Effects of Yeast Culture Supplementation on Growth Performance, Nutrient Digestibility, Blood Metabolites, and Immune Response in Geese
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Diets, and Experimental Design
2.2. Sampling and Analyses
2.2.1. Growth Performance
2.2.2. Nutrient Digestibility
2.2.3. Serum Metabolites
2.2.4. Immune Factors
2.2.5. Immune Genes
2.3. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Nutrient Digestibility
3.3. Serum Metabolites
3.4. Immune Factors
3.5. Immune Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baquero, F.; Martínez, J.L.; Cantón, R. Antibiotics and antibiotic resistance in water environments. Curr. Opin. Biotechnol. 2008, 19, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.Y.; Chen, S.W.; Wang, H.T. Effect of supplementation of yeast with bacteriocin and Lactobacillus culture on growth performance, cecal fermentation, microbiota composition, and blood characteristics in broiler chickens. Asian-Australas. J. Anim. Sci. 2017, 30, 211–220. [Google Scholar] [CrossRef] [PubMed]
- Van der Peet-Schwering, C.M.C.; Jansman, A.J.M.; Smidt, H.; Yoon, I. Effects of yeast culture on performance, gut integrity, and blood cell composition of weanling pigs. J. Anim. Sci. 2007, 85, 3099–3109. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Zhang, H.J.; Yu, S.H.; Wu, S.G.; Yoon, I.; Quigley, J.; Gao, P.Y.; Qi, G.H. Effects of yeast culture in broiler diets on performance and immunomodulatory functions. Poult Sci. 2008, 87, 1377–1384. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.L.; Harris, A.D.; Johnson, J.A.; Silbergeld, E.K.; Glenn, M. Animal antibiotic use has an early but important impact on the emergence of antibiotic resistance in human commensal bacteria. Proc. Natl. Acad. Sci. USA 2002, 99, 6434–6439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bach, K.K.E. Development of antibiotic resistance and options to replace antimicrobials in animal diets. Proc. Nutr. Soc. 2001, 60, 291–299. [Google Scholar]
- Liu, H.; Li, J.; Guo, X.; Liang, Y.; Wang, W. Yeast culture dietary supplementation modulates gut microbiota, growth and biochemical parameters of grass carp. Microb. Biotechnol. 2018, 11, 551–565. [Google Scholar] [CrossRef]
- Shen, Y.B.; Piao, X.S.; Kim, S.W.; Wang, L.; Liu, P.; Yoon, I.; Zhen, Y.G. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J. Anim. Sci. 2009, 87, 2614–2624. [Google Scholar] [CrossRef]
- Yalçin, S.; Özsoy, B.; Erol, H.; Yalçin, S. Yeast culture supplementation to laying hen diets containing soybean meal or sunflower seed meal and its effect on performance, egg quality traits, and blood chemistry. J. Appl. Poult. Res. 2008, 17, 229–236. [Google Scholar] [CrossRef]
- Dias, A.L.G.; Freitas, J.A.; Micai, B.; Azevedo, R.A.; Greco, L.F.; Jep, S. Effect of supplemental yeast culture and dietary starch content on rumen fermentation and digestion in dairy cows. J. Dairy Sci. 2017, 101, 201–221. [Google Scholar] [CrossRef]
- Dias, A.L.G.; Freitas, J.A.; Micai, B.; Azevedo, R.A.; Greco, L.F.; Santos, J.E.P. Effects of supplementing yeast culture to diets differing in starch content on performance and feeding behavior of dairy cows. J. Dairy Sci. 2017, 101, 186–200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salvati, G.G.S.; Júnior, N.N.M.; Melo, A.C.S.; Vilela, R.R.; Cardoso, F.F.; Aronovich, M.; Pereira, R.A.N.; Pereira, M.N. Response of lactating cows to live yeast supplementation during summer. J. Dairy Sci. 2015, 98, 4062–4073. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dias, J.D.L.; Silva, R.B.; Fernandes, T.; Barbosa, E.F.; Graças, L.E.C.; Araujo, R.C.; Pereira, R.A.N.; Pereira, M.N. Yeast culture increased plasma niacin concentration, evaporative heat loss, and feed efficiency of dairy cows in a hot environment. J. Dairy Sci. 2018, 101, 5924–5936. [Google Scholar] [CrossRef] [PubMed]
- Salinaschavira, J.; Montano, M.F.; Torrentera, N.; Zinn, R.A. Influence of feeding enzymatically hydrolysed yeast cell wall + yeast culture on growth performance of calf-fed Holstein steers. J. Appl. Anim. Res. 2017, 2, 327–330. [Google Scholar]
- Hhansen, H.; Eel-Bordeny, N.; Mebeid, H. Response of primiparous and multiparous buffaloes to yeast culture supplementation during early and mid-lactation. Anim. Nutr. 2017, 3, 411–418. [Google Scholar] [CrossRef]
- Galıp, N. Effect of supplemental yeast culture and sodium bicarbonate on ruminal fermentation and blood variables in rams. J Anim. Physiol. Anim. Nutr. 2010, 90, 446–452. [Google Scholar] [CrossRef]
- Reis, L.F.; Sousa, R.S.; Oliveira, F.L.C.; Barrêto-Júnior, R.A.; Mori, C.S.; Minervino, A.H.H.; Ortolani, E.L. Comparative assessment of probiotics and monensin in the prophylaxis of acute ruminal lactic acidosis in sheep. BMC Vet. Res. 2018, 14, 9. [Google Scholar] [CrossRef] [Green Version]
- Murray, J.A.M.D.; Brown, S.; O’Shaughnessy, P.; Monteiro, A.; Warren, H.; Hastie, P.M. Effect of live yeast culture supplementation on fibrolytic and saccharolytic bacterial populations in the feces of horses fed a high-fiber or high-starch diet. J. Equine Vet. Sci. 2017, 51, 41–45. [Google Scholar] [CrossRef] [Green Version]
- Jouany, J.P.M.B.; Bertin, G.; Julliand, V. Effect of live yeast culture supplementation on hindgut microbial communities and their polysaccharidase and glycoside hydrolase activities in horses fed a high-fiber or high-starch diet. J. Anim. Sci. 2009, 87, 2844–2852. [Google Scholar] [CrossRef] [Green Version]
- Berto, R.D.S.; Pereira, G.D.V.; Mouriño, J.L.P.; Martins, M.L.; Fracalossi, D.M. Yeast extract on growth, nutrient utilization and haemato-immunological responses of Nile tilapia. Aquacult. Res. 2016, 47, 2650–2660. [Google Scholar] [CrossRef]
- Gao, G.; Zhao, X.; Li, Q.; He, C.; Zhao, W.; Liu, S.; Ding, J.; Ye, W.; Wang, J.; Chen, Y.; et al. Genome and metagenome analyses reveal adaptive evolution of the host and interaction with the gut microbiota in the goose. Sci. Rep. 2016, 6, 32961. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, H.; Xiao, Y.; Gui, G.; Li, J.; Wang, J.; Li, D. Microbial community and short-chain fatty acid profile in gastrointestinal tract of goose. Poult. Sci. 2018, 97, 1420–1428. [Google Scholar] [CrossRef] [PubMed]
- National Academy Press (NRC). Nutrient Requirements of Poultry; National Academy Press: Washington, DC, USA, 1994. [Google Scholar]
- Yildiz, A.; Parlat, S.S.; Yildirim, I. Effect of dietary addition of live yeast (Saccharomyces cerevisiae) on some performance parameters of adult Japanese quail (Coturnix coturnix japonica) induced by aflatoxicosis. Rev. Med. Vet. 2004, 155, 38–41. [Google Scholar]
- Tangendjaja, B.; Yoon, I. Effect of yeast culture on egg production and mortality in layer chickens. In Proceedings of the Poultry Science Association 91st Annual Meeting Abstracts, Newark, DE, USA, 11–14 August 2002; p. 89. [Google Scholar]
- Fathi, M.M.; Al-Mansour, S.; Al-Homidan, A.; Al-Khalaf, A.; Al-Damegh, M. Effect of yeast culture supplementation on carcass yield and humoral immune response of broiler chicks. Vet. World. 2012, 5, 651–657. [Google Scholar] [CrossRef]
- Barnes, M.; Durben, D.; Reeves, S.; Sanders, R. Dietary yeast culture supplementation improves initial rearing of McConaughy strain rainbow trout. Aquacult. Nutr. 2006, 12, 388–394. [Google Scholar] [CrossRef]
- Liu, Z.; Qi, G.; Yoon, I. Effect of yeast culture on production parameters and intestinal microflora in laying hens. In Proceedings of the Poultry Science Association 91st Annual Meeting Abstracts, Newark, DE, USA, 11–14 August 2002; p. 89. [Google Scholar]
- Finck, D.; Parr, S.; Young, T.; Carroll, J.; Corley, J.; Estefan, A.; Johnson, B. Interactive effects of yeast and yeast cell wall material on feedlot performance during the receiving period of stressed beef cattle. J. Anim. Sci. 2010, 88, 383. [Google Scholar]
- Lei, C.; Dong, G.; Jin, L.; Zhang, S.; Zhou, J. Effects of dietary supplementation of montmorillonite and yeast cell wall on lipopolysaccharide adsorption, nutrient digestibility and growth performance in beef cattle. Livest. Sci. 2013, 158, 57–63. [Google Scholar] [CrossRef]
- Nde, F.F.; Verla, N.I.; Michael, C.; Ahmed, M.A. Effect of Celmanax on feed intake, live weight gain and nematode control in growing sheep. Afr. J. Agric. Res. 2014, 9, 695–700. [Google Scholar]
- Shin, Y.; Kim, J.; Whang, K. Effect of supplemental mixed yeast culture and antibiotics on growth performance of weaned pigs. J. Dairy Sci. 2005, 88, 34–35. [Google Scholar]
- Desnoyers, M.; Giger-Reverdin, S.; Bertin, G.; Duvaux-Ponter, C.; Sauvant, D. Meta-analysis of the influence of Saccharomyces cerevisiae supplementation on ruminal parameters and milk production of ruminants. J. Dairy Sci. 2009, 92, 1620–1632. [Google Scholar] [CrossRef]
- Jiang, Y.; Ogunade, I.; Qi, S.; Hackmann, T.; Staples, C.; Adesogan, A. Effects of the dose and viability of Saccharomyces cerevisiae. 1. Diversity of ruminal microbes as analyzed by Illumina MiSeq sequencing and quantitative PCR. J. Dairy Sci. 2017, 100, 325–342. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jurgens, M. Performance of Weaning Pigs Fed Diets Containing Yeast Culture and/or an Antibiotic; Research Investment Report; The National Pork Producers Council: Des Moines, IA, USA, 1995; pp. 417–422. [Google Scholar]
- Kornegay, E.; Rhein-Welker, D.; Lindemann, M.; Wood, C. Performance and nutrient digestibility in weanling pigs as influenced by yeast culture additions to starter diets containing dried whey or one of two fiber sources. J. Anim. Sci. 1995, 73, 1381–1389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bradley, G.L.; Savage, T.F. The effect of autoclaving a yeast culture of Saccharomyces cerevisiae on turkey poult performance and the retention of gross energy, and selected minerals. Anim. Feed Sci. Technol. 1995, 55, 1–7. [Google Scholar] [CrossRef]
- Ohta, A.; Ohtsuki, M.; Baba, S.; Adachi, T.; Sakata, T.; Sakaguchi, E. Calcium and magnesium absorption from the colon and rectum are increased in rats fed fructooligosaccharides. J. Nutr. 1995, 125, 2417–2424. [Google Scholar] [CrossRef] [PubMed]
- Chaucheyras-Durand, F.; Walker, N.; Bach, A. Effects of active dry yeasts on the rumen microbial ecosystem: Past, present and future. Anim. Feed Sci. Technol. 2008, 145, 5–26. [Google Scholar] [CrossRef]
- Montagne, L.; Pluske, J.; Hampson, D. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive health in young non-ruminant animals. Anim. Feed Sci. Technol. 2003, 108, 95–117. [Google Scholar] [CrossRef]
- Warner, A. Rate of passage of digesta through the gut of mammals and birds. Nutr. Abstr. Rev. 1981, 51, 789–820. [Google Scholar]
- Ametaj, B.; Emmanuel, D.; Zebeli, Q.; Dunn, S. Feeding high proportions of barley grain in a total mixed ration perturbs diurnal patterns of plasma metabolites in lactating dairy cows. J. Dairy Sci. 2009, 92, 1084–1091. [Google Scholar] [CrossRef]
- Helal, F.; Abdel-Rahman, K. Productive performance of lactating ewes fed diets supplementing with dry yeast and/or bentonite as feed additives. World J. Agric. Sci. 2010, 6, 489–498. [Google Scholar]
- Bagheri, M.; Ghorbani, G.; Rahmani, H.; Khorvash, M.; Nili, N. Effect of live yeast and mannan-oligosaccharides on performance of early-lactation Holstein dairy cows. Asian-Austral. J. Anim. Sci. 2009, 22, 812–818. [Google Scholar] [CrossRef]
- Özsoy, B.; Yalçın, S.; Erdoğan, Z.; Cantekin, Z.; Aksu, T. Effects of dietary live yeast culture on fattening performance on some blood and rumen fluid parameters in goats. Revue. Méd. Vét. 2013, 164, 263–271. [Google Scholar]
- Nursoy, H.; Baytok, E. The effects of baker’s yeast (Saccharomyces cerevisiae) in dairy cow diets on milk yield, some rumen fluid parameters and blood metabolites of dairy cow diets. Turk. J. Vet. Anim. Sci. 2003, 27, 7–13. [Google Scholar]
- Onifade, A.; Obiyan, R.; Onipede, E.; Adejumo, D.; Abu, O.; Babatunde, G. Assessment of the effects of supplementing rabbit diets with a culture of Saccharomyces cerevisiae using growth performance, blood composition and clinical enzyme activities. Anim. Feed Sci. Technol. 1999, 77, 25–32. [Google Scholar] [CrossRef]
- Mansoub, N.H. Effect of probiotic bacteria utilization on serum cholesterol and triglycerides contents and performance of broiler chickens. Global Vet. 2010, 5, 184–186. [Google Scholar]
- Jin, L.; Ho, Y.; Ali, M.; Abdullah, N.; Jalaludin, S. Effect of adherent Lactobacillus spp. on in vitro adherence of salmonellae to the intestinal epithelial cells of chicken. J. Appl. Bacteriol. 1996, 81, 201–206. [Google Scholar] [CrossRef]
- Kalavathy, R.; Abdullah, N.; Jalaludin, S.; Ho, Y. Effects of Lactobacillus cultures on growth performance, abdominal fat deposition, serum lipids and weight of organs of broiler chickens. Br. Poult. Sci. 2003, 44, 139–144. [Google Scholar] [CrossRef]
- Karimi Torshizi, M.; Moghaddam, A.; Rahimi, S.; Mojgani, N. Assessing the effect of administering probiotics in water or as a feed supplement on broiler performance and immune response. Br. Poult. Sci. 2010, 51, 178–184. [Google Scholar] [CrossRef]
- Alkhalf, A.; Alhaj, M.; Al-Homidan, I. Influence of probiotic supplementation on blood parameters and growth performance in broiler chickens. Saudi J. Biol. Sci. 2010, 17, 219–225. [Google Scholar] [CrossRef] [Green Version]
- Possemiers, S.; Pinheiro, I.; Verhelst, A.; Van den Abbeele, P.; Maignien, L.; Laukens, D.; Reeves, S.G.; Robinson, L.E.; Raas, T.; Schneider, Y.J.; et al. A dried yeast fermentate selectively modulates both the luminal and mucosal gut microbiota and protects against inflammation, as studied in an integrated in vitro approach. J. Agric. Food Chem. 2013, 61, 9380–9392. [Google Scholar] [CrossRef]
- Zaworski, E.; Shriver-Munsch, C.; Fadden, N.; Sanchez, W.; Yoon, I.; Bobe, G. Effects of feeding various dosages of Saccharomyces cerevisiae fermentation product in transition dairy cows. J. Dairy Sci. 2014, 97, 3081–3098. [Google Scholar] [CrossRef] [Green Version]
- Jensen, G.; Patterson, K.; Yoon, I. Yeast culture has anti-inflammatory effects and specifically activates NK cells. Com. Immunol. Microb. 2008, 31, 487–500. [Google Scholar] [CrossRef] [PubMed]
- Edens, F.; Parkhurst, C.; Casas, I.; Dobrogosz, W. Principles of ex ovo competitive exclusion and in ovo administration of Lactobacillus reuteri. Poult. Sci. 1997, 76, 179–196. [Google Scholar] [CrossRef] [PubMed]
- Van Heugten, E.; Funderburke, D.; Dorton, K. Growth performance, nutrient digestibility, and fecal microflora in weanling pigs fed live yeast. J. Anim. Sci. 2003, 81, 1004–1012. [Google Scholar] [CrossRef] [PubMed]
- Dong, C.; Wang, J. Immunostimulatory effects of dietary fructooligosaccharides on red swamp crayfish, Procambarus clarkii (Girard). Aquacult. Res. 2013, 44, 1416–1424. [Google Scholar] [CrossRef]
- Zhen, Y.G.; Zhao, W.; Chen, X.; Li, L.J.; Lee, H.G.; Zhang, X.F.; Wang, T. Effects of yeast culture on broiler growth performance, nutrient digestibility and caecal microbiota. S. Afr. J. Anim. Sci. 2019, 49, 99–108. [Google Scholar] [CrossRef]

| Ingredients (%) | Starter (Days 1–28) | Grower (Days 29–70) |
|---|---|---|
| Corn | 63.80 | 53.60 |
| Wheat bran | 2.99 | 14.50 |
| Soybean meal | 20.00 | 11.50 |
| Rapeseed meal | 4.00 | / |
| Rice bran | / | 13.40 |
| Silkworm chrysalis | 4.30 | 1.79 |
| CaHPO4 | 1.59 | 0.90 |
| Limestone | 0.87 | 0.75 |
| L-Lysine (98.5%) | 0.15 | 0.18 |
| DL-Methionine | 0.05 | 0.07 |
| Salt (NaCl) | 0.20 | 0.20 |
| Choline chloride | 0.05 | 0.12 |
| Premix 1 | 2.00 | 2.00 |
| Sand | / | 1.00 |
| Total | 100 | 100 |
| Nutrient content | ||
| Metabolizable energy (MJ·kg−1) 2 | 11.97 | 11.21 |
| Crude protein (%) | 20.43 | 14.81 |
| Crude fiber (%) | 4.12 | 8.04 |
| Calcium (%) | 0.87 | 0.80 |
| Available P (%) 2 | 0.43 | 0.40 |
| Lysine (%) | 1.14 | 0.85 |
| Methionine (%) | 0.36 | 0.30 |
| Gene Name 1 | Primer Sequences (5′→3′) | Product Size (bp) | GenBank No. |
|---|---|---|---|
| IFN-γ | F: ACATCAAAAACCTGTCTGAGCAGC | 94 | AF087134 |
| R: AGGTTTGACAGGTCCACGAGG | |||
| IL-2 | F: AATACTAGCACAGAGACAACCAG | 768 | AF294323 |
| R: TTACTGAAATTTATTAAATATCATCTA | |||
| TNF-α | F: GAATGAACCCTCCTCCG | 139 | EU375296 |
| R: ATCTGGTTACAGGAAGG | |||
| β-actin | F: CAACGAGCGGTTCAGGTGT | 92 | M26111 |
| R: TGGAGTTGAAGGTGGTCTCGT |
| Item | Yeast Culture Supplementation (% of Diet) | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| Control | 0.5% | 1.0% | 2.0% | 4.0% | L | Q | ||
| Mortality (goose) | 0 | 1 | 1 | 0 | 1 | 0.26 | / | / |
| BW (g/goose) | ||||||||
| d 1 | 94.50 | 96.33 | 94.42 | 95.63 | 96.67 | 1.60 | 0.24 | 0.57 |
| d 28 | 1001 a | 1090 b | 1184 c | 1172 d | 1000 a | 2.32 | 0.78 | 0.06 |
| d 70 | 2868 a | 3025 b | 3027 b | 3474 c | 3063 b | 46.82 | 0.52 | 0.21 |
| ADG (g/goose) | ||||||||
| d 1 to 28 | 32.39 a | 35.48 b | 38.93 c | 38.43 c | 32.27 a | 0.11 | 0.77 | 0.06 |
| d 29 to 70 | 44.44 a | 46.07 ab | 45.86 a | 54.82 c | 49.12 b | 1.14 | 0.33 | 0.29 |
| d 1 to 70 | 39.62 a | 41.83 b | 41.89 b | 48.26 c | 42.38 b | 0.66 | 0.52 | 0.21 |
| ADFI (g/goose) | ||||||||
| d 1 to 28 | 52.10 | 51.51 | 51.92 | 51.72 | 51.60 | 0.58 | 0.39 | 0.72 |
| d 29 to 70 | 227.4 a | 226.0 a | 226.2 a | 221.2 b | 227.5 a | 1.14 | 0.94 | 0.27 |
| d 1 to 70 | 157.3 a | 156.2 a | 156.5 a | 148.0 b | 157.2 a | 0.87 | 0.83 | 0.37 |
| FCR | ||||||||
| d 1 to 28 | 1.61 a | 1.45 b | 1.33 c | 1.35 c | 1.60 a | 0.02 | 0.78 | 0.06 |
| d 29 to 70 | 5.12 a | 4.92 ab | 4.93 ab | 3.87 c | 4.63 b | 0.12 | 0.39 | 0.29 |
| d 1 to 70 | 3.97 a | 3.74 b | 3.74 b | 3.07 c | 3.71 b | 0.07 | 0.56 | 0.22 |
| Digestibility (%) | Yeast Culture Supplementation (% of Diet) | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| Control | 0.5% | 1.0% | 2.0% | 4.0% | L | Q | ||
| Ca | ||||||||
| d 23 to 27 | 30.25 | 30.55 | 31.06 | 30.35 | 29.05 | 2.59 | 0.12 | 0.09 |
| d 64 to 68 | 18.04 a | 16.62 ab | 18.18 a | 17.26 a | 15.32 b | 0.54 | 0.11 | 0.29 |
| P | ||||||||
| d 23 to 27 | 44.21 a | 48.04 ab | 50.02 bc | 53.35 c | 45.34 a | 1.31 | 0.96 | 0.01 |
| d 64 to 68 | 50.63 | 49.36 | 51.46 | 54.73 | 53.38 | 1.11 | 0.17 | 0.29 |
| CP | ||||||||
| d 23 to 27 | 67.47 | 71.53 | 73.41 | 74.64 | 72.67 | 2.04 | 0.34 | 0.05 |
| d 64 to 68 | 65.04 a | 70.26 ab | 73.64 b | 75.84 b | 72.95 b | 1.88 | 0.29 | 0.02 |
| GE | ||||||||
| d 23 to 27 | 74.46 a | 85.25 b | 85.54 b | 86.75 b | 65.63 c | 1.18 | 0.33 | 0.04 |
| d 64 to 68 | 78.22 | 80.64 | 75.64 | 80.42 | 79.37 | 2.05 | 0.72 | 0.95 |
| Parameter | Yeast Culture Supplementation (% of Diet) | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| Control | 0.5% | 1.0% | 2.0% | 4.0% | L | Q | ||
| ALT (U/L) | ||||||||
| d 28 | 12.63 a | 20.36 b | 20.04 b | 23.27 b | 22.12 b | 0.68 | 0.22 | 0.15 |
| d 70 | 14.26 a | 16.53 b | 15.17 ab | 29.05 c | 29.42 c | 0.42 | 0.05 | 0.17 |
| AST (U/L) | ||||||||
| d 28 | 17.43 a | 13.23 b | 13.17 b | 14.75 b | 14.21 b | 0.68 | 0.65 | 0.68 |
| d 70 | 22.20 a | 16.45 b | 26.27 c | 41.43 d | 41.02 d | 0.62 | 0.07 | 0.2 |
| ALP (U/L) | ||||||||
| d 28 | 583.11 a | 985.63 b | 993.41 b | 658.85 c | 692.58 d | 3.46 | 0.69 | 0.83 |
| d 70 | 786.25 a | 1061.63 b | 848.37 d | 853.74 c | 850.02 cd | 1.45 | 0.78 | 0.95 |
| TC (mmol/L) | ||||||||
| d 28 | 6.40 a | 5.76 b | 7.06 c | 6.07 d | 6.27 e | 0.03 | 0.92 | 0.99 |
| d 70 | 4.76 a | 5.11 b | 4.21 c | 4.21 c | 4.22 c | 0.01 | 0.24 | 0.41 |
| TG (mmol/L) | ||||||||
| d 28 | 0.50 a | 0.55 b | 0.69 c | 0.55 b | 0.61 d | 0.01 | 0.58 | 0.77 |
| d 70 | 0.59 a | 0.55 b | 0.78 c | 0.91 d | 0.93 d | 0.01 | 0.06 | 0.12 |
| HDL (mmol/L) | ||||||||
| d 28 | 4.65 a | 4.09 b | 5.15 c | 4.26 b | 4.58 a | 0.08 | 0.97 | 1.0 |
| d 70 | 3.24 a | 3.61 b | 2.91 c | 2.66 d | 2.64 d | 0.01 | 0.13 | 0.32 |
| LDL (mmol/L) | ||||||||
| d 28 | 1.98 a | 1.70 b | 2.39 c | 1.91 d | 1.87 e | 0.01 | 0.82 | 0.9 |
| d 70 | 1.61 a | 1.75 b | 1.42 c | 1.64 a | 1.61 a | 0.01 | 0.95 | 0.96 |
| Item | Yeast Culture Supplementation (% of Diet) | SEM | p-Value | |||||
|---|---|---|---|---|---|---|---|---|
| Control | 0.5% | 1.0% | 2.0% | 4.0% | L | Q | ||
| Lysozyme (μg/mL) | ||||||||
| d 28 | 0.79 b | 0.65 a | 0.78 b | 1.01 c | 0.91 bc | 0.06 | 0.25 | 0.47 |
| d 70 | 0.40 a | 0.73 b | 0.79 b | 1.09 c | 0.48 a | 0.04 | 0.99 | 0.04 |
| IL-2 (ng/mL) | ||||||||
| d 28 | 46.12 a | 50.65 b | 64.93 c | 68.81 d | 83.81 e | 0.28 | 0.01 | 0.04 |
| d 70 | 17.62 a | 20.02 b | 18.97 ab | 19.72 b | 17.50 a | 0.63 | 0.61 | 0.32 |
| IgA (g/L) | ||||||||
| d 28 | 0.32 | 0.33 | 0.33 | 0.33 | 0.33 | 0.01 | 0.36 | 0.35 |
| d 70 | 0.33 | 0.34 | 0.33 | 0.34 | 0.34 | 0.004 | 0.31 | 0.63 |
| IgG (g/L) | ||||||||
| d 28 | 2.34 | 2.54 | 2.48 | 2.49 | 2.39 | 0.15 | 0.83 | 0.46 |
| d 70 | 2.44 a | 1.65 b | 2.23 a | 2.50 a | 2.31 a | 0.11 | 0.65 | 0.92 |
| IgM (g/L) | ||||||||
| d 28 | 0.15 a | 0.30 b | 0.18 a | 0.28 b | 0.30 b | 0.02 | 0.28 | 0.59 |
| d 70 | 0.20 a | 0.33 b | 0.15 c | 0.32 b | 0.31 b | 0.02 | 0.45 | 0.8 |
| Complement C3 (g/L) | ||||||||
| d 28 | 0.13 a | 0.19 b | 0.15 ab | 0.15 ab | 0.13 a | 0.01 | 0.52 | 0.72 |
| d 70 | 0.20 a | 0.18 a | 0.24 b | 0.18 a | 0.27 b | 0.01 | 0.22 | 0.45 |
| Complement C4 (g/L) | ||||||||
| d 28 | 0.08 a | 0.06 ab | 0.08 a | 0.04 b | 0.06 ab | 0.01 | 0.42 | 0.51 |
| d 70 | 0.07 a | 0.08 a | 0.07 a | 0.07 a | 0.04 b | 0.01 | 0.05 | 0.06 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, J.; He, H.; Yuan, Y.; Wan, K.; Li, L.; Liu, A. Effects of Yeast Culture Supplementation on Growth Performance, Nutrient Digestibility, Blood Metabolites, and Immune Response in Geese. Animals 2022, 12, 1270. https://doi.org/10.3390/ani12101270
Zhang J, He H, Yuan Y, Wan K, Li L, Liu A. Effects of Yeast Culture Supplementation on Growth Performance, Nutrient Digestibility, Blood Metabolites, and Immune Response in Geese. Animals. 2022; 12(10):1270. https://doi.org/10.3390/ani12101270
Chicago/Turabian StyleZhang, Jie, Hang He, Yancong Yuan, Kun Wan, Longjiao Li, and Anfang Liu. 2022. "Effects of Yeast Culture Supplementation on Growth Performance, Nutrient Digestibility, Blood Metabolites, and Immune Response in Geese" Animals 12, no. 10: 1270. https://doi.org/10.3390/ani12101270
APA StyleZhang, J., He, H., Yuan, Y., Wan, K., Li, L., & Liu, A. (2022). Effects of Yeast Culture Supplementation on Growth Performance, Nutrient Digestibility, Blood Metabolites, and Immune Response in Geese. Animals, 12(10), 1270. https://doi.org/10.3390/ani12101270

