Heat Stress Alters the Effect of Eimeria maxima Infection on Ileal Amino Acids Digestibility and Transporters Expression in Meat-Type Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Sampling
2.2. Apparent Digestibility
2.3. Nucleic Acid Extraction
2.4. Gene Expression
2.5. Statistical Analysis
3. Results
4. Discussion
4.1. The Effect of HS and E. maxima Infection on the Amino Acid AID
4.2. The Effect of HS and E. maxima Infection on the Apical Amino Acid Transporters
4.3. The Effect of HS and E. maxima Infection on the Basolateral Amino Acid Transporters
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Allen, P.C.; Fetterer, R. Recent advances in biology and immunobiology of Eimeria species and in diagnosis and control of infection with these coccidian parasites of poultry. Clin. Microbiol. Rev. 2002, 15, 58–65. [Google Scholar] [CrossRef] [Green Version]
- McDougald, L.R. Intestinal protozoa important to poultry. Poult. Sci. 1998, 77, 1156–1158. [Google Scholar] [CrossRef]
- Levine, N.D. Protozoan Parasites of Domestic Animals and of Man; Burgess Publishing Company: Minneapolis, MN, USA, 1961. [Google Scholar]
- Dubey, J.; Jenkins, M. Re-evaluation of the life cycle of Eimeria maxima Tyzzer, 1929 in chickens (Gallus domesticus). Parasitology 2018, 145, 1051–1058. [Google Scholar] [CrossRef]
- Zulpo, D.L.; Peretti, J.; Ono, L.M.; Longhi, E.; Oliveira, M.R.; Guimarães, I.G.; Headley, S.A.; Junior, J.d.S.G.; Garcia, J.L. Pathogenicity and histopathological observations of commercial broiler chicks experimentally infected with isolates of Eimeria tenella, E. acervulina and E. maxima. Semin. Cienc. Agrar. 2007, 28, 97–104. [Google Scholar] [CrossRef] [Green Version]
- Allen, P.C.; Jenkins, M.C.; Miska, K.B. Cross protection studies with Eimeria maxima strains. Parasitol. Res. 2005, 97, 179–185. [Google Scholar] [CrossRef]
- Sharman, P.A.; Smith, N.C.; Wallach, M.G.; Katrib, M. Chasing the golden egg: Vaccination against poultry coccidiosis. Parasite Immunol. 2010, 32, 590–598. [Google Scholar] [CrossRef]
- Ghazi, S.; Habibian, M.; Moeini, M.M.; Abdolmohammadi, A.R. Effects of different levels of organic and inorganic chromium on growth performance and immunocompetence of broilers under heat stress. Biol. Trace. Elem. Res. 2012, 146, 309–317. [Google Scholar] [CrossRef]
- Attia, Y.; Hassan, R.; Tag El-Din, A.; Abou-Shehema, B. Effect of ascorbic acid or increasing metabolizable energy level with or without supplementation of some essential amino acids on productive and physiological traits of slow-growing chicks exposed to chronic heat stress. J. Anim Physiol. Anim. Nutr. (Berl.) 2011, 95, 744–755. [Google Scholar] [CrossRef]
- Quinteiro-Filho, W.M.; Ribeiro, A.; Ferraz-de-Paula, V.; Pinheiro, M.L.; Sakai, M.; Sa, L.R.; Ferreira, A.J.; Palermo-Neto, J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult. Sci. 2010, 89, 1905–1914. [Google Scholar] [CrossRef]
- Habashy, W.S.; Milfort, M.C.; Fuller, A.L.; Attia, Y.A.; Rekaya, R.; Aggrey, S.E. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int. J. Biometeorol. 2017, 61, 2111–2118. [Google Scholar] [CrossRef]
- Habashy, W.S.; Milfort, M.C.; Adomako, K.; Attia, Y.A.; Rekaya, R.; Aggrey, S.E. Effect of heat stress on amino acid digestibility and transporters in meat-type chickens. Poult. Sci. 2017, 96, 2312–2319. [Google Scholar] [CrossRef]
- Kiela, P.R.; Ghishan, F.K. Physiology of Intestinal Absorption and Secretion. Best. Pract. Res. Clin. Gastroenterol. 2016, 30, 145–159. [Google Scholar] [CrossRef] [Green Version]
- Stevens, B.R. Amino acid transport by epithelial membranes. In Epithelial Transport Physiology; Springer: Berlin/Heidelberg, Germany, 2010; pp. 353–378. [Google Scholar]
- Kong, S.; Zhang, Y.H.; Zhang, W. Regulation of Intestinal Epithelial Cells Properties and Functions by Amino Acids. Biomed. Res. Int. 2018, 2018, 2819154. [Google Scholar] [CrossRef]
- Sohail, M.; Hume, M.; Byrd, J.; Nisbet, D.; Ijaz, A.; Sohail, A.; Shabbir, M.; Rehman, H. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress. Poult. Sci. 2012, 91, 2235–2240. [Google Scholar] [CrossRef]
- Adedokun, S.A.; Helmbrecht, A.; Applegate, T.J. Investigation of the effect of coccidial vaccine challenge on apparent and standardized ileal amino acid digestibility in grower and finisher broilers and its evaluation in 21-day-old broilers. Poult. Sci. 2016, 95, 1825–1835. [Google Scholar] [CrossRef]
- Guo, S.; Liu, D.; Zhao, X.; Li, C.; Guo, Y. Xylanase supplementation of a wheat-based diet improved nutrient digestion and mRNA expression of intestinal nutrient transporters in broiler chickens infected with Clostridium perfringens. Poult. Sci. 2014, 93, 94–103. [Google Scholar] [CrossRef]
- Zanu, H.K.; Keerqin, C.; Kheravii, S.K.; Morgan, N.K.; Wu, S.B.; Bedford, M.R.; Swick, R.A. Influence of meat and bone meal, phytase, and antibiotics on broiler chickens challenged with subclinical necrotic enteritis: 1. growth performance, intestinal pH, apparent ileal digestibility, cecal microbiota, and tibial mineralization. Poult. Sci. 2020, 99, 1540–1550. [Google Scholar] [CrossRef]
- Schneiders, G.; Foutz, J.; Milfort, M.; Ghareeb, A.; Sorhue, U.; Richter, J.; Fuller, A.; Williams, S.; Rekaya, R.; Aggrey, S.J.J.A.P. Ontogeny of intestinal permeability in chickens infected with Eimeria maxima: Implications for intestinal health. J. Adv. Parasitol 2019, 6, 41–50. [Google Scholar]
- Available online: https://en.aviagen.com/assets/Tech_Center/Ross_Broiler/Ross-BroilerHandbook2018-EN.pdf (accessed on 15 March 2021).
- Horwitz, W. Official Methods of Analysis of the Association of Official Analytical Chemists (AOAC); AOAC: Gaithersburg, MD, USA, 2000; Volumes 1–2. [Google Scholar]
- Edwards Jr, H.; Gillis, M. A chromic oxide balance method for determining phosphate availability. Poult. Sci. 1959, 38, 569–574. [Google Scholar] [CrossRef]
- Schneiders, G.H.; Foutz, J.C.; Milfort, M.C.; Ghareeb, A.F.A.; Fuller, A.L.; Rekaya, R.; Williams, S.M.; Aggrey, S.E. Heat stress reduces sexual development and affects pathogenesis of Eimeria maxima in meat-type chickens. Sci. Rep. 2020, 10, 10736. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- SAS Institute Inc. SAS/IML® Studio 15.1 for SAS/STAT® Users; SAS Institute Inc.: Cary, NC, USA, 2018. [Google Scholar]
- Ruff, J.; Barros, T.L.; Tellez, G., Jr.; Blankenship, J.; Lester, H.; Graham, B.D.; Selby, C.A.M.; Vuong, C.N.; Dridi, S.; Greene, E.S.; et al. Research Note: Evaluation of a heat stress model to induce gastrointestinal leakage in broiler chickens. Poult. Sci. 2020, 99, 1687–1692. [Google Scholar] [CrossRef]
- Al-Zghoul, M.B.; Alliftawi, A.R.S.; Saleh, K.M.M.; Jaradat, Z.W. Expression of digestive enzyme and intestinal transporter genes during chronic heat stress in the thermally manipulated broiler chicken. Poult. Sci. 2019, 98, 4113–4122. [Google Scholar] [CrossRef]
- Su, S.; Miska, K.B.; Fetterer, R.H.; Jenkins, M.C.; Lamont, S.J.; Wong, E.A. Differential expression of intestinal nutrient transporters and host defense peptides in Eimeria maxima-infected Fayoumi and Ross chickens. Poult. Sci. 2018, 97, 4392–4400. [Google Scholar] [CrossRef]
- Miska, K.B.; Fetterer, R.H. The mRNA expression of amino acid and sugar transporters, aminopeptidase, as well as the di- and tri-peptide transporter PepT1 in the intestines of Eimeria infected broiler chickens. Poult. Sci. 2017, 96, 465–473. [Google Scholar] [CrossRef]
- Dalloul, R.A.; Lillehoj, H.S. Poultry coccidiosis: Recent advancements in control measures and vaccine development. Expert Rev. Vaccines 2006, 5, 143–163. [Google Scholar] [CrossRef]
- Bell, E.A.; Watson, A.A.; Nash, R.J. Non-protein amino acids: A review of the biosynthesis and taxonomic significance. Nat. Prod. Commun. 2008, 3, 93–110. [Google Scholar] [CrossRef] [Green Version]
- Pizzarello, S. Nonprotein Amino Acids. In Encyclopedia of Astrobiology; Gargaud, M., Irvine, W.M., Amils, R., Cleaves, H.J., Pinti, D.L., Quintanilla, J.C., Rouan, D., Spohn, T., Tirard, S., Viso, M., Eds.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 1697–1702. [Google Scholar]
- Wu, G.; Flynn, N.E.; Yan, W.; Barstow, D.G., Jr. Glutamine metabolism in chick enterocytes: Absence of pyrroline-5-carboxylase synthase and citrulline synthesis. Biochem. J. 1995, 306, 717–721. [Google Scholar] [CrossRef] [Green Version]
- Li, P.; Wu, G. Roles of dietary glycine, proline, and hydroxyproline in collagen synthesis and animal growth. Amino Acids 2018, 50, 29–38. [Google Scholar] [CrossRef]
- Hauer Jensen, M.; Sauer, T.; Sletten, K.; Reitan, J.B.; Nygaard, K. Value of hydroxyproline measurements in the assessment of late radiation enteropathy. Acta Radiol. Oncol. 1986, 25, 137–142. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.P.; Fishel, R.S.; Efron, D.T.; Williams, J.Z.; Fishel, M.H.; Barbul, A. Effect of supplemental ornithine on wound healing. J. Surg. Res. 2002, 106, 299–302. [Google Scholar] [CrossRef] [PubMed]
- Meesters, D.M.; Wijnands, K.A.P.; Brink, P.R.G.; Poeze, M. Malnutrition and Fracture Healing: Are Specific Deficiencies in Amino Acids Important in Nonunion Development? Nutrients 2018, 10, 1597. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Albaugh, V.L.; Mukherjee, K.; Barbul, A. Proline Precursors and Collagen Synthesis: Biochemical Challenges of Nutrient Supplementation and Wound Healing. J. Nutr. 2017, 147, 2011–2017. [Google Scholar] [CrossRef] [PubMed]
- Bröer, S.; Bröer, A. Amino acid homeostasis and signalling in mammalian cells and organisms. Biochem. J. 2017, 474, 1935–1963. [Google Scholar] [CrossRef] [Green Version]
- Böhmer, C.; Bröer, A.; Munzinger, M.; Kowalczuk, S.; Rasko, J.E.; Lang, F.; Bröer, S. Characterization of mouse amino acid transporter B0AT1 (slc6a19). Biochem. J. 2005, 389, 745–751. [Google Scholar] [CrossRef] [Green Version]
- Konashi, S.; Takahashi, K.; Akiba, Y. Effects of dietary essential amino acid deficiencies on immunological variables in broiler chickens. Br. J. Nutr. 2000, 83, 449–456. [Google Scholar]
- Baker, D.H. Advances in protein-amino acid nutrition of poultry. Amino Acids 2009, 37, 29–41. [Google Scholar] [CrossRef]
- Schmidt, M.M.; Dringen, R. Glutathione (GSH) synthesis and metabolism. In Neural Metabolism In Vivo; Springer: Boston, MA, USA, 2012; pp. 1029–1050. [Google Scholar]
- Habashy, W.S.; Milfort, M.C.; Rekaya, R.; Aggrey, S.E. Cellular antioxidant enzyme activity and biomarkers for oxidative stress are affected by heat stress. Int. J. Biometeorol. 2019, 63, 1569–1584. [Google Scholar] [CrossRef]
- Palacin, M.; Fernandez, E.; Chillaron, J.; Zorzano, A. The amino acid transport system b(o,+) and cystinuria. Mol. Membr. Biol. 2001, 18, 21–26. [Google Scholar] [CrossRef] [Green Version]
- Yan, R.; Li, Y.; Shi, Y.; Zhou, J.; Lei, J.; Huang, J.; Zhou, Q. Cryo-EM structure of the human heteromeric amino acid transporter b(0,+)AT-rBAT. Sci. Adv. 2020, 6, eaay6379. [Google Scholar] [CrossRef] [Green Version]
- Fetterer, R.H.; Miska, K.B.; Jenkins, M.C.; Wong, E.A. Expression of nutrient transporters in duodenum, jejunum, and ileum of Eimeria maxima-infected broiler chickens. Parasitol. Res. 2014, 113, 3891–3894. [Google Scholar] [CrossRef] [PubMed]
- White, M.F.; Christensen, H.N. Cationic amino acid transport into cultured animal cells. II. Transport system barely perceptible in ordinary hepatocytes, but active in hepatoma cell lines. J. Biol. Chem. 1982, 257, 4450–4457. [Google Scholar] [CrossRef]
- Meier, C.; Ristic, Z.; Klauser, S.; Verrey, F. Activation of system L heterodimeric amino acid exchangers by intracellular substrates. EMBO J. 2002, 21, 580–589. [Google Scholar] [CrossRef] [PubMed]
- Fotiadis, D.; Kanai, Y.; Palacin, M. The SLC3 and SLC7 families of amino acid transporters. Mol. Aspects Med. 2013, 34, 139–158. [Google Scholar] [CrossRef] [PubMed]
- Sinclair, L.V.; Rolf, J.; Emslie, E.; Shi, Y.B.; Taylor, P.M.; Cantrell, D.A. Control of amino-acid transport by antigen receptors coordinates the metabolic reprogramming essential for T cell differentiation. Nat. Immunol. 2013, 14, 500–508. [Google Scholar] [CrossRef] [Green Version]
- Bodoy, S.; Martin, L.; Zorzano, A.; Palacin, M.; Estevez, R.; Bertran, J. Identification of LAT4, a novel amino acid transporter with system L activity. J. Biol. Chem. 2005, 280, 12002–12011. [Google Scholar] [CrossRef] [Green Version]
- Babu, E.; Kanai, Y.; Chairoungdua, A.; Kim, D.K.; Iribe, Y.; Tangtrongsup, S.; Jutabha, P.; Li, Y.; Ahmed, N.; Sakamoto, S.; et al. Identification of a novel system L amino acid transporter structurally distinct from heterodimeric amino acid transporters. J. Biol. Chem. 2003, 278, 43838–43845. [Google Scholar] [CrossRef] [Green Version]
- Hellsten, S.V.; Lekholm, E.; Ahmad, T.; Fredriksson, R. The gene expression of numerous SLC transporters is altered in the immortalized hypothalamic cell line N25/2 following amino acid starvation. FEBS Open Bio. 2017, 7, 249–264. [Google Scholar] [CrossRef]
- Kim, D.K.; Kanai, Y.; Chairoungdua, A.; Matsuo, H.; Cha, S.H.; Endou, H. Expression cloning of a Na+-independent aromatic amino acid transporter with structural similarity to H+/monocarboxylate transporters. J. Biol. Chem. 2001, 276, 17221–17228. [Google Scholar] [CrossRef] [Green Version]
- Palacin, M.; Nunes, V.; Font-Llitjos, M.; Jimenez-Vidal, M.; Fort, J.; Gasol, E.; Pineda, M.; Feliubadalo, L.; Chillaron, J.; Zorzano, A. The genetics of heteromeric amino acid transporters. Physiology 2005, 20, 112–124. [Google Scholar] [CrossRef]
- Ramadan, T.; Camargo, S.M.; Herzog, B.; Bordin, M.; Pos, K.M.; Verrey, F. Recycling of aromatic amino acids via TAT1 allows efflux of neutral amino acids via LAT2-4F2hc exchanger. Pflugers Arch. 2007, 454, 507–516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halestrap, A.P. The SLC16 gene family—Structure, role and regulation in health and disease. Mol. Aspects Med. 2013, 34, 337–349. [Google Scholar] [CrossRef] [PubMed]
- Juel, C.; Halestrap, A.P. Lactate transport in skeletal muscle—Role and regulation of the monocarboxylate transporter. J. Physiol. 1999, 517, 633–642. [Google Scholar] [CrossRef] [PubMed]
- Halestrap, A.P.; Wilson, M.C. The monocarboxylate transporter family--role and regulation. IUBMB Life 2012, 64, 109–119. [Google Scholar] [CrossRef]
- Wang, S.; Song, P.; Zou, M.H. AMP-activated protein kinase, stress responses and cardiovascular diseases. Clin. Sci. 2012, 122, 555–573. [Google Scholar] [CrossRef] [Green Version]
- Pochini, L.; Scalise, M.; Galluccio, M.; Indiveri, C. Membrane transporters for the special amino acid glutamine: Structure/function relationships and relevance to human health. Front. Chem. 2014, 2, 61. [Google Scholar] [CrossRef] [Green Version]
- Pallett, L.J.; Schmidt, N.; Schurich, A. T cell metabolism in chronic viral infection. Clin. Exp. Immunol. 2019, 197, 143–152. [Google Scholar] [CrossRef] [Green Version]
- Song, W.; Li, D.; Tao, L.; Luo, Q.; Chen, L. Solute carrier transporters: The metabolic gatekeepers of immune cells. Acta Pharm. Sin. B 2020, 10, 61–78. [Google Scholar] [CrossRef]
- Broer, S. The SLC38 family of sodium-amino acid co-transporters. Pflugers Arch. 2014, 466, 155–172. [Google Scholar] [CrossRef]
- Hagglund, M.G.; Sreedharan, S.; Nilsson, V.C.; Shaik, J.H.; Almkvist, I.M.; Backlin, S.; Wrange, O.; Fredriksson, R. Identification of SLC38A7 (SNAT7) protein as a glutamine transporter expressed in neurons. J. Biol. Chem. 2011, 286, 20500–20511. [Google Scholar] [CrossRef] [Green Version]
- Chapel, A.; Kieffer-Jaquinod, S.; Sagne, C.; Verdon, Q.; Ivaldi, C.; Mellal, M.; Thirion, J.; Jadot, M.; Bruley, C.; Garin, J.; et al. An extended proteome map of the lysosomal membrane reveals novel potential transporters. Mol. Cell Proteomics 2013, 12, 1572–1588. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kara, A.; Gedikli, S.; Sengul, E.; Gelen, V.; Ozkanlar, S. Oxidative stress and autophagy. In Free Radicals and Diseases; Intechopen: London, UK, 2016. [Google Scholar]
Nutrient Transporter | Transporter Gene | Gene Bank Accession Number | Size | Align. | Primers Sequences |
---|---|---|---|---|---|
Apical amino acids | B0AT1 (SLC6A19) | XM_419056.8 | 117 | Forward | 5′CTGCCTGGGTTTGTCATCTAT3′ |
Reverse | 5′GCGCAGACGATACCTGTAAT3′ | ||||
b0,+AT (SLC7A9) | NM_001199133.1 | 113 | Forward | 5′GATCCCTGGAGCCTGAATTAC3′ | |
Reverse | 5′CTCCTTTCTGTTGTCCTGTTCT3′ | ||||
rBAT (SLC3A1) | XM_004935370.3 | 119 | Forward | 5′CTGAGAGCATCACAGCCTATTC3′ | |
Reverse | 5′GCCAGGTTCACTGCTGTATT3′ | ||||
Basolateral amino acids | TAT1 (SLC16A10) | NM_001321736.1 | 119 | Forward | 5′GCACCATCGAACCTCTGTATT3′ |
Reverse | 5′CACTAGACCAAGGCGTTTCTT3′ | ||||
LAT4 (SLC43A2) | XM_415803.6 | 113 | Forward | 5′GACTCGCAGCATCCCTAAAT3′ | |
Reverse | 5′GTGTCAGAGAAGTGGACGATATG3′ | ||||
CAT1 (SLC7A1) | NM_001145490.1 | 111 | Forward | 5′CGAACAACAGAGGAGACAGATAA3′ | |
Reverse | 5′GGGACACAGTATGGCTTTGA3′ | ||||
LAT1 (SLC7A5) | NM_001030579.2 | 98 | Forward | 5′GCCTTCTCCAATGACATCTTCT3′ | |
Reverse | 5′TAACGCAGCCACATCATACC3′ | ||||
SNAT1 (SLC38A1) | NM_001199603.1 | 108 | Forward | 5′CGCTAAATGCAACATCACCTATC3′ | |
Reverse | 5′TGGTGGGCAAAGCATACA3′ | ||||
SNAT2 (SLC38A2) | NM_001305439.1 | 127 | Forward | 5′GAACAAGTAGGGCCCTGTAATC3′ | |
Reverse | 5′GGGCAGAGCTTGATGTTATCT3′ | ||||
SNAT7 (SLC38A7) | XM_025154307.1 | 93 | Forward | 5′CAAGTTCACCATCAGCATCAC3′ | |
Reverse | 5′CTCAGAGAGCTGGCGTATTT3′ | ||||
B-actin | NM_205518.2 | 125 | Forward | 5′AGACATCAGGGTGTGATGGTTGGT3′ | |
Reverse | 5′TCCCAGTTGGTGACAATACCGTGT3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghareeb, A.F.A.; Schneiders, G.H.; Foutz, J.C.; Milfort, M.C.; Fuller, A.L.; Yuan, J.; Rekaya, R.; Aggrey, S.E. Heat Stress Alters the Effect of Eimeria maxima Infection on Ileal Amino Acids Digestibility and Transporters Expression in Meat-Type Chickens. Animals 2022, 12, 1554. https://doi.org/10.3390/ani12121554
Ghareeb AFA, Schneiders GH, Foutz JC, Milfort MC, Fuller AL, Yuan J, Rekaya R, Aggrey SE. Heat Stress Alters the Effect of Eimeria maxima Infection on Ileal Amino Acids Digestibility and Transporters Expression in Meat-Type Chickens. Animals. 2022; 12(12):1554. https://doi.org/10.3390/ani12121554
Chicago/Turabian StyleGhareeb, Ahmed F. A., Gustavo H. Schneiders, James C. Foutz, Marie C. Milfort, Alberta L. Fuller, Jianmin Yuan, Romdhane Rekaya, and Samuel E. Aggrey. 2022. "Heat Stress Alters the Effect of Eimeria maxima Infection on Ileal Amino Acids Digestibility and Transporters Expression in Meat-Type Chickens" Animals 12, no. 12: 1554. https://doi.org/10.3390/ani12121554
APA StyleGhareeb, A. F. A., Schneiders, G. H., Foutz, J. C., Milfort, M. C., Fuller, A. L., Yuan, J., Rekaya, R., & Aggrey, S. E. (2022). Heat Stress Alters the Effect of Eimeria maxima Infection on Ileal Amino Acids Digestibility and Transporters Expression in Meat-Type Chickens. Animals, 12(12), 1554. https://doi.org/10.3390/ani12121554