Determination of the Optimal Level of Dietary Zinc for Newly Weaned Pigs: A Dose-Response Study
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Housing, and Experimental Diet
2.2. Registrations
2.3. Feed and Blood Sample Collection
2.4. Feed and Blood Mineral Analyses
2.5. Analysis of DAO and D-Lactate in Plasma
2.6. Faecal Microbial Analysis
2.7. Statistical Analyses
3. Results
3.1. Feed, Feed Intake and Weight Gain
3.2. Diarrhoea Probability
3.3. Serum Zn Status
3.4. Serum Zn Status and Weight Gain
3.5. Intestinal Integrity and Faecal Bacteria
4. Discussion
4.1. Serum Zn Status
4.2. Feed Intake and Weight Gain
4.3. Intestinal Integrity
4.4. Diarrhoea Probability and Faecal Microbial Composition
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Salgueiro, M.J.; Zubillaga, M.; Lysionek, A.; Sarabia, M.I.; Caro, R.; De Paoli, T.; Hager, A.; Weill, R.; Boccio, J. Zinc as an essential micronutrient: A review. Nutr. Res. 2000, 20, 737–755. [Google Scholar] [CrossRef]
- Kambe, T.; Weaver, B.P.; Andrews, G.K. The genetics of essential metal homeostasis during development. Genesis 2008, 46, 214–228. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Windisch, W. Development of zinc deficiency in 65Zn labeled, fully grown rats as a model for adult individuals. J. Trace Elem. Med. Biol. 2003, 17, 91–96. [Google Scholar] [CrossRef]
- Windisch, W.; Kirchgessner, M. Tissue zinc distribution and exchange in adult rats at zinc deficiency induced by dietary phytate additions: II. Quantitative zinc metabolism of65Zn-labelled adult rats at zinc deficiency. J. Anim. Physiol. Anim. Nutr. 1999, 82, 116–124. [Google Scholar] [CrossRef]
- Rincker, M.J.; Hill, G.M.; Link, J.E.; Meyer, A.M.; Rowntree, J.E. Effects of dietary zinc and iron supplementation on mineral excretion, body composition, and mineral status of nursery pigs. J. Anim. Sci. 2005, 83, 2762–2774. [Google Scholar] [CrossRef] [Green Version]
- Dahmer, E.J.; Coleman, B.W.; Grummer, R.H.; Hoekstra, W.G. Alleviation of Parakeratosis in Zinc Deficient Swine by High Levels of Dietary Histidine. J. Anim. Sci. 1972, 35, 1181–1189. [Google Scholar] [CrossRef] [PubMed]
- Tucker, H.F.; Salmon, W.D. Parakeratosis or Zinc Deficiency Disease in the Pig. Exp. Biol. Med. 1955, 88, 613–616. [Google Scholar] [CrossRef]
- King, J.C. Assessment of Zinc Status. J. Nutr. 1990, 120, 1474–1479. [Google Scholar] [CrossRef]
- King, J.C. Zinc: An essential but elusive nutrient. Am. J. Clin. Nutr. 2011, 94, 679S–684S. [Google Scholar] [CrossRef] [Green Version]
- Yu, Q.; Sun, X.; Zhao, J.; Zhao, L.; Chen, Y.; Fan, L.; Li, Z.; Sun, Y.; Wang, M.; Wang, F. The effects of zinc deficiency on homeostasis of twelve minerals and trace elements in the serum, feces, urine and liver of rats. Nutr. Metab. 2019, 16, 73. [Google Scholar] [CrossRef]
- Browning, J.D.; Macdonald, R.S.; Thornton, W.H.; O’Dell, B.L. Reduced Food Intake in Zinc Deficient Rats Is Normalized by Megestrol Acetate but not by Insulin-Like Growth Factor-I. J. Nutr. 1998, 128, 136–142. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giugliano, R.; Millward, D.J. Growth and zinc homeostasis in the severely Zn-deficient rat. Br. J. Nutr. 1984, 52, 545–560. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bahl, R.; Bhandari, N.; Hambidge, K.M.; Bhan, M.K. Plasma zinc as a predictor of diarrheal and respiratory morbidity in children in an urban slum setting. Am. J. Clin. Nutr. 1998, 68, 414S–417S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abolurin, O.O.; Oyelami, O.A.; Oseni, S.B. A comparative study of the prevalence of zinc deficiency among children with acute diarrhoea in SouthWestern Nigeria. Afr. Health Sci. 2020, 20, 406–412. [Google Scholar] [CrossRef] [PubMed]
- Tuerk, M.J.; Fazel, N. Zinc deficiency. Curr. Opin. Gastroenterol. 2009, 25, 136–143. [Google Scholar] [CrossRef] [PubMed]
- Brugger, D.; Windisch, W.M. Subclinical zinc deficiency impairs pancreatic digestive enzyme activity and digestive capacity of weaned piglets. Br. J. Nutr. 2016, 116, 425–433. [Google Scholar] [CrossRef] [Green Version]
- Wapnir, R.A. Zinc Deficiency, Malnutrition and the Gastrointestinal Tract. J. Nutr. 2000, 130, 1388S–1392S. [Google Scholar] [CrossRef]
- National Research Council; Committee on Nutrient Requirements of Swine; Board on Agriculture and Natural Resources; Division on Earth and Life Studies. Nutrient Requirements of Swine, 11th ed.; The National Academies Press: Washington, DC, USA, 2012; ISBN 978-0-309-22423-9. [Google Scholar]
- Fix, J.S.; Cassady, J.P.; van Heugten, E.; Hanson, D.J.; See, M.T. Differences in lean growth performance of pigs sampled from 1980 and 2005 commercial swine fed 1980 and 2005 representative feeding programs. Livest. Sci. 2010, 128, 108–114. [Google Scholar] [CrossRef]
- EU. Commission implementing regulation (EU) 2016/1095 of 6 July 2016 concerning the authorisation of Zinc acetate dihydrate, Zinc chloride anhydrous, Zinc oxide, Zinc sulphate heptahydrate, Zinc sulphate monohydrate, Zinc chelate of amino acids hydrate, Zinc chelate of protein hydrolysates, Zinc chelate of glycine hydrate (solid) and Zinc chelate of glycine hydrate (liquid) as feed additives for all animal species and amending Regulations (EC) No 1334/2003, (EC) No 479/2006, (EU) No 335/2010 and Implementing Regulations (EU) No 991/2012 and (EU) No 636/2013. Off. J. Eur. Union 2016, L 182, 7. [Google Scholar]
- EU. Commission Implementing Decision of 26.6.2017 Concerning, in the Framework of Article 35 of Directive 2001/82/EC of the European Parliament and of the Council, the Marketing Authorisations for Veterinary Medicinal Products Containing “Zinc Oxide” to Be Administered Orally to Food Producing Species. 2017. Available online: https://ec.europa.eu/health/documents/community-register/2017/20170626136754/dec_136754_en.pdf (accessed on 15 May 2022).
- Lu, J.J.; Wang, C.; Xie, P.; Liu, L.L.; Dong, X.Y.; Zou, X.T. Use of lower level of capsulated zinc oxide as an alternative to pharmacological dose of zinc oxide for weaned piglets. Asian J. Anim. Vet. Adv. 2012, 7, 1290–1300. [Google Scholar] [CrossRef]
- Wilt, H.D.; Carlson, M.S. Effect of supplementing zinc oxide and biotin with or without carbadox on nursery pig performance. J. Anim. Sci. 2009, 87, 3253–3258. [Google Scholar] [CrossRef] [PubMed]
- Bruininx, E.M.A.M.; Binnendijk, G.P.; van der Peet-Schwering, C.M.C.; Schrama, J.W.; den Hartog, L.A.; Everts, H.; Beynen, A.C. Effect of creep feed consumption on individual feed intake characteristics and performance of group-housed weanling pigs. J. Anim. Sci. 2002, 80, 1413–1418. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruininx, E.M.A.M.; Van Der Peet-Schwering, C.M.; Schrama, J.W.; Vereijken, P.F.; Vesseur, P.C.; Everts, H.; Den Hartog, L.A.; Beynen, A.C. Individually measured feed intake characteristics and growth performance of group-housed weanling pigs: Effects of sex, initial body weight, and body weight distribution within groups. J. Anim. Sci. 2001, 79, 301. [Google Scholar] [CrossRef] [PubMed]
- Suttle, N.F. Minerals in Animal Nutrition, 4th ed.; CABI: Wallingford, UK, 2010. [Google Scholar]
- Dewar, W.A.; Downie, J.N. The zinc requirements of broiler chicks and turkey poults fed on purified diets. Br. J. Nutr. 1984, 51, 467–477. [Google Scholar] [CrossRef] [Green Version]
- King, J.C.; Brown, K.H.; Gibson, R.S.; Krebs, N.F.; Lowe, N.M.; Siekmann, J.H.; Raiten, D.J. Biomarkers of Nutrition for Development (BOND)—Zinc Review. J. Nutr. 2015, 146, 858S–885S. [Google Scholar] [CrossRef] [Green Version]
- Broom, L.J.; Monteiro, A.; Piñon, A. Recent Advances in Understanding the Influence of Zinc, Copper, and Manganese on the Gastrointestinal Environment of Pigs and Poultry. Animals 2021, 11, 1276. [Google Scholar] [CrossRef]
- Brugger, D.; Buffler, M.; Windisch, W. Development of an experimental model to assess the bioavailability of zinc in practical piglet diets. Arch. Anim. Nutr. 2014, 68, 73–92. [Google Scholar] [CrossRef]
- Revy, P.S.; Jondreville, C.; Dourmad, J.Y.; Nys, Y. Assessment of dietary zinc requirement of weaned piglets fed diets with or without microbial phytase. J. Anim. Physiol. Anim. Nutr. 2006, 90, 50–59. [Google Scholar] [CrossRef]
- Pedersen, K.S.; Toft, N. Intra- and inter-observer agreement when using a descriptive classification scale for clinical assessment of faecal consistency in growing pigs. Prev. Vet. Med. 2011, 98, 288–291. [Google Scholar] [CrossRef]
- Larsen, T. Fluorometric determination of d-lactate in biological fluids. Anal. Biochem. 2017, 539, 152–157. [Google Scholar] [CrossRef]
- ThermoFisher. DNA Copy Number Calculator. Available online: https://www.thermofisher.com/dk/en/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/dna-copy-number-calculator.html (accessed on 24 January 2022).
- Hermann-Bank, M.L.; Skovgaard, K.; Stockmarr, A.; Larsen, N.; Molbak, L. The Gut Microbiotassay: A high-throughput qPCR approach combinable with next generation sequencing to study gut microbial diversity. BMC Genom. 2013, 14, 788. [Google Scholar] [CrossRef] [Green Version]
- Walker, D.I.; McQuillan, J.; Taiwo, M.; Parks, R.; Stenton, C.A.; Morgan, H.; Mowlem, M.C.; Lees, D.N. A highly specific Escherichia coli qPCR and its comparison with existing methods for environmental waters. Water Res. 2017, 126, 101–110. [Google Scholar] [CrossRef] [Green Version]
- Lee, D.-H.; Zo, Y.-G.; Kim, S.-J. Nonradioactive method to study genetic profiles of natural bacterial communities by PCR-single-strand-conformation polymorphism. Appl. Environ. Microbiol. 1996, 62, 3112–3120. [Google Scholar] [CrossRef] [Green Version]
- R Studio Team. RStudio: Integrated Development Environment for R; RStudio, PBC: Boston, MA, USA, 2012; Available online: http://www.rstudio.com/ (accessed on 15 May 2022).
- Bates, D.; Mächler, M.; Bolker, B.; Walker, S. Fitting Linear Mixed-Effects Models using lme4. J. Stat. Softw. 2014, 67, 1–48. [Google Scholar] [CrossRef]
- Wood, S. mgcv: Mixed GAM Computation Vehicle with Automatic Smoothness Estimation. R Package Version 1.8-38. Available online: https://cran.r-project.org/web/packages/mgcv/index.html (accessed on 15 May 2022).
- Christensen, R.H.B. Ordinal: Regression Models for Ordinal Data. R Package Version 2019.12-10. Available online: https://cran.r-project.org/web/packages/ordinal/index.html (accessed on 22 September 2021).
- Nakazawa, M. fmsb: Functions for Medical Statistics Book with Some Demographic Data. R Package Version 0.7.1. Available online: https://cran.r-project.org/web/packages/fmsb/index.html (accessed on 24 September 2021).
- Lenth, R.V.; Buerkner, P.; Herve, M.; Love, J.; Miguez, F.; Riebl, H.; Singmann, H. Estimated Marginal Means, aka Least-Squares Means. R Package Version 1.7.1-1. Available online: https://cran.r-project.org/web/packages/emmeans/emmeans.pdf (accessed on 15 May 2022).
- Poulsen, H.D. Zinc oxide for weanling piglets. Acta Agric. Scand. Sect. A—Anim. Sci. 1995, 45, 159–167. [Google Scholar] [CrossRef]
- Hahn, J.D.; Baker, D.H. Growth and plasma zinc responses of young pigs fed pharmacologic levels of zinc. J. Anim. Sci. 1993, 71, 3020–3024. [Google Scholar] [CrossRef]
- Hill, G.M.; Mahan, D.C.; Carter, S.D.; Cromwell, G.L.; Ewan, R.C.; Harrold, R.L.; Lewis, A.J.; Miller, P.S.; Shurson, G.C.; Veum, T.L. Effect of pharmacological concentrations of zinc oxide with or without the inclusion of an antibacterial agent on nursery pig performance. J. Anim. Sci. 2001, 79, 934–941. [Google Scholar] [CrossRef] [PubMed]
- Carlson, D.; Beattie, J.H.; Poulsen, H.D. Assessment of zinc and copper status in weaned piglets in relation to dietary zinc and copper supply. J. Anim. Physiol. Anim. Nutr. 2007, 91, 19–28. [Google Scholar] [CrossRef]
- Burrough, E.R.; De Mille, C.; Gabler, N.K. Zinc overload in weaned pigs: Tissue accumulation, pathology, and growth impacts. J. Vet. Diagn. Investig. 2019, 31, 537–545. [Google Scholar] [CrossRef]
- Cho, J.H.; Upadhaya, S.D.; Kim, I.H. Effects of dietary supplementation of modified zinc oxide on growth performance, nutrient digestibility, blood profiles, fecal microbial shedding and fecal score in weanling pigs. Anim. Sci. J. 2015, 86, 617–623. [Google Scholar] [CrossRef]
- Sun, Y.B.; Xia, T.; Wu, H.; Zhang, W.J.; Zhu, Y.H.; Xue, J.X.; He, D.T.; Zhang, L.Y. Effects of nano zinc oxide as an alternative to pharmacological dose of zinc oxide on growth performance, diarrhea, immune responses, and intestinal microflora profile in weaned piglets. Anim. Feed Sci. Technol. 2019, 258, 114312. [Google Scholar] [CrossRef]
- Shen, J.; Chen, Y.; Wang, Z.; Zhou, A.; He, M.; Mao, L.; Zou, H.; Peng, Q.; Xue, B.; Wang, L.; et al. Coated zinc oxide improves intestinal immunity function and regulates microbiota composition in weaned piglets. Br. J. Nutr. 2014, 111, 2123–2134. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, F.H.; Forbes, J.M.; Miller, H.M. Does the newly weaned piglet select a zinc oxide supplemented feed, when given the choice? Animal 2010, 4, 1359–1367. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Guo, Y. The growth-promoting effect of tetrabasic zinc chloride is associated with elevated concentration of growth hormone and ghrelin. Asian-Australas. J. Anim. Sci. 2008, 21, 1473–1478. [Google Scholar] [CrossRef]
- Yin, J.; Li, X.; Li, D.; Yue, T.; Fang, Q.; Ni, J.; Zhou, X.; Wu, G. Dietary supplementation with zinc oxide stimulates ghrelin secretion from the stomach of young pigs. J. Nutr. Biochem. 2009, 20, 783–790. [Google Scholar] [CrossRef]
- Prinz, P.; Stengel, A. Control of Food Intake by Gastrointestinal Peptides: Mechanisms of Action and Possible Modulation in the Treatment of Obesity. J. Neurogastroenterol. Motil. 2017, 23, 180–196. [Google Scholar] [CrossRef] [Green Version]
- Case, C.L.; Carlson, M.S. Effect of feeding organic and inorganic sources of additional zinc on growth performance and zinc balance in nursery pigs. J. Anim. Sci. 2002, 80, 1917–1924. [Google Scholar] [CrossRef]
- Abonyi, F.O.; Ogoenyi, E.E.; Eze, J.I.; Machebe, N.S. Growth performance, haematology and insulin profile of weanling pigs fed graded levels zinc oxide supplemented diet. Indian J. Anim. Res. 2015, 49, 638–644. [Google Scholar] [CrossRef] [Green Version]
- Hedemann, M.S.; Jensen, B.B.; Poulsen, H.D. Influence of dietary zinc and copper on digestive enzyme activity and intestinal morphology in weaned pigs. J. Anim. Sci. 2006, 84, 3310–3320. [Google Scholar] [CrossRef] [Green Version]
- Kjeldsen, N.J.; Krogsdahl, J.; Koziara, S.E. Alternativer til Medicinsk Zink til Smågrise; SEGES Svineproduktion: Copenhagen, Denmark, 2017; p. 101. [Google Scholar]
- Shirali, M.; Doeschl-Wilson, A.; Knap, P.W.; Duthie, C.; Kanis, E.; Van Arendonk, J.A.M.; Roehe, R. Nitrogen excretion at different stages of growth and its association with production traits in growing pigs. J. Anim. Sci. 2012, 90, 1756–1765. [Google Scholar] [CrossRef] [Green Version]
- Rantzer, D.; Svendsen, J. Slatted versus Solid Floors in the Dung Area: Comparison of Pig Production System (Moved versus not Moved) and Effects on Hygiene and Pig Performance, Weaning to Four Weeks after Weaning. Acta Agric. Scand. Sect. A—Anim. Sci. 2001, 51, 175–183. [Google Scholar] [CrossRef]
- Horn, N.; Ruch, F.; Little, C.R.; Miller, G.; Ajuwon, K.M.; Adeola, O. Impact of acute feed and water deprivation at weaning and subsequent heat stress on growth performance and ileal morphology in nursery pigs. J. Anim. Sci. 2016, 94, 289–293. [Google Scholar] [CrossRef] [Green Version]
- Pastorelli, H.; Le Floc’h, N.; Merlot, E.; Meunier-Salaün, M.C.; van Milgen, J.; Montagne, L. Sanitary housing conditions modify the performance and behavioural response of weaned pigs to feed- and housing-related stressors. Animal 2012, 6, 1811–1820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Puls, R. Mineral Levels in Animal Health: Diagnostic Data; Sherpa International: Clearbrook, BC, Canada, 1990. [Google Scholar]
- Thompson, J.S.; Vaughan, W.P.; Forst, C.F.; Jacobs, D.L.; Weekly, J.S.; Rikkers, L.F. The effect of the route of nutrient delivery on gut structure and diamine oxidase levels. J. Parenter. Enter. Nutr. 1987, 11, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Brandt, R.B.; Siegel, S.A.; Waters, M.G.; Bloch, M.H. Spectrophotometric assay for d-(−)-lactate in plasma. Anal. Biochem. 1980, 102, 39–46. [Google Scholar] [CrossRef]
- Biebl, M.; Klocker, J.; Perkmann, R.; Kolbitsch, C.; Klingler, P.; Drasche, A.; Klingler, A.; Fraedrich, G.; Schwelberger, H.G. Heparin-induced diamine oxidase release into the circulation in pigs. Inflamm. Res. 2002, 51, S93–S94. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, W.; Wang, R.; Hao, X.; Duan, Y.; Meng, Z.; An, X.; Qi, J. Dietary fermented soybean meal inclusion improves growth performance and ileal barrier function of the weaned piglets challenged by enterotoxigenic Escherichia coli K88. Anim. Feed Sci. Technol. 2020, 268, 114596. [Google Scholar] [CrossRef]
- Hu, C.H.; Song, Z.H.; Xiao, K.; Song, J.; Jiao, L.F.; Ke, Y.L. Zinc oxide influences intestinal integrity, the expressions of genes associated with inflammation and TLR4-myeloid differentiation factor 88 signaling pathways in weanling pigs. Innate Immun. 2014, 20, 478–486. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Zhang, L.; Ying, Z.; He, J.; Zhou, L.; Zhang, L.; Zhong, X.; Wang, T. Effects of dietary zinc oxide nanoparticles on growth, diarrhea, mineral deposition, intestinal morphology, and barrier of weaned piglets. Biol. Trace Elem. Res. 2018, 185, 364–374. [Google Scholar] [CrossRef]
- Pieper, R.; Dadi, T.H.; Pieper, L.; Vahjen, W.; Franke, A.; Reinert, K.; Zentek, J. Concentration and chemical form of dietary zinc shape the porcine colon microbiome, its functional capacity and antibiotic resistance gene repertoire. ISME J. 2020, 14, 2783–2793. [Google Scholar] [CrossRef]
- Wang, C.; Zhang, L.; Su, W.; Ying, Z.; He, J.; Zhang, L.; Zhong, X.; Wang, T. Zinc oxide nanoparticles as a substitute for zinc oxide or colistin sulfate: Effects on growth, serum enzymes, zinc deposition, intestinal morphology and epithelial barrier in weaned piglets. PLoS ONE 2017, 12, e0181136. [Google Scholar] [CrossRef] [PubMed]
- Upadhaya, S.D.; Kim, Y.M.; Lee, K.Y.; Kim, I.H. Use of protected zinc oxide in lower doses in weaned pigs in substitution for the conventional high dose zinc oxide. Anim. Feed Sci. Technol. 2018, 240, 1–10. [Google Scholar] [CrossRef]
- Schell, T.C.; Kornegay, E.T. Zinc concentration in tissues and performance of weanling pigs fed pharmacological levels of zinc from ZnO, Zn-methionine, Zn-lysine, or ZnSO4. J. Anim. Sci. 1996, 74, 1584–1593. [Google Scholar] [CrossRef] [PubMed]
- Bhatnagar, S.; Bahl, R.; Sharma, P.K.; Kumar, G.T.; Saxena, S.K.; Bhan, M.K. Zinc with Oral Rehydration Therapy Reduces Stool Output and Duration of Diarrhea in Hospitalized Children: A Randomized Controlled Trial. J. Pediatr. Gastroenterol. Nutr. 2004, 38, 34–40. [Google Scholar] [CrossRef] [Green Version]
- Bednorz, C.; Oelgeschlager, K.; Kinnemann, B.; Hartmann, S.; Neumann, K.; Pieper, R.; Bethe, A.; Semmler, T.; Tedin, K.; Schierack, P.; et al. The broader context of antibiotic resistance: Zinc feed supplementation of piglets increases the proportion of multi-resistant Escherichia coli in vivo. Int. J. Med. Microbiol. 2013, 303, 396–403. [Google Scholar] [CrossRef]
- Slifierz, M.J.; Friendship, R.; Weese, J.S. Zinc oxide therapy increases prevalence and persistence of methicillin-resistant Staphylococcus aureus in pigs: A randomized controlled trial. Zoonoses Public Health 2015, 62, 301–308. [Google Scholar] [CrossRef]
- Xia, T.; Lai, W.; Han, M.; Han, M.; Ma, X.; Zhang, L. Dietary ZnO nanoparticles alters intestinal microbiota and inflammation response in weaned piglets. Oncotarget 2017, 8, 64878–64891. [Google Scholar] [CrossRef] [Green Version]
- Pieper, R.; Vahjen, W.; Neumann, K.; Van Kessel, A.G.; Zentek, J. Dose-dependent effects of dietary zinc oxide on bacterial communities and metabolic profiles in the ileum of weaned pigs. J. Anim. Physiol. Anim. Nutr. 2012, 96, 825–833. [Google Scholar] [CrossRef]
Ingredients | % |
---|---|
Wheat | 40.3 |
Barley | 20.0 |
Soy protein concentrate, HP300 | 9.8 |
Soybean meal, 45.8% protein | 8.0 |
Oats | 5.9 |
Vegetable fat and oil | 4.8 |
Lactose | 4.1 |
Fishmeal | 3.0 |
Vitamin/mineral premix 2 | 2.2 |
Monocalcium phosphate | 1.1 |
Salt | 0.7 |
Aroma | 0.1 |
Natuphos 10000 E 1 | 0.02 |
Calculated composition (as-fed) | |
Crude protein, % | 18.3 |
Lysine, % | 1.25 |
Ca, % | 0.74 |
P, % (available) | 0.40 |
Fe, mg/kg | 180 |
Zn, mg/kg | 29 |
Cu, mg/kg | 120 |
Added Zn (mg/kg) 3 | Analysed Zn (as-fed), mg/kg feed |
Basal diet (no added ZnO) | 50 |
100 | 153 |
450 | 493 |
950 | 1022 |
1450 | 1601 |
1950 | 2052 |
2450 | 2407 |
Primer Name 1 | Target Sequence | Sequence (5′–3′) | Conc. 2 (μM) | AT 3 (°C) | Size (bp) | Standard | Reference |
---|---|---|---|---|---|---|---|
Bank-lacto-F | All Lactobacillus (23S rRNA) | GCGGTGAAATTCCAAACG | 0.30 | 60 | 216 | Lactobacillus reuteri DSM 20016 | [35] |
Bank-lacto-R | GGGACCTTAACTGGTGAT | 0.30 | |||||
E. coli 401 F | All E. coli (ybbW gene) | TGATTGGCAAAATCTGGCCG | 0.50 | 65 | 211 | E. coli K12 | [36] |
E. coli 611 R | GAAATCGCCCAAATCGCCAT | 0.50 | |||||
16S_BAC-F (SRV3-1) | All bacteria (16S rRNA) | CGGYCCAGACTCCTACGG | 0.30 | 65 | 200 | E. coli K12 | [37] |
16S_BAC-R (SRV3-2) | TTACCGCGGCTGCTGGCAC | 0.30 |
Total Dietary Zinc Concentration [mg Zn/kg Diet] 2 | ||||||||
---|---|---|---|---|---|---|---|---|
153 | 493 | 1022 | 1601 | 2052 | 2407 | 95% CI | p-Values | |
Week 1 | 28.2 a | 19.1 ab | 13.2 ab | 23.3 a | 10.6 ab | 6.6 b | 11.7–19.9 | <0.05 |
Week 2 | 22.7 a | 13.6 ab | 16.1 ab | 16.0 ab | 6.9 b | 6.4 b | 9.6–16.0 | <0.05 |
Week 3 | 43.7 a | 26.9 ab | 27.7 ab | 16.9 abc | 12.4 bc | 4.5 c | 13.1–26.0 | <0.05 |
Week 1–2 | 26.3 a | 17.1 abc | 15.7 abc | 20.0 ab | 9.7 bc | 7.0 c | 12.2–17.9 | <0.05 |
Week 1–3 | 33.3 a | 22.0 ab | 21.5 ab | 21.1 ab | 13.1 bc | 7.7 c | 15.5–21.6 | <0.05 |
Serum Zinc Concentration | Relative Risk (95% CI) | p-Value | ||
---|---|---|---|---|
≤767 µg/L | >767 µg/L | |||
Day 7 1 | ||||
Number of pigs | 87 | 85 | ||
Days with diarrhoea (d 7–13) * | 126 | 81 | 1.52 (1.18–1.96) | <0.01 |
Total number of days # | 609 | 595 | ||
Day 14 2 | ||||
Number of pigs | 54 | 111 | ||
Days with diarrhoea (d 14–20) * | 142 | 182 | 1.60 (1.34–1.92) | <0.01 |
Total number of days # | 378 | 777 |
Dietary Zn [mg Zn/kg Diet] | ||||||||
---|---|---|---|---|---|---|---|---|
153 | 493 | 1022 | 1601 | 2052 | 2407 | 95% CI | p-Value | |
D-Lactate [mg/L] | ||||||||
Day 0 | 0.71 | 0.91 | 1.48 | 1.18 | 0.88 | 1.54 | 0.63–1.82 | 0.06 |
Day 7 | 2.27 | 3.01 | 2.74 | 2.23 | 1.61 | 1.87 | 1.54–3.25 | 0.61 |
Day 14 | 1.97 | 1.60 | 1.93 | 2.43 | 2.11 | 1.67 | 1.54–2.42 | 0.81 |
Day 21 | 2.10 | 1.11 | 1.43 | 4.14 | 1.48 | 1.03 | 0.92–1.96 | 0.47 |
DAO [Units/min] | ||||||||
Day 21 | 100 | 119 | 104 | 123 | 123 | 124 | 82–149 | 0.25 |
Total Dietary Zn [mg Zn/kg Diet] | ||||||
---|---|---|---|---|---|---|
153 | 1022 | 1601 | 2407 | 95% CI | p-Value | |
Total bacteria count (log copies/g sample) | 10.4 A | 10.3 AB | 10.2 AB | 10.0 B | 10.0–10.4 | 0.08 |
Total Lactobacilli count (log copies/g sample) | 9.80 a | 9.44 ab | 9.39 ab | 8.92 b | 8.98–9.82 | <0.01 |
Total E. coli count (log copies/g sample) | 5.92 a | 5.53 ab | 5.23 ab | 4.99 b | 5.08–5.73 | 0.04 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hansen, S.V.; Nørskov, N.P.; Nørgaard, J.V.; Woyengo, T.A.; Poulsen, H.D.; Nielsen, T.S. Determination of the Optimal Level of Dietary Zinc for Newly Weaned Pigs: A Dose-Response Study. Animals 2022, 12, 1552. https://doi.org/10.3390/ani12121552
Hansen SV, Nørskov NP, Nørgaard JV, Woyengo TA, Poulsen HD, Nielsen TS. Determination of the Optimal Level of Dietary Zinc for Newly Weaned Pigs: A Dose-Response Study. Animals. 2022; 12(12):1552. https://doi.org/10.3390/ani12121552
Chicago/Turabian StyleHansen, Sally V., Natalja P. Nørskov, Jan V. Nørgaard, Tofuko A. Woyengo, Hanne D. Poulsen, and Tina S. Nielsen. 2022. "Determination of the Optimal Level of Dietary Zinc for Newly Weaned Pigs: A Dose-Response Study" Animals 12, no. 12: 1552. https://doi.org/10.3390/ani12121552
APA StyleHansen, S. V., Nørskov, N. P., Nørgaard, J. V., Woyengo, T. A., Poulsen, H. D., & Nielsen, T. S. (2022). Determination of the Optimal Level of Dietary Zinc for Newly Weaned Pigs: A Dose-Response Study. Animals, 12(12), 1552. https://doi.org/10.3390/ani12121552