switzerland, 2014; Volume 23, Available online: https://apps.who.int/iris/bitstream/handle/10665/112672/9789241564700_eng.pdf?sequence=1 (accessed on 19 February 2020).
- Casulli, A. Recognizing the substantial burden of neglected pandemics cystic and alveolar echinococcosis. Lancet Glob. Health 2020, 8, e470–e471. [Google Scholar] [CrossRef]
- Rojo-Vazquez, F.A.; Pardo-Lledias, J.; Francos-Von Hunefeld, M.; Cordero-Sanchez, M.; Alamo-Sanz, R.; Hernandez-Gonzalez, A.; Brunetti, E.; Siles-Lucas, M. Cystic echinococcosis in Spain: Current situation and relevance for other endemic areas in Europe. PLoS Negl. Trop. Dis. 2011, 5, e893. [Google Scholar] [CrossRef]
- Onac, D.; Gyorke, A.; Oltean, M.; Gavrea, R.; Cozma, V. First detection of Echinococcus granulosus G1 and G7 in wild boars (Sus scrofa) and red deer (Cervus elaphus) in Romania using PCR and PCR-RFLP techniques. Vet. Parasitol. 2013, 193, 289–291. [Google Scholar] [CrossRef]
- Breyer, I.; Georgieva, D.; Kurdova, R.; Gottstein, B. Echinococcus granulosus strain typing in Bulgaria: The G1 genotype is predominant in intermediate and definitive wild hosts. Parasitol. Res. 2004, 93, 127–130. [Google Scholar] [CrossRef]
- Guerra, D.; Armua-Fernandez, M.T.; Silva, M.; Bravo, I.; Santos, N.; Deplazes, P.; Carvalho, L.M. Taeniid species of the Iberian wolf (Canis lupus signatus) in Portugal with special focus on Echinococcus spp. Int. J. Parasitol. Parasites Wildl. 2012, 2, 50–53. [Google Scholar] [CrossRef]
- Guberti, V.; Bolognini, M.; Lanfranchi, P.; Battelli, G. Echinococcus granulosus in the wold in Italy. Parassitologia 2004, 46, 425–427. [Google Scholar]
- Gori, F.; Armua-Fernandez, M.T.; Milanesi, P.; Serafini, M.; Magi, M.; Deplazes, P.; Macchioni, F. The occurrence of taeniids of wolves in Liguria (northern Italy). Int. J. Parasitol. Parasites Wildl. 2015, 4, 252–255. [Google Scholar] [CrossRef]
- van Liere, D.; Dwyer, C.; Jordan, D.; Premik-Banič, A.; Valenčič, A.; Kompan, D.; Siard, N. Farm characteristics in Slovene wolf habitat related to attacks on sheep. Appl. Anim. Behav. Sci. 2013, 144, 46–56. [Google Scholar] [CrossRef]
- Krofel, M.; Kos, I. Analiza vsebine iztrebkov volka (Canis lupus) v Sloveniji (Scat analysis of grey wolves (Canis lupus) in Slovenia). Zb. Gozdarstva Lesar. 2010, 91, 3–12. [Google Scholar]
- Deplazes, P.; Hegglin, D.; Gloor, S.; Romig, T. Wilderness in the city: The urbanization of Echinococcus multilocularis. Trends Parasitol. 2004, 20, 77–84. [Google Scholar] [CrossRef] [PubMed]
- Krofel, M. Confirmed presence of territorial groups of golden jackals (Canis aureus) in Slovenia. Nat. Slov. 2009, 11, 65–68. [Google Scholar]
- Arnold, J.; Humer, A.; Heltai, M.; Murariu, D.; Spassov, N.; Hackländer, K. Current status and distribution of golden jackals Canis aureus in Europe. Mammal Rev. 2012, 42, 1–11. [Google Scholar] [CrossRef]
- Széll, Z.; Marucci, G.; Pozio, E.; Sréter, T. Echinococcus multilocularis and Trichinella spiralis in golden jackals (Canis aureus) of Hungary. Vet. Parasitol. 2013, 197, 393–396. [Google Scholar] [CrossRef]
- Frey, C.F.; Basso, W.U.; Zürcher-Giovannini, S.; Marti, I.; Borel, S.; Guthruf, S.; Gliga, D.; Lundström-Stadelmann, B.; Origgi, F.C.; Ryser-Degiorgis, M.P. The golden jackal (Canis aureus): A new host for Echinococcus multilocularis and Trichinella britovi in Switzerland. Schweiz. Arch. Tierheilkd 2022, 164, 71–78. [Google Scholar] [CrossRef]
- Lalošević, D.; Lalošević, V.; Simin, V.; Miljevic, M.; Cabrilo, B.; Bjelic Cabrilo, O. Spreading of multilocular echinococcosis in southern Europe: The first record in foxes and jackals in Serbia, Vojvodina Province. Eur. J. Wildl. Res. 2016, 62, 793–796. [Google Scholar]
- Lanszki, J.; Heltai, M.; Szabó, L. Feeding habits and trophic niche overlap between sympatric golden jackal (Canis aureus) and red fox (Vulpes vulpes) in the Pannonian ecoregion (Hungary). Can. J. Zool. 2006, 84, 1647–1656. [Google Scholar] [CrossRef]
- Avcioglu, H.; Guven, E.; Balkaya, I.; Kirman, R. Echinococcus multilocularis in a Eurasian lynx (Lynx lynx) in Turkey. Parasitology 2018, 145, 1147–1150. [Google Scholar] [CrossRef]
- Kritsky, D.C.; Leiby, P.D. Studies on sylvatic echinococcosis. V. Factors influencing prevalence of Echinococcus multilocularis Leuckart 1863, in red foxes from North Dakota, 1965–1972. J. Parasitol. 1978, 64, 625–634. [Google Scholar] [PubMed]
- Hofer, S.; Gloor, S.; Müller, U.; Mathis, A.; Hegglin, D.; Deplazes, P. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zürich, Switzerland. Parasitology 2000, 120, 135–142. [Google Scholar] [CrossRef] [PubMed]
- di Cerbo, A.R.; Manfredi, M.T.; Bregoli, M.; Ferro Milone, N.; Cova, M. Wild carnivores as source of zoonotic helminths in north-eastern Italy. Helminthologia 2008, 45, 13–19. [Google Scholar] [CrossRef] [Green Version]
- RS Statistical Office, 2022a. Available online: https://www.stat.si/obcine/en/Region/Index/5 (accessed on 18 July 2022).
- RS Statistical Office, 2022b. Available online: https://www.stat.si/obcine/en/Region/Index/8 (accessed on 18 July 2022).
- Avcioglu, H.; Guven, E.; Balkaya, I.; Kirman, R.; Akyuz, M.; Bia, M.M.; Gulbeyen, H.; Yaya, S. Echinococcus multilocularis in Red Foxes in Turkey: Increasing risk in urban. Acta Trop. 2021, 216, 105826. [Google Scholar] [CrossRef]
Assay Name (Gene Targeted) | Primer/ Probe | Oligonucleotide Sequences (5′-3′) | Product Size | Reference |
---|---|---|---|---|
EM (rrnL) | Forward | CTGTGATCTTGGTGTAGTAGTTGAGATTT | (bp) 84 | [22] |
Reverse | GGCTTACGCCGGTCTTAACTC | |||
Probe | FAM -TGGTCTGTTCGACCTTTTTAGCCTCCAT – TAMRA | |||
Egss (cox1) | Forward | AGGGGCTGGTGTTGGTTGGA | 80 | [23] |
Reverse | TGAAACACCAGCCAAATGCAGAGA | |||
Probe | FAM – TCCGCCGTTGTCCTCGTCGT – BHQ1 | |||
EC (nad5) | Forward | TCTTTCTGATAGACGAGGTTAGG | 109 | [24] |
Reverse | TCCATAAAGCCAAAAATTGTAC | |||
Probe | Cy5 – CGGTGGTTTGTAGTGTGAGTTTGGTG – BHQ2 |
. | Tested Animals | EM Positive (%) | p * | |||
---|---|---|---|---|---|---|
Species | 0.22 | |||||
Red fox | 210 | 61 (29.1) | ||||
Golden jackal | 39 | 7 (18) | ||||
Red fox | Golden jackal | Red fox | Golden jackal | Red fox + Golden jackal | ||
Sex | 0.18 | |||||
male | 133 | 28 | 43 (32.3) | 6 (21.4) | 49/161 (30.4) | |
female | 77 | 11 | 18 (23.4) | 1 (9.1) | 19/88 (21.6) | |
Age (years) | 0.12 | |||||
juvenile (0) | 57 | 6 | 19 (33.3) | 0 | 19/63 (30.2) | |
young adult (1) | 108 | 30 | 24 (22.2) | 7 (23.3) | 31/138 (22.5) | |
adult (≥2) | 45 | 3 | 18 (40) | 0 | 18/48 (37.5) | |
Region | <0.001 | |||||
R1 obalno kraska | 2 | 8 | 0 | 1 (12.5) | 1/10 (10) | |
R2 goriska | 8 | 2 | 0 | 0 | 0/10 (0) | |
R3 primorsko notranjska | 12 | 3 | 6 (50) | 0 | 6/15 (40) | |
R4 osrednjeslovenska | 51 | 13 | 24 (47.1) | 3 (23.1) | 27/64 (42.2) | |
R5 gorenjska | 9 | 2 | 1 (11.1) | 1 (50) | 2/11 (18.2) | |
R6 jugovzhodna slovenija | 66 | / | 25 (37.9) | / | 25/66 (37.9) | |
R7 posavska | 11 | 9 | 1 (9.1) | 2 (22.2) | 3/20 (15) | |
R8 zasavska | / | / | / | / | / | |
R9 savinjska | 30 | 2 | 1 (3.3) | / | 1/32 (3.1) | |
R10 podravska | 9 | / | 1 (11.1) | / | 1/9 (11.1) | |
R11 pomurska | 10 | / | 0 | / | 0/10 (0) | |
R12 koroska | 2 | / | 2 (100) | / | 2/2 (100) |
Red Fox/ Golden Jackal. | OR | 95% CI | p-Values |
---|---|---|---|
Species (red fox vs. golden jackal) | 0.57 | 0.2–1.57 | 0.28 |
Sex (male vs. female) | 1.77 | 0.91–3.44 | 0.1 |
Age (y) | 0.37 | ||
1 vs. 0 | 0.91 | 0.42–1.92 | 0.8 |
≥2 vs. 1 | 1.75 | 0.79–3.87 | 0.17 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bandelj, P.; Blagus, R.; Vengušt, G.; Žele Vengušt, D. Wild Carnivore Survey of Echinococcus Species in Slovenia. Animals 2022, 12, 2223. https://doi.org/10.3390/ani12172223
Bandelj P, Blagus R, Vengušt G, Žele Vengušt D. Wild Carnivore Survey of Echinococcus Species in Slovenia. Animals. 2022; 12(17):2223. https://doi.org/10.3390/ani12172223
Chicago/Turabian StyleBandelj, Petra, Rok Blagus, Gorazd Vengušt, and Diana Žele Vengušt. 2022. "Wild Carnivore Survey of Echinococcus Species in Slovenia" Animals 12, no. 17: 2223. https://doi.org/10.3390/ani12172223
APA StyleBandelj, P., Blagus, R., Vengušt, G., & Žele Vengušt, D. (2022). Wild Carnivore Survey of Echinococcus Species in Slovenia. Animals, 12(17), 2223. https://doi.org/10.3390/ani12172223