The Knockout of the ASIP Gene Altered the Lipid Composition in Bovine Mammary Epithelial Cells via the Expression of Genes in the Lipid Metabolism Pathway
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Construction of KO-ASIP bMECs
2.3. Identification of KO-ASIP bMECs Lines
2.4. Determination of Triglycerides, Cholesterol, and Intracellular Fatty Acid Content in bMECs of ASIP Gene
2.5. RNA Extraction, Library Preparation and RNA-Seq Analysis
2.6. Determination of Gene Expression Related to Lipid Metabolism
2.7. Statistical Analysis
3. Results
3.1. Construction of KO-ASIP bMECs
3.2. Detection of Triglycerides, Cholesterol and Fatty Acid in KO-ASIP bMECs
3.3. Functional Enrichment Analysis of the DEGs in KO-ASIP bMECs
3.4. Prediction and Analysis of Signal Pathway Interaction after ASIP Knockout
3.5. Verification of Differential Gene Expression Level
3.6. Effect of ASIP Knockout on the Milk Lipid Metabolism Pathways
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Månsson, H.L. Fatty Acids in Bovine Milk Fat. Food Nutr. Res. 2008, 52, 1821. [Google Scholar] [CrossRef] [PubMed]
- Gidding, S.S.; Dennison, B.A.; Birch, L.L.; Daniels, S.R.; Gilman, M.W.; Lichtenstein, A.H.; Rattay, K.T.; Steinberger, J.; Stettler, N.; Van Horn, L. Dietary Recommendations for Children and Adolescents. Circulation 2005, 112, 2061–2075. [Google Scholar] [CrossRef]
- American Heart Association; Gidding, S.S.; Dennison, B.A.; Birch, L.L.; Daniels, S.R.; Gilman, M.W.; Lichtenstein, A.H.; Rattay, K.T.; Steinberger, J.; Stettler, N.; et al. Dietary Recommendations for Children and Adolescents: A Guide for Practitioners. Pediatrics 2006, 117, 544–559. [Google Scholar] [PubMed]
- Tucker, L.A. Milk Fat Intake and Telomere Length in U.S. Women and Men: The Role of the Milk Fat Fraction. Oxid Med. Cell Longev. 2019, 2019, e1574021. [Google Scholar] [CrossRef] [PubMed]
- Haug, A.; Høstmark, A.T.; Harstad, O.M. Bovine Milk in Human Nutrition—A Review. Lipids Health Dis. 2007, 6, 25. [Google Scholar] [CrossRef] [PubMed]
- Guallar, E.; Aro, A.; Jiménez, F.J.; Martín-Moreno, J.M.; Salminen, I.; van’t Veer, P.; Kardinaal, A.F.M.; Gómez-Aracena, J.; Martin, B.C.; Kohlmeier, L.; et al. Omega-3 Fatty Acids in Adipose Tissue and Risk of Myocardial Infarction. Arterioscl. Throm. Vas. 1999, 19, 1111–1118. [Google Scholar] [CrossRef][Green Version]
- Kris-Etherton, P.M.; Pearson, T.A.; Wan, Y.; Hargrove, R.L.; Moriarty, K.; Fishell, V.; Etherton, T.D. High–Monounsaturated Fatty Acid Diets Lower Both Plasma Cholesterol and Triacylglycerol Concentrations. Am. J. Clin. Nutr. 1999, 70, 1009–1015. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Lu, S.; Cui, K.; Shafique, L.; Luo, C.; Wang, Z.; Ruan, J.; Qian, Q.; Liu, Q. Fatty Acid Biosynthesis and Transcriptional Regulation of Stearoyl-CoA Desaturase 1 (SCD1) in Buffalo Milk. BMC Genet. 2020, 21, 23. [Google Scholar] [CrossRef]
- Kadegowda, A.K.G.; Bionaz, M.; Piperova, L.S.; Erdman, R.A.; Loor, J.J. Peroxisome Proliferator-Activated Receptor-Gamma Activation and Long-Chain Fatty Acids Alter Lipogenic Gene Networks in Bovine Mammary Epithelial Cells to Various Extents. J. Dairy Sci. 2009, 92, 4276–4289. [Google Scholar] [CrossRef]
- Li, C.; Sun, D.; Zhang, S.; Yang, S.; Alim, M.A.; Zhang, Q.; Li, Y.; Liu, L. Genetic Effects of FASN, PPARGC1A, ABCG2 and IGF1 Revealing the Association with Milk Fatty Acids in a Chinese Holstein Cattle Population Based on a Post Genome-Wide Association Study. BMC Genet. 2016, 17, 110. [Google Scholar] [CrossRef]
- Bultman, S.J.; Michaud, E.J.; Woychik, R.P. Molecular Characterization of the Mouse Agouti Locus. Cell 1992, 71, 1195–1204. [Google Scholar] [CrossRef]
- Voisey, J.; van Daal, A. Agouti: From Mouse to Man, from Skin to Fat. Pigment Cell Res. 2002, 15, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Jones, B.H.; Kim, J.H.; Zemel, M.B.; Woychik, R.P.; Michaud, E.J.; Wilkison, W.O.; Moustaid, N. Upregulation of Adipocyte Metabolism by Agouti Protein: Possible Paracrine Actions in Yellow Mouse Obesity. Am. J. Physiol. 1996, 270, E192–E196. [Google Scholar] [CrossRef] [PubMed]
- Albrecht, E.; Komolka, K.; Kuzinski, J.; Maak, S. Agouti Revisited: Transcript Quantification of the ASIP Gene in Bovine Tissues Related to Protein Expression and Localization. PLoS ONE 2012, 7, e35282. [Google Scholar] [CrossRef]
- Liu, Y.; Albrecht, E.; Schering, L.; Kuehn, C.; Yang, R.; Zhao, Z.; Maak, S. Agouti Signaling Protein and Its Receptors as Potential Molecular Markers for Intramuscular and Body Fat Deposition in Cattle. Front. Physiol. 2018, 9, 172. [Google Scholar] [CrossRef]
- Liu, Y.; Fang, X.; Zhihui, Z.; Li, J.; Albrecht, E.; Schering, L.; Maak, S.; Yang, R. Polymorphisms of the ASIP Gene and the Haplotype Are Associated with Fat Deposition Traits and Fatty Acid Composition in Chinese Simmental Steers. Arch. Anim. Breed. 2019, 62, 135–142. [Google Scholar] [CrossRef]
- Lu, C.; Yang, R.; Liu, B.; Li, Z.; Shen, B.; Yan, S.; Zhang, Y.; Zhang, L.; Zhao, Z. Establishment of Two Types of Mammary Epithelial Cell Lines from Chinese Holstein Dairy Cow. J. Anim. Vet. Adv. 2012, 11, 1166–1172. [Google Scholar]
- Jiang, P.; Xia, L.; Jin, Z.; Ali, S.; Wang, M.; Li, X.; Yang, R.; Fang, X.; Zhao, Z. New function of the CD44 gene: Lipid metabolism regulation in bovine mammary epithelial cells. J. Dairy Sci. 2020, 103, 6661–6671. [Google Scholar] [CrossRef]
- Ghatak, S.; Muthukumaran, R.B.; Nachimuthu, S.K. A Simple Method of Genomic DNA Extraction from Human Samples for PCR-RFLP Analysis. J. Biomol. Tech. 2013, 24, 224–231. [Google Scholar] [CrossRef]
- Costa-Silva, J.; Domingues, D.; Lopes, F.M. RNA-Seq Differential Expression Analysis: An Extended Review and a Software Tool. PLoS ONE 2017, 12, e0190152. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. ClusterProfiler: An R Package for Comparing Biological Themes among Gene Clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef] [PubMed]
- Jiang, P.; Iqbal, A.; Wang, M.; Li, X.; Fang, X.; Yu, H.; Zhao, Z. Transcriptomic Analysis of Short/Branched-Chain Acyl-Coenzyme a Dehydrogenase Knocked Out BMECs Revealed Its Regulatory Effect on Lipid Metabolism. Front. Vet. Sci. 2021, 8, 744287. [Google Scholar] [CrossRef] [PubMed]
- Jensen, R.G.; Newburg, D.S. B—Bovine Milk Lipids. In Handbook of Milk Composition; Jensen, R.G., Ed.; Food Science and Technology; Academic Press: San Diego, CA, USA, 1995; pp. 543–575. [Google Scholar]
- Ohlsson, L. Dairy Products and Plasma Cholesterol Levels. Food Nutr. Res. 2010, 54, 1. [Google Scholar] [CrossRef] [PubMed]
- Sealls, W.; Gonzalez, M.; Brosnan, M.J.; Black, P.N.; DiRusso, C.C. Dietary Polyunsaturated Fatty Acids (C18:2 Ω6 and C18:3 Ω3) Do Not Suppress Hepatic Lipogenesis. Biochim. Biophys Acta Mol. Cell Res. Lipids 2008, 1781, 406–414. [Google Scholar] [CrossRef]
- Aquino-Bolaños, E.N.; Mapel-Velazco, L.; Martín-del-Campo, S.T.; Chávez-Servia, J.L.; Martínez, A.J.; Verdalet-Guzmán, I. Fatty Acids Profile of Oil from Nine Varieties of Macadamia Nut. Int. J. Food Prop. 2017, 20, 1262–1269. [Google Scholar] [CrossRef]
- Dan, N.; Zhang, H.; Ao, C. Khas-Erdene Transcriptional Regulation of Milk Lipid Synthesis by Exogenous C16:0 and C18 Fatty Acids in Bovine Mammary Epithelial Cells. CJAS 2018, 98, 260–270. [Google Scholar]
- Lordan, R.; Tsoupras, A.; Mitra, B.; Zabetakis, I. Dairy Fats and Cardiovascular Disease: Do We Really Need to Be Concerned? Foods 2018, 7, 29. [Google Scholar] [CrossRef]
- Grundy, S.M. Monounsaturated Fatty Acids and Cholesterol Metabolism: Implications for Dietary Recommendations. J. Nutr. 1989, 119, 529–533. [Google Scholar] [CrossRef]
- Yang, Z.-H.; Emma-Okon, B.; Remaley, A.T. Dietary Marine-Derived Long-Chain Monounsaturated Fatty Acids and Cardiovascular Disease Risk: A Mini Review. Lipids Health Dis. 2016, 15, 201. [Google Scholar] [CrossRef]
- Zhao, Z.; Bai, Y.; Tian, H.; Shi, B.; Li, X.; Luo, Y.; Wang, J.; Hu, J.; Raza, S.H.A. Interference with ACSL1 Gene in Bovine Adipocytes: Transcriptome Profiling of CircRNA Related to Unsaturated Fatty Acid Production. Genomics 2021, 113, 3967–3977. [Google Scholar] [CrossRef]
- Tian, W.; Zhang, W.; Zhang, Y.; Zhu, T.; Hua, Y.; Li, H.; Zhang, Q.; Xia, M. FABP4 Promotes Invasion and Metastasis of Colon Cancer by Regulating Fatty Acid Transport. Cancer Cell Int. 2020, 20, 512. [Google Scholar] [CrossRef] [PubMed]
- Hotamisligil, G.S.; Bernlohr, D.A. Metabolic Functions of FABPs- Mechanisms and Therapeutic Implications. Nat. Rev. Endocrinol. 2015, 11, 592–605. [Google Scholar] [CrossRef] [PubMed]
- Ji, Z.; Shen, Y.; Feng, X.; Kong, Y.; Shao, Y.; Meng, J.; Zhang, X.; Yang, G. Deregulation of Lipid Metabolism: The Critical Factors in Ovarian Cancer. Front. Oncol. 2020, 10, 593017. [Google Scholar] [CrossRef] [PubMed]
- Suburu, J.; Shi, L.; Wu, J.; Wang, S.; Samuel, M.; Thomas, M.J.; Kock, N.D.; Yang, G.; Kridel, S.; Chen, Y.Q. Fatty Acid Synthase Is Required for Mammary Gland Development and Milk Production during Lactation. Am. J. Physiol. Endocrinol. Metab. 2014, 306, E1132–E1143. [Google Scholar] [CrossRef] [PubMed]
- Matsui, H.; Yokoyama, T.; Sekiguchi, K.; Iijima, D.; Sunaga, H.; Maniwa, M.; Ueno, M.; Iso, T.; Arai, M.; Kurabayashi, M. Stearoyl-CoA Desaturase-1 (SCD1) Augments Saturated Fatty Acid-Induced Lipid Accumulation and Inhibits Apoptosis in Cardiac Myocytes. PLoS ONE 2012, 7, e33283. [Google Scholar]
- Mele, M.; Conte, G.; Castiglioni, B.; Chessa, S.; Macciotta, N.P.P.; Serra, A.; Buccioni, A.; Pagnacco, G.; Secchiari, P. Stearoyl-Coenzyme A Desaturase Gene Polymorphism and Milk Fatty Acid Composition in Italian Holsteins. J. Dairy Sci. 2007, 90, 4458–4465. [Google Scholar] [CrossRef]
- Junjvlieke, Z.; Khan, R.; Mei, C.; Cheng, G.; Wang, S.; Raza, S.H.A.; Hong, J.; Wang, X.; Yang, W.; Zan, L. Effect of ELOVL6 on the Lipid Metabolism of Bovine Adipocytes. Genomics 2020, 112, 2282–2290. [Google Scholar] [CrossRef]
- Angela, M.; Endo, Y.; Asou, H.K.; Yamamoto, T.; Tumes, D.J.; Tokuyama, H.; Yokote, K.; Nakayama, T. Fatty Acid Metabolic Reprogramming via MTOR-Mediated Inductions of PPARγ Directs Early Activation of T Cells. Nat. Commun. 2016, 7, 13683. [Google Scholar] [CrossRef]
- Garin-Shkolnik, T.; Rudich, A.; Hotamisligil, G.; Rubinstein, M. FABP4 Attenuates PPAR Gamma and Adipogenesis and Is Inversely Correlated With PPARg in Adipose Tissues. Diabetes 2014, 63, 900–911. [Google Scholar] [CrossRef]
- Li, T.; Li, X.; Meng, H.; Chen, L.; Meng, F. ACSL1 Affects Triglyceride Levels through the PPARγ Pathway. Int. J. Med. Sci. 2020, 17, 720–727. [Google Scholar] [CrossRef]
- Han, T.; Lv, Y.; Wang, S.; Hu, T.; Hong, H.; Fu, Z. PPARγ Overexpression Regulates Cholesterol Metabolism in Human L02 Hepatocytes. J. Pharmacol. Sci. 2019, 139, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Hida, T.; Wakamatsu, K.; Sviderskaya, E.V.; Donkin, A.J.; Montoliu, L.; Lamoreux, M.L.; Yu, B.; Millhauser, G.L.; Ito, S.; Barsh, G.S.; et al. Agouti Protein, Mahogunin, and Attractin in Pheomelanogenesis and Melanoblast-like Alteration of Melanocytes: A CAMP-Independent Pathway. Pigment Cell Melanoma Res. 2009, 22, 623–634. [Google Scholar] [CrossRef] [PubMed]
- Horrell, E.M.W.; Boulanger, M.C.; D’Orazio, J.A. Melanocortin 1 Receptor: Structure, Function, and Regulation. Front. Genet. 2016, 7, 95. [Google Scholar] [CrossRef] [PubMed]







| Name | Sequence (5′ -> 3′) |
|---|---|
| ASIP gRNA | CCT GGGATGGATGTCAGCCGCCT |
| ASIP gRNA 1F | CACCAGGCGGCTGACATCCATCCCAGG |
| ASIP gRNA 1R | AAACGGGATGGATGTCAGCCGCCT |
| Gene Name | Sequence (5′ -> 3′) | Length (bp) | Tm (°C) | |
|---|---|---|---|---|
| Agouti signalling protein (ASIP) | Forward primer | CAGGTCCATCCTATCCTTCTG | 21 | 56.36 |
| Reverse primer | CACCAAGTGCCTTGACTTTG | 20 | 54.81 | |
| RARRES2 | Forward primer | GAAGAAAGACTGGAGGAAAGA | 21 | 54.88 |
| Reverse primer | CGTTGAACCTGAGTCTGTATG | 21 | 56.39 | |
| ELOVL6 | Forward primer | TCGAACTGGTGCTTATATGG | 20 | 54.96 |
| Reverse primer | TGTATCTCCTAGTTCGGGTG | 20 | 55.78 | |
| PGM2L1 | Forward primer | GCTTTGTAGTTGGGTATGAC | 20 | 54.01 |
| Reverse primer | GATACACAGGAACATCTTTGG | 21 | 54.29 | |
| HACD4 | Forward primer | CCAAGAGAAATACGTGGTGT | 20 | 55.4 |
| Reverse primer | GATAAATTGGCATCCACAGG | 20 | 54.39 | |
| FABP4 | Forward primer | TGAAATCACTCCAGATGACAG | 21 | 55.33 |
| Reverse primer | CATTCCAGCACCATCTTATC | 20 | 53.83 | |
| SLC26A2 | Forward primer | CCCAATCCATCGCTTATTCT | 20 | 55.27 |
| Reverse primer | CACCAATCATAAGGCACAGT | 20 | 55.72 | |
| BGN | Forward primer | TGGACCTGCAGAATAATGAC | 20 | 55.13 |
| Reverse primer | CTTGGAGATCTTGTTGTTCAC | 21 | 54.8 | |
| NR4A1 | Forward primer | TGCTTCCTTCAAGTTCGAG | 19 | 55.17 |
| Reverse primer | GACTGCCATAGTAGTCAGAG | 20 | 54.42 | |
| FASN | Forward primer | TGGAGTACGTTGAAGCCCAT | 20 | 59.02 |
| Reverse primer | ACTTGGTGGACCCAATCCG | 19 | 59.62 | |
| ACSL1 | Forward primer | TATACGAAGGTTTCCAGAGG | 20 | 53.89 |
| Reverse primer | CTGCCATATCTTCAACCTGT | 20 | 55.12 | |
| PPARγ | Forward primer | ACCCGATGGTTGCAGATTAT | 20 | 56.97 |
| Reverse primer | CTTACTGTACAGCTGAGTCTT | 21 | 54.73 | |
| SCD1 | Forward primer | TTACACTTGGGAGCCCTAT | 19 | 54.92 |
| Reverse primer | CTTTGTAGGTTCGGTGACTC | 20 | 55.82 | |
| Name | Fatty Acids | ASIP/(μg/107) | WT (μg/107) | p-Value |
|---|---|---|---|---|
| C22:2N6 | cis-13,16-Docosadienoic acid ester | 0.014838855 | 0.003033941 | 2.58062 × 10−5 |
| C20:2N6 | cis-11,14-Eicosadienoic acid ester | 0.341624903 | 0.145442912 | 3.0034 × 10−5 |
| C20:0 | Arachidate | 0.307623681 | 0.120142089 | 3.37505 × 10−5 |
| C18:2N6 | Linoleate | 7.768339337 | 5.578928386 | 7.88289 × 10−5 |
| C20:5N3 | cis-5,8,11,14,17-Eicosapentaenoic acid ester | 0.104328937 | 0.0401591 | 1.18454 × 10−4 |
| C18:3N3 | Linolenate | 0.62363992 | 0.425347349 | 1.99928 × 10−4 |
| C16:1N7 | Palmitoleate | 0.164777719 | 0.261128788 | 4.0848 × 10−4 |
| C16:0 | Palmitate | 4.350355862 | 3.616156662 | 4.52232 × 10−4 |
| C23:0 | Tricosanoate | 0.005332711 | 0.002470432 | 5.41577 × 10−4 |
| C20:3N3 | cis-11,14,17-Eicosatrienoic acid ester | 0.187933366 | 0.112294234 | 6.59976 × 10−4 |
| C21:0 | Heneicosanoate | 0.011796608 | 0.005044538 | 8.50669 × 10−4 |
| C15:0 | Pentadecanoate | 0.070234556 | 0.053131791 | 1.005741 × 10−3 |
| C18:1N9 | Oleate | 3.148316962 | 3.978008211 | 1.364646 × 10−3 |
| C18:1TN9 | Elaidate | 3.069077829 | 3.825630862 | 1.423762 × 10−3 |
| C24:0 | Tetracosanoate | 0.097692958 | 0.044705298 | 1.431508 × 10−3 |
| C20:4N6 | Arachidonate | 0.744710508 | 0.580317797 | 5.513477 × 10−3 |
| C17:0 | Heptadecanoate | 0.110713207 | 0.095970131 | 6.445856 × 10−3 |
| C22:4N6 | Docosatetraenoate | 0.107525698 | 0.07236041 | 7.025267 × 10−3 |
| C20:1N9 | cis-11-Eicosenoic acid ester | 0.297438676 | 0.347778714 | 8.552879 × 10−3 |
| C14:0 | Myristate | 0.213007746 | 0.175155542 | 9.617887 × 10−3 |
| C18:3N6 | γ-linolenate | 0.014223628 | 0.007856659 | 1.6396827 × 10−2 |
| C20:3N6 | cis-8,11,14-Eicosatrienoic acid ester | 0.525239379 | 0.414319337 | 1.6616937 × 10−2 |
| C18:0 | Stearate | 1.693107169 | 1.562829639 | 3.7789469 × 10−2 |
| C22:5N3 | Docosapentaenoate | 0.646932832 | 0.481578127 | 4.7233379 × 10−2 |
| C24:1N9 | cis-15-tetracosenoate | 0.105985694 | 0.090770742 | 4.8230263 × 10−2 |
| Gene | Log2FC | p-Value |
|---|---|---|
| FABP4 | 6.533276472 | 4.17 × 10−3 |
| HACD4 | 1.890805053 | 5.67 × 10−3 |
| ELOVL6 | 1.528882028 | 2.37 × 10−2 |
| NR4A1 | 2.351458317 | 1.91 × 10−2 |
| SLC26A2 | 2.516902391 | 2.94 × 10−4 |
| BGN | 7.414908474 | 3.28 × 10−11 |
| ACSL1 | 1.487425813 | 3.23 × 10−2 |
| RARRES2 | −8.204826354 | 5.19 × 10−6 |
| PGM2L1 | −2.243074323 | 3.13 × 10−3 |
| SCD | −1.535957561 | 2.16 × 10−2 |
| Term | Database | ID | Input Number | Background Number | p-Value | Corrected p-Value | Input |
|---|---|---|---|---|---|---|---|
| long-chain fatty-acyl-CoA biosynthetic process | Gene Ontology | GO:0035338 | 3 | 9 | 0.020237634 | 0.136990166 | ELOVL6|ACSL1|ACSL5 |
| very long-chain fatty acid biosynthetic process | Gene Ontology | GO:0042761 | 2 | 12 | 0.156216785 | 0.378399061 | ELOVL6|HACD4 |
| unsaturated fatty acid biosynthetic process | Gene Ontology | GO:0006636 | 2 | 12 | 0.156216785 | 0.378399061 | ELOVL6|SCD |
| long-chain fatty acid transport | Gene Ontology | GO:0015909 | 1 | 7 | 0.340296604 | 0.500036513 | FABP4 |
| Term | Database | ID | Input Number | Background Number | p-Value | Corrected p-Value | Input |
|---|---|---|---|---|---|---|---|
| Fatty acid metabolism | Reactome | R-BTA-8978868 | 5 | 92 | 0.176804584 | 0.403842589 | FADS1|PTGES|ALOX12B|ALOX12|ACSL5 |
| Fatty acid metabolism | KEGG PATHWAY | bta01212 | 2 | 58 | 0.552242024 | 0.626722575 | FADS1|ACSL5 |
| Fatty acid biosynthesis | KEGG PATHWAY | bta00061 | 1 | 18 | 0.446287647 | 0.549649992 | ACSL5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, T.; Liu, Y.; Lu, H.; Iqbal, A.; Ruan, M.; Jiang, P.; Yu, H.; Meng, J.; Zhao, Z. The Knockout of the ASIP Gene Altered the Lipid Composition in Bovine Mammary Epithelial Cells via the Expression of Genes in the Lipid Metabolism Pathway. Animals 2022, 12, 1389. https://doi.org/10.3390/ani12111389
Xie T, Liu Y, Lu H, Iqbal A, Ruan M, Jiang P, Yu H, Meng J, Zhao Z. The Knockout of the ASIP Gene Altered the Lipid Composition in Bovine Mammary Epithelial Cells via the Expression of Genes in the Lipid Metabolism Pathway. Animals. 2022; 12(11):1389. https://doi.org/10.3390/ani12111389
Chicago/Turabian StyleXie, Tao, Yinuo Liu, Huixian Lu, Ambreen Iqbal, Mengru Ruan, Ping Jiang, Haibin Yu, Jilun Meng, and Zhihui Zhao. 2022. "The Knockout of the ASIP Gene Altered the Lipid Composition in Bovine Mammary Epithelial Cells via the Expression of Genes in the Lipid Metabolism Pathway" Animals 12, no. 11: 1389. https://doi.org/10.3390/ani12111389
APA StyleXie, T., Liu, Y., Lu, H., Iqbal, A., Ruan, M., Jiang, P., Yu, H., Meng, J., & Zhao, Z. (2022). The Knockout of the ASIP Gene Altered the Lipid Composition in Bovine Mammary Epithelial Cells via the Expression of Genes in the Lipid Metabolism Pathway. Animals, 12(11), 1389. https://doi.org/10.3390/ani12111389

