Evaluation of the Effect of Different Dietary Lipid Sources on Dogs’ Faecal Microbial Population and Activities
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal and Diets
2.2. In Vitro Fermentation
2.3. Bacterial Cell Evaluation
2.4. Statistical Analysis
3. Results
3.1. In Vitro Fermentation
3.2. Bacterial Cell Counts
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- NRC. Nutrient Requirements of Dogs and Cats, 1st ed.; National Academy Press: Washington, DC, USA, 2001.
- Bauer, J.E. Essential fatty acid metabolism dogs and cats. Rev. Bras. Zootec. 2008, 37, 20–27. [Google Scholar] [CrossRef]
- Zentek, J.; Buchheit-Renko, S.; Ferrara, F.; Vahjen, W.; Van Kessel, A.G.; Pieper, R. Nutritional and physiological role of medium-chain triglycerides and medium-chain fatty acids in piglets. Anim. Health Res. Rev. 2011, 12, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Han, F.Y.; Conboy-Schmidt, L.; Rybachuk, G.; Volk, H.A.; Zanghi, B.; Pan, Y.; Borges, K. Dietary medium chain triglycerides for management of epilepsy: New data from human, dog, and rodent studies. Epilepsia 2021, 62, 1790–1806. [Google Scholar] [CrossRef]
- Burron, S.; Richards, T.; Patterson, K.; Grant, C.; Akhtar, N.; Trevizan, L.; Pearson, W.; Shoveller, A.K. Safety of Dietary Camelina Oil Supplementation in Healthy, Adult Dogs. Animals 2021, 11, 2603. [Google Scholar] [CrossRef] [PubMed]
- Biagi, G.; Mordenti, A.L.; Cocchi, M. The role of dietary omega-3 and omega-6 essential fatty acids in the nutrition of dogs and cats: A review. Prog. Nutr. 2004, 6, 97–107. [Google Scholar]
- Case, L.P.; Daristole, L.; Hayek, M.G.; Raasch, M.F. Canine and Feline Nutrition, 3rd ed.; Mosby Elsevier: Riverport Lane Maryland Heights, MO, USA, 2011. [Google Scholar]
- Pojić, M.; Hadnadev, T.D.; Hadnadev, M.; Rakita, S.; Brlek, T. Bread Supplementation with Hemp Seed Cake: A By-Product of Hemp Oil Processing. J. Food Qual. 2015, 38, 431–440. [Google Scholar] [CrossRef]
- Da Porto, C.; Decorti, D.; Tubaro, F. Fatty acid composition and oxidation stability of hemp (Cannabis sativa L.) seed oil extracted by supercritical carbon dioxide. Ind. Crops Prod. 2012, 36, 401–404. [Google Scholar] [CrossRef]
- Karlsson, L.; Finell, M.; Martinsson, K. Effects of increasing amounts of hempseed cake in the diet of dairy cows on the production and composition of milk. Animal 2010, 4, 1854–1860. [Google Scholar] [CrossRef]
- Mierlitặ, D. Effects of diets containing hemp seeds or hemp cake on fatty acid composition and oxidative stability of sheep milk. S. Afr. J. Anim. Sci. 2018, 48, 504–515. [Google Scholar] [CrossRef]
- Della Rocca, G.; Di Salvo, A. Hemp in veterinary medicine: From feed to drug. Front. Vet. Sci. 2020, 7, 381. [Google Scholar] [CrossRef]
- Vastolo, A.; Iliano, S.; Laperuta, F.; Pennacchio, S.; Pompameo, M.; Cutrignelli, M.I. Hemp Seed Cake as a Novel Ingredient for Dog’s Diet. Front. Vet. Sci. 2021, 8, 754625. [Google Scholar] [CrossRef] [PubMed]
- EFSA. Scientific Opinion on the safety of hemp (Cannabis genus) for use as animal feed. EFSA J. 2011, 9, 1–41. [Google Scholar] [CrossRef]
- Sandri, M.; Dal Monego, S.; Conte, G.; Sgorlon, S.; Stefanon, B. Raw meat based diet influences faecal microbiome and end products of fermentation in healthy dogs. BMC Vet. Res. 2017, 13, 65. [Google Scholar] [CrossRef] [PubMed]
- Schloissnig, S.; Arumugam, M.; Sunagawa, S.; Mitreva, M.; Tap, J.; Zhu, A.; Waller, A.; Mende, D.R.; Kultima, J.R.; Martin, J.; et al. Genomic variation landscape of the human gut microbiome. Nature 2013, 493, 45–50. [Google Scholar] [CrossRef]
- Huang, Z.; Pan, Z.; Yang, R.; Bi, Y.; Xiong, X. The canine gastrointestinal microbiota: Early studies and research frontiers. Gut Microbes 2020, 4, 635–654. [Google Scholar] [CrossRef]
- De Godoy, M.R.; Kerr, K.R.; Fahey, G.C., Jr. Alternative dietary fiber sources in companion animal nutrition. Nutrients 2013, 5, 3099–3117. [Google Scholar] [CrossRef]
- Herstad, K.M.V.; Gajardo, K.; Bakke, A.M.; Moe, L.; Ludvigsen, J.; Rudi, K.; Rud, I.; Sekelja, M.; Skancke, E. A diet change from dry food to beef induces reversible changes on the faecal microbiota in healthy, adult client-owned dogs. BMC Vet. Res. 2017, 13, 147. [Google Scholar] [CrossRef]
- Kilburn, L.R.; Koester, L.R.; Schmitz-Esser, S.; Serão, N.V.L.; Rossoni Serão, M.C. High-Fat Diets Led to OTU-Level Shifts in Fecal Samples of Healthy Adult Dogs. Front. Microbiol. 2020, 11, 564160. [Google Scholar] [CrossRef]
- FEDIAF. Nutritional Guidelines for Complete and Complementary Pet Foods for Dogs and Cats; European Pet Food Industry Federation: Bruxelles, Belgium, 2020. [Google Scholar]
- AOAC. Official Methods of Analysis, 18th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2015. [Google Scholar]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [CrossRef]
- Christie, W.W. Preparation of ester derivatives of fatty acids for chromatographic 282 analysis. In Advances in Lipid Methodology, 2nd ed.; Christie, W.W., Ed.; Oily Press: Dundee, UK, 1993; pp. 69–111. [Google Scholar]
- Oteri, M.; Gresta, F.; Costale, A.; Lo Presti, V.; Meineri, G.; Chiofalo, B. Amaranthus hypochondriacus L. as a sustainable source of nutrients and bioactive compounds for animal feeding. Antioxidants 2021, 10, 876. [Google Scholar] [CrossRef]
- Theodorou, M.K.; Williams, B.A.; Dhanoa, M.S.; McAllan, A.B.; France, J. A simple gas production method using a pressure transducer to determine the fermentation kinetics of ruminant feeds. Anim. Feed Sci. Technol. 1994, 48, 185–197. [Google Scholar] [CrossRef]
- Cutrignelli, M.I. In vitro assessments of pre- and probiotics. Compend. Contin. Educ. Vet. 2007, 29, 38. [Google Scholar]
- Calabrò, S.; Musco, N.; Roberti, F.; Vastolo, A.; Coppola, M.; Esposito, L.; Cutrignelli, M.I. Fermentability characteristics of different Saccharomyces cerevisiae cell wall using cat faeces as inoculum. Ital. J. Anim. Sci. 2020, 19, 186–193. [Google Scholar] [CrossRef]
- Groot, J.C.J.; Cone, J.W.; Williams, B.A.; Debersaques, F.M.A.; Lantinga, E.A. Multiphasic analysis of gas production kinetics for in vitro fermentation of ruminant feeds. Anim. Feed Sci. Technol. 1996, 64, 77–89. [Google Scholar] [CrossRef]
- Kröger, S.; Vahjen, W.; Zentek, J. Influence of lignocellulose and low or high levels of sugar beet pulp on nutrient digestibility and the fecal microbiota in dogs. J. Anim. Sci. 2017, 95, 1598–1605. [Google Scholar] [CrossRef]
- Rinttilä, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J. Appl. Microbiol. 2004, 97, 1166–1177. [Google Scholar] [CrossRef]
- Malinen, E.; Kassinen, A.; Rinttilä, T.; Palva, A. Comparison of real-time PCR with SYBR Green I or 5′-nuclease assays and dot-blot hybridization with rDNA-targeted oligonucleotide probes in quantification of selected fecal bacteria. Microbiology 2003, 149, 269–277. [Google Scholar] [CrossRef]
- Matsuki, T.; Watanabe, K.; Fujimoto, J.; Takada, T.; Tanaka, R. Use of 16S rRNA gene-targeted group-specific primers for real-time PCR analysis of predominant bacteria in human feces. Appl. Environ. Microbiol. 2004, 70, 7220–7228. [Google Scholar] [CrossRef]
- Cutrignelli, M.I.; Bovera, F.; Tudisco, R.; D’Urso, S.; Marono, S.; Piccolo, G.; Calabro, S. In vitro fermentation characteristics of different carbohydrate sources in two dog breeds (German shepherd and Neapolitan mastiff). J. Anim. Physiol. Anim. Nutr. 2009, 93, 305–312. [Google Scholar] [CrossRef]
- Pinna, C.; Biagi, G. The Utilisation of Prebiotics and Synbiotics in Dogs. Ital. J. Anim. Sci. 2014, 13, 3107. [Google Scholar] [CrossRef]
- Calabrò, S.; Carciofi, C.A.; Musco, N.; Tudisco, R.; Gomes, M.O.S.; Cutrignelli, M.I. Fermentation Characteristics of Several Carbohydrate Sources for Dog Diets Using the In Vitro Gas Production Technique. Ital. J. Anim. Sci. 2013, 12, e4. [Google Scholar] [CrossRef]
- Salminen, S.; Bouley, C.; Boutron-Ruault, M.C.; Cummings, J.H.; Franck, A.; Gibson, G.R.; Isolauri, E.; Moreau, M.C.; Roberfroid, M.; Rowland, I. Functional food science and gastrointestinal physiology and function. Br. J. Nutr. 1998, 80, S147–S171. [Google Scholar] [CrossRef] [PubMed]
- Williams, B.A.; Verstegen, M.W.A.; Tamminga, S. Fermentation in the large intestine of single-stomached animals and its relationship to animal health. Nutr. Res. Rev. 2001, 14, 207–227. [Google Scholar] [CrossRef] [PubMed]
- Musco, N.; Calabrò, S.; Roberti, F.; Grazioli, R.; Tudisco, R.; Lombardi, P.; Cutrignelli, M.I. In vitro evaluation of Saccharomyces cerevisiae cell wall fermentability using a dog model. J. Anim. Physiol. Anim. Nutr. 2018, 102, 24–30. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, A.; Kildegaard, K.R.; Li, M.; Borodina, I.; Nielsen, J. Establishment of a yeast platform strain for production of p-coumaric acid through metabolic engineering of aromatic amino acid biosynthesis. Metab. Eng. 2015, 31, 181–188. [Google Scholar] [CrossRef]
- Garcia-Mazcorro, J.F.; Barcenas-Walls, J.R.; Suchodolski, J.S.; Steiner, J.M. Molecular assessment of the fecal microbiota in healthy cats and dogs before and during supplementation with fructo-oligosaccharides (FOS) and inulin using high-throughput 454-pyrosequencing. PeerJ 2017, 5, e3184. [Google Scholar] [CrossRef]
- Middelbos, I.S.; Fastinger, N.D.; Fahey, G.C., Jr. Evaluation of fermentable oligosaccharides in diets fed to dogs in comparison to fiber standards. J. Anim. Sci. 2007, 85, 3033–3044. [Google Scholar] [CrossRef]
- Bonnema, A.L.; Kolberg, L.W.; Thomas, W.; Slavin, J.L. Gastrointestinal Tolerance of Chicory Inulin Products. J. Am. Diet. Assoc. 2010, 110, 865–868. [Google Scholar] [CrossRef]
- Hernot, D.C.; Boileau, T.W.; Bauer, L.L.; Middelbos, I.S.; Murphy, M.R.; Swanson, K.S.; Fahey, G.C., Jr. In Vitro Fermentation Profiles, Gas Production Rates, and Microbiota Modulation as Affected by Certain Fructans, Galactooligosaccharides, and Polydextrose. J. Agric. Food. Chem. 2009, 57, 1354–1361. [Google Scholar] [CrossRef]
- Wang, S.; Kreuzer, M.; Braun, U.; Schwarm, A. Effect of unconventional oilseeds (safflower, poppy, hemp, camelina) on in vitro ruminal methane production and fermentation. J. Sci. Food Agric. 2017, 97, 3864–3870. [Google Scholar] [CrossRef]
- Vastolo, A.; Calabrò, S.; Pacifico, S.; Koura, B.I.; Cutrignelli, M.I. Chemical and nutritional characteristics of Cannabis sativa L. co-products. J. Anim. Physiol. Anim. Nutr. 2021, 105, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Hooda, S.; Minamoto, Y.; Suchodolski, J.S.; Swanson, K.S. Current state of knowledge: The canine gastrointestinal microbiome. Anim. Health Res. Rev. 2012, 13, 78–88. [Google Scholar] [CrossRef] [PubMed]
- Swann, J.R.; Want, E.J.; Geier, F.M.; Spagou, K.; Wilson, I.D.; Sidaway, J.E.; Nicholson, J.K.; Holmes, E. Systemic gut microbial modulation of bile acid metabolism in host tissue compartments. Proc. Natl. Acad. Sci. USA 2011, 108, 4523–4530. [Google Scholar] [CrossRef]
- Murphy, A.E.; Velazquez, K.T.; Herbert, K.M. Influence of high-fatdiet on gut microbiota: A driving force for chronic disease risk. Curr. Opin. Clin. Nutr. Metab. Care 2015, 18, 515–520. [Google Scholar] [CrossRef]
- Jia, J.; Frantz, N.; Khoo, C.; Gibson, G.R.; Rastall, R.A.; McCartney, A.L. Investigation of the faecal microbiota associated with canine chronic diarrhoea. FEMS Microbiol. Ecol. 2010, 71, 304–312. [Google Scholar] [CrossRef]
- Walter, J. Ecological role of lactobacilli in the gastrointestinal tract: Implications for fundamental and biomedical research. Appl. Environ. Microbiol. 2008, 74, 4985–4996. [Google Scholar] [CrossRef] [PubMed]
- Salas-Mani, A.; Jeusette, I.; Castillo, I.; Manuelian, C.L.; Lionnet, C.; Iraculis, N.; Sanchez, N.; Fernández, S.; Vilaseca, L.; Torre, C. Fecal microbiota composition changes after a BW loss diet in Beagle dogs. J. Anim. Sci. 2018, 96, 3102–3111. [Google Scholar] [CrossRef] [PubMed]
- Coelho, L.P.; Kultima, J.R.; Costea, P.I.; Fournier, C.; Pan, Y.; Czarnecki-Maulden, G.; Hayward, M.R.; Forslund, S.K.; Schmidt, T.S.B.; Descombes, P.; et al. Similarity of the dog and human gut microbiomes in gene content and response to diet. Microbiome 2018, 6, 72. [Google Scholar] [CrossRef]
- Kumar, R.; Grover, S.; Kumar Batish, V. Bile Salt Hydrolase (Bsh) Activity Screening of Lactobacilli: In Vitro Selection of Indigenous Lactobacillus Strains with Potential Bile Salt Hydrolysing and Cholesterol-Lowering Ability. Probiotics Antimicrob. Proteins 2012, 4, 162–172. [Google Scholar] [CrossRef]
- Heimann, E.; Nyman, M.; Pålbrink, A.; Karin Lindkvist-Petersson, K.L.; Degerman, E. Branched short-chain fatty acids modulate glucose and lipid metabolism in primary adipocytes. Adipocyte 2016, 5, 359–368. [Google Scholar] [CrossRef]
- Shen, W.; Gaskins, H.R.; Mcintosh, M.K. Influence of dietary fat on intestinal microbies, inflammation, barrier function and metabolic outcomes. J. Nutr. Biochem. 2014, 25, 270–280. [Google Scholar] [CrossRef] [PubMed]
- Paßlack, N.; Kohn, B.; Vahjen, W.; Zentek, J. Effects of dietary cellobiose on the intestinal microbiota and excretion of nitrogen metabolites in healthy adult dogs. J. Anim. Physiol. Anim. Nutr. 2021, 105, 569–578. [Google Scholar] [CrossRef] [PubMed]
- Deabold, K.A.; Schwark, W.S.; Wolf, L.; Wakshlag, J.J. Single-Dose Pharmacokinetics and Preliminary Safety Assessment with Use of CBD-Rich Hemp Nutraceutical in Healthy Dogs and Cats. Animals 2019, 9, 832. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Matute, A.I.; Brokl, M.; Sanz, M.L.; Soria, A.C.; Côté, G.L.; Collins, M.E.; Rastall, R.A. Effect of dextransucrase cellobiose acceptor products on the growth of human gut bacteria. J. Agric. Food Chem. 2011, 59, 3693–3700. [Google Scholar] [CrossRef]
- Lloyd-Price, J.; Mahurkar, A.; Rahnavard, G.; Crabtree, J.; Orvis, J.; Hall, A.B.; Brady, A.; Creasy, H.H.; Mccracken, C.; Giglio, M.G.; et al. Strains, functions and dynamics in the expanded human microbiome project. Nature 2017, 550, 61–66. [Google Scholar] [CrossRef]
| Diets | HS | HL1 | HL2 |
|---|---|---|---|
| ME (kcal/kg) | 1194 | 1286 | 1370 |
| CP | 74.3 | 89.6 | 77.0 |
| CF | 9.29 | 27.4 | 21.8 |
| EE | 30.9 | 55.1 | 65.1 |
| Ash | 27.9 | 28.8 | 23.0 |
| NFE | 136 | 62.2 | 50.7 |
| Fatty Acids | HS | HL1 | HL2 |
|---|---|---|---|
| C4:0 | 1.72 | 4.35 | 4.18 |
| C6:0 | 0.37 | 3.86 | 3.21 |
| C8:0 | 0.02 | 0.24 | 0.08 |
| C10:0 | 0.04 | ND | 0.08 |
| C12:0 | 0.22 | ND | 0.26 |
| C14:0 | 1.05 | 1.29 | 3.51 |
| C16:0 | 11.4 | 28.8 | 47.0 |
| C16:1 | ND | 0.35 | 0.32 |
| C18:1 cis6 | 0.12 | 0.14 | 0.50 |
| C18:0 | 4.60 | 25.0 | 31.3 |
| C18:1 trans 11 (TVA) | 0.51 | 3.09 | 2.45 |
| C18:1 cis 9 | 19.0 | 46.3 | 71.1 |
| C18:1 cis 10 | 0.08 | 0.62 | 0.57 |
| C18:1 cis 11 | 0.008 | 0.02 | 0.04 |
| C18:2 cis n-6 (LA) | 9.82 | 34.0 | 19.8 |
| C20:0 | 0.08 | 0.61 | 0.37 |
| C18:3 n-6 | 0.02 | 0.37 | 0.96 |
| C18:3 n-3 (ALA) | 0.95 | 5.75 | 2.59 |
| C20:2 n-6 | 0.05 | 0.24 | 0.63 |
| C22:0 | 0.14 | 0.26 | 2.23 |
| C20:3 n-6 | 0.03 | 0.06 | 0.07 |
| C22:1 | 0.02 | ND | 0.18 |
| C20:3 n-3 | 0.11 | 0.99 | 0.45 |
| C20:4 n-6 (AA) | 0.15 | 0.20 | 0.35 |
| C22:2 n-6 | 0.19 | 0.13 | 0.58 |
| C24:0 | 0.03 | 0.09 | 0.18 |
| C20:5 n-3 (EPA) | 0.008 | 0.29 | 0.09 |
| SFA | 38.8 | 173 | 103 |
| MCT | 2.37 | 8.45 | 7.81 |
| MUFA | 20.2 | 81.1 | 48.7 |
| PUFA | 11.3 | 27.2 | 17.7 |
| n-6 | 10.3 | 23.9 | 15.7 |
| n-3 | 1.07 | 3.33 | 2.03 |
| PUFA/SFA | 0.29 | 0.16 | 0.17 |
| n-6/n-3 | 9.58 | 7.17 | 7.73 |
| LA/ALA | 10.3 | 5.93 | 7.65 |
| AA/EPA | 18.0 | 0.70 | 4.00 |
| Specificity | Sequence | Name | Product. bp | AT 1 | Reference |
|---|---|---|---|---|---|
| Lactobacillus spp. | F:5′-AGCAGTAGGGAATCTTCCA-3′ R: 5′-CACCGCTACACATGGAG-3′ | LAC-1 LAC-2 | 341 | 58 | Rinttilä et al. [31] |
| Enterobacteria | F:5′-GTTAATACCTTTGCTCATTGA-3 R:5′-ACCAGGGTATCTAATCCTGTT-3′ | Entero-F Entero-R | 340 | 50 | Malinen et al. [32] |
| Bifidobacterium spp. | F:5′-TCGCGTC(C/T)GGTGTGAAAG-3′ R:5′-CCACATCCAGC(A/G)TCCAC-3′ | g-BIFID-F g-BIFID-R | 243 | 58 | Rinttilä et al. [31] |
| Clostridium coccoides cluster (Cluster XIVa) | AAATGACGGTACCTGACTAA CTTTGAGTTTCATTCTTGCGAA | g-Cocc-F g-Cocc-R | 440 | 55 | Matsuki et al. [33] |
| Clostridium leptum cluster (Cluster IV) | GCACAAGCAGTGGAGT CTTCCTCCGTTTTGTCAA | sg-Clept-F sg-Clept-R | 239 | 55 | Matsuki et al. [33] |
| Items | OMD | OMCV |
|---|---|---|
| % | mL/g | |
| Inoculum effect | ||
| HS-group | 57.2 B | 51.1 A |
| HL1-group | 60.1 A | 40.8 B |
| HL2-group | 58.6 B | 58.2 A |
| Substrate effect | ||
| MOS | 97.5 A | 24.8 B |
| Inulin | 76.4 B | 114 A |
| Cellulose | 2.02 C | 10.8 C |
| Inoculum x Substrate | ||
| *** | *** | |
| MSE | 1.64 | 46.1 |
| Items | pH | VFA | Acetate | Propionate | Iso-Butyrate | Butyrate | Iso-Valerate | Valerate | BCFA |
|---|---|---|---|---|---|---|---|---|---|
| mmol/gOM | % VFA | ||||||||
| Inoculum effect | |||||||||
| HS-group | 6.27 | 53.4 B | 45.6 C | 23.9 A | 3.45 | 19.6 A | 5.08 A | 1.87 B | 8.53 a |
| HL1-group | 6.18 | 43.2 C | 53.2 A | 22.6 B | 3.06 | 16.2 B | 4.81 A | 0.91 C | 7.88 ab |
| HL2-group | 6.26 | 72.3 A | 50.2 B | 16.8 C | 3.19 | 19.3 A | 4.15 B | 2.27 A | 7.34 b |
| Substrate effect | |||||||||
| MOS | 6.42 B | 65.6 B | 49.9 B | 21.4 B | 3.11 B | 19.4 B | 4.51 B | 1.75 B | 7.62 B |
| Inulin | 5.45 C | 74.7 A | 43.9 C | 26.1 A | 1.04 C | 22.9 A | 1.47 C | 0.62 C | 2.51 C |
| Cellulose | 6.83 A | 28.5 C | 55.2 A | 16.7 C | 5.55 A | 12.9 C | 8.07 A | 2.69 A | 13.6 A |
| Inoculum x Substrate | |||||||||
| NS | *** | *** | *** | NS | *** | *** | *** | *** | |
| MSE | 0.08 | 12.4 | 4.47 | 1.17 | 0.22 | 5.60 | 0.33 | 0.07 | 0.96 |
| Bacteria Cell Count | HS | HL1 | HL2 | p-Value | |
|---|---|---|---|---|---|
| Between Diets | HL1 vs. HL2 | ||||
| Lactobacillus spp. | 6.86 ± 0.22 | 7.11 ± 0.05 | 6.55 ± 0.14 | 0.0429 | 0.0142 |
| Bifidobacterium spp. | 2.54 ± 0.29 | 2.60 ± 0.21 | 2.20 ± 0.11 | 0.6376 | 0.2008 |
| Enterobacteria | 6.01 ± 0.22 | 6.91 ± 0.10 | 6.66 ± 0.13 | 0.0131 | 0.1594 |
| Cl. coccoides cluster XIVa | 9.95 ± 0.03 | 9.86 ± 0.04 | 9.77 ± 0.05 | 0.0203 | 0.1821 |
| Cl. leptum cluster IV | 8.53 ± 0.09 | 8.05 ± 0.22 | 8.57 ± 0.10 | 0.1874 | 0.1408 |
| Items | Units | HS | HL1 | HL2 | p-Value | |
|---|---|---|---|---|---|---|
| Between Diets | HL1 vs. HL2 | |||||
| VFA (mmol/g) | 163 ± 6.52 | 87.2 ± 2.98 | 134 ± 9.97 | 0.0024 | 0.0105 | |
| acetate | % VFA | 60.6 ± 0.40 | 61.4 ± 0.82 | 58.7 ± 0.53 | 0.0221 | 0.0209 |
| propionate | % VFA | 28.2 ± 0.42 | 25.9 ± 0.45 | 23.1 ± 0.50 | 0.0001 | 0.0033 |
| iso-butyrate | % VFA | 1.03 ± 0.07 | 1.31 ± 0.12 | 2.34 ± 0.06 | 0.0003 | 0.0008 |
| butyrate | % VFA | 8.11 ± 0.28 | 10.5 ± 0.43 | 9.40 ± 0.44 | 0.0035 | 0.0633 |
| iso-valerate | % VFA | 1.40 ± 0.08 | 1.21 ± 0.07 | 3.45 ± 0.14 | 0.0003 | 0.0008 |
| valerate | % VFA | 0.36 ± 0.02 | 0.30 ± 0.02 | 2.94 ± 0.11 | 0.0004 | 0.0012 |
| BCFA | % VFA | 2.07 ± 0.25 | 2.87 ± 0.36 | 5.51 ± 0.31 | 0.0003 | 0.0011 |
| Items | HS | HL1 | HL2 | p-Value | |
|---|---|---|---|---|---|
| Between Diets | HL1 vs. HL2 | ||||
| D-lactate (µL/g) | 1.67 ± 0.58 | 0.25 ± 0.03 | 0.43 ± 0.14 | 0.0138 | 0.6242 |
| L-lactate (µL/g) | 1.77 ± 0.82 | 0.22 ± 0.06 | 0.25 ± 0.14 | 0.0468 | 0.6473 |
| Ammonia (µmol/g) | 59.9 ± 4.80 | 42.7 ± 2.24 | 59.3 ± 5.46 | 0.0255 | 0.0472 |
| pH | 6.75 ± 0.06 | 6.97 ± 0.04 | 7.11 ± 0.03 | 0.0008 | 0.0273 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vastolo, A.; Riedmüller, J.; Cutrignelli, M.I.; Zentek, J. Evaluation of the Effect of Different Dietary Lipid Sources on Dogs’ Faecal Microbial Population and Activities. Animals 2022, 12, 1368. https://doi.org/10.3390/ani12111368
Vastolo A, Riedmüller J, Cutrignelli MI, Zentek J. Evaluation of the Effect of Different Dietary Lipid Sources on Dogs’ Faecal Microbial Population and Activities. Animals. 2022; 12(11):1368. https://doi.org/10.3390/ani12111368
Chicago/Turabian StyleVastolo, Alessandro, Jonathan Riedmüller, Monica Isabella Cutrignelli, and Jürgen Zentek. 2022. "Evaluation of the Effect of Different Dietary Lipid Sources on Dogs’ Faecal Microbial Population and Activities" Animals 12, no. 11: 1368. https://doi.org/10.3390/ani12111368
APA StyleVastolo, A., Riedmüller, J., Cutrignelli, M. I., & Zentek, J. (2022). Evaluation of the Effect of Different Dietary Lipid Sources on Dogs’ Faecal Microbial Population and Activities. Animals, 12(11), 1368. https://doi.org/10.3390/ani12111368

