Microsatellite-Based Genetic Structure and Hybrid Detection in Alpacas Bred in Poland
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Microsatellite Genotyping
2.2. Population Structure Analysis
2.3. Statistical Analysis
3. Results
3.1. Genetic Structure
3.2. Genetic Diversity
4. Discussion
4.1. Population Structure and Llama–Alpaca Hybrids
4.2. Genetic Diversity
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wheeler, J.C. Evolution and present situation of the South American camelidae. Biol. J. Linn. Soc. 1995, 54, 271–295. [Google Scholar] [CrossRef]
- Wheeler, J.C.; Russel, A.J.F.; Redden, H. Llamas and Alpacas: Pre-conquest breeds and post-conquest hybrids. J. Archaeol. Sci. 1995, 22, 833–840. [Google Scholar] [CrossRef]
- Czub, G.; Niznikowski, R.; Morales Villavicencio, A. Influence of age and sex on body conformation of alpacas bred in Poland. Ann. Warsaw Univ. Life Sci.-SGGW. Anim. Sci. 2010, 47, 328–335. [Google Scholar]
- Kapustka, J.; Budzyńska, M. Cechy behawioru alpak na podstawie obserwacji na pastwisku i w alpakarni. Wiadomości Zootech. 2018, 3, 128–136. [Google Scholar]
- Markowska-Daniel, I.; Kita, J.; Kalicki, M. Wielbłądowate jako potencjalne źródło chorób odzwierzęcych. Życie Weter. 2018, 93, 470–475. [Google Scholar]
- Krajewska- Wędzina, M.; Raczyńska, A.; Najbar, J.; Turcewicz, P. Alpaki-Nowy gatunek hodowlany w Polsce.Część I. Ogólna charakterystyka gatunku. Życie Weter. 2020, 95, 422–426. [Google Scholar]
- Czaplicki, Z.; Mikołajczyk, Z.; Prążyńska, A. Analysis of functional properties of knitted fabrics made of alpaca wool and other fibres. Fibres Text. East. Eur. 2018, 26, 52–59. [Google Scholar]
- Czaplicki, Z. Properties and structure of polish alpaca wool. Fibres Text. East. Eur. 2012, 90, 8–12. [Google Scholar]
- Kadwell, M.; Fernandez, M.; Stanley, H.F.; Baldi, R.; Wheeler, J.C.; Rosadio, R.; Bruford, M.W. Genetic analysis reveals the wild ancestors of the llama and the alpaca. Proc. R. Soc. B Biol. Sci. 2001, 268, 2575–2584. [Google Scholar] [CrossRef] [Green Version]
- Bravo, P.W. Camelidae; Elsevier Inc.: Philadelphia, PA, USA, 2015. [Google Scholar]
- Echalar, J.; Barreta, J.; Iniguez, V.; Romero, F.; Callisaya, A.M.; Saavedra, V. Intraspecific genetic analysis of Bolivian alpacas and interspecific relationship with llamas and vicunas. Small Rumin. Res. 2020, 189, 106137. [Google Scholar] [CrossRef]
- Varas, V.; Vásquez, J.P.; Rivera, R.; Longo, A.; Valdecantos, P.A.; Wheeler, J.C.; Johnson, W.E.; Marín, J.C. Interbreeding among South American camelids threatens species integrity. J. Arid Environ. 2020, 181, 104249. [Google Scholar] [CrossRef]
- Andersone, Ž.; Lucchini, V.; Ozoliņš, J. Hybridisation between wolves and dogs in Latvia as documented using mitochondrial and microsatellite DNA markers. Mamm. Biol. 2002, 67, 79–90. [Google Scholar] [CrossRef]
- Khosravi, R.; Rezaei, H.R.; Kaboli, M. Detecting hybridization between iranian wild wolf (Canis Lupus Pallipes) and free-ranging domestic dog (Canis Familiaris) by analysis of microsatellite markers. Zool. Sci. 2013, 30, 27–34. [Google Scholar] [CrossRef]
- Dufresnes, C.; Remollino, N.; Stoffel, C.; Manz, R.; Weber, J.M.; Fumagalli, L. Two decades of non-invasive genetic monitoring of the grey wolves recolonizing the Alps support very limited dog introgression. Sci. Rep. 2019, 9, 148. [Google Scholar] [CrossRef] [Green Version]
- Hindrikson, M.; Männil, P.; Ozolins, J.; Krzywinski, A.; Saarma, U. Bucking the Trend in Wolf-Dog Hybridization: First Evidence from Europe of Hybridization between Female Dogs and Male Wolves. PLoS ONE 2012, 7, e46465. [Google Scholar] [CrossRef] [Green Version]
- Randi, E.; Hulva, P.; Fabbri, E.; Galaverni, M.; Galov, A.; Kusak, J.; Bigi, D.; Bolfíková, B.Č.; Smetanová, M.; Caniglia, R. Multilocus detection of wolf x dog hybridization in Italy, and guidelines for marker selection. PLoS ONE 2014, 9, e86409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vilà, C.; Walker, C.; Sundqvist, A.K.; Flagstad, Ø.; Andersone, Z.; Casulli, A.; Kojola, I.; Valdmann, H.; Halverson, J.; Ellegren, H. Combined use of maternal, paternal and bi-parental genetic markers for the identification of wolf-dog hybrids. Heredity 2003, 90, 17–24. [Google Scholar] [CrossRef] [PubMed]
- Anderson, D.; Negishi, Y.; Toma, R.; Nagata, J.; Tamate, H.; Kaneko, S. Robust microsatellite markers for hybrid analysis between domesticated pigs and wild boar. Genet. Resour. 2020, 1, 29–41. [Google Scholar] [CrossRef]
- Ito, H.; Langenhorst, T.; Ogden, R.; Inoue-Murayama, M. Population genetic diversity and hybrid detection in captive zebras. Sci. Rep. 2015, 5, 13171. [Google Scholar] [CrossRef] [Green Version]
- Pacheco-Sierra, G.; Vázquez-Domínguez, E.; Pérez-Alquicira, J.; Suárez-Atilano, M.; Domínguez-Laso, J. Ancestral hybridization yields evolutionary distinct hybrids lineages and species boundaries in crocodiles, posing unique conservation conundrums. Front. Ecol. Evol. 2018, 6, 138. [Google Scholar] [CrossRef] [Green Version]
- Beugin, M.P.; Letty, J.; Kaerle, C.; Guitton, J.S.; Muselet, L.; Queney, G.; Pontier, D. A single multiplex of twelve microsatellite markers for the simultaneous study of the brown hare (Lepus europaeus) and the mountain hare (Lepus timidus). Ecol. Evol. 2017, 7, 3931–3939. [Google Scholar] [CrossRef]
- Negri, A.; Pellegrino, I.; Mucci, N.; Randi, E.; Tizzani, P.; Meneguz, P.G.; Malacarne, G. Mitochondrial DNA and microsatellite markers evidence a different pattern of hybridization in red-legged partridge (Alectoris rufa) populations from NW Italy. Eur. J. Wildl. Res. 2013, 59, 407–419. [Google Scholar] [CrossRef] [Green Version]
- Penedo, M.C.T.; Caetano, A.R.; Cordova, K.I. Microsatellite markers for South American camelids. Anim. Genet. 1998, 29, 411–412. [Google Scholar] [PubMed]
- Penedo, M.C.T.; Caetano, A.R.; Cordova, K. Eight microsatellite markers for South American camelids. Anim. Genet. 1999, 30, 166–167. [Google Scholar] [CrossRef]
- Penedo, M.C.T.; Caetano, A.R.; Cordova, K.I. Six microsatellite markers for South American camelids. Anim. Genet. 1999, 30, 399. [Google Scholar] [CrossRef]
- Sarno, R.J.; David, V.A.; Franklin, W.L.; O’Brien, S.J.; Johnson, W.E. Development of microsatellite markers in the guanaco, Lama guanicoe: Utility for South American camelids. Mol. Ecol. 2000, 9, 1922–1924. [Google Scholar] [CrossRef]
- Lang, K.D.M.; Wang, Y.; Plante, Y. Fifteen polymorphic dinucleotide microsatellites in llamas and alpacas. Anim. Genet. 1996, 27, 293. [Google Scholar] [CrossRef]
- Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef]
- Earl, D.A.; VonHoldt, B.M. Structure Harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peakall, R.; Smouse, P.E. Genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
- Peakall, R.; Smouse, P.E. GenALEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef] [Green Version]
- Kalinowski, S.T. Counting alleles with rarefaction: Private alleles and hierarchical sampling designs. Conserv. Genet. 2004, 5, 539–543. [Google Scholar] [CrossRef]
- Kalinowski, S.T. HP-RARE 1.0: A computer program for performing rarefaction on measures of allelic richness. Mol. Ecol. Notes 2005, 5, 187–189. [Google Scholar] [CrossRef]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef]
- Garcia-Vallvé, S.; Palau, J.; Romeu, A. Horizontal gene transfer in glycosyl hydrolases inferred from codon usage in Escherichia coli and Bacillus subtilis. Mol. Biol. Evol. 1999, 16, 1125–1134. [Google Scholar] [CrossRef] [Green Version]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef]
- Raymond, M.; Rousset, F. GENEPOP (Version 1.2): Population Genetics Software for Exact Tests and Ecumenicism. J. Hered. 1995, 86, 248–249. [Google Scholar] [CrossRef]
- Rousset, F. Genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
- Wheeler, J.C. South American Camelids-Past, Present and Futur. J. Camelid Sci. 2012, 5, 1–24. [Google Scholar]
- Pfennig, K.S. Biased Hybridization and Its Impact on Adaptive Introgression. Trends Ecol. Evol. 2021, 36, 488–497. [Google Scholar] [CrossRef] [PubMed]
- Barreta, J.; Gutiérrez-Gil, B.; Iñiguez, V.; Saavedra, V.; Chiri, R.; Latorre, E.; Arranz, J.J. Analysis of mitochondrial DNA in Bolivian llama, alpaca and vicuna populations: A contribution to the phylogeny of the South American camelids. Anim. Genet. 2013, 44, 158–168. [Google Scholar] [CrossRef] [PubMed]
- Marín, J.C.; Romero, K.; Rivera, R.; Johnson, W.E.; González, B.A. Y-chromosome and mtDNA variation confirms independent domestications and directional hybridization in South American camelids. Anim. Genet. 2017, 48, 591–595. [Google Scholar] [CrossRef]
- VÄHÄ, J.-P.; Primmer, C.R. Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Mol. Ecol. 2006, 15, 63–72. [Google Scholar] [CrossRef]
- Wheeler, J.C.; Chikhi, L. Genetic Analysis of the Origins of Domestic South American Camelids Genetic Analysis of the Origins of Domestic South American Camelids. Genet. S. Am. Camelids 2006, 23, 331–343. [Google Scholar]
- Di Rocco, F.; Posik, D.M.; Ripoli, M.V.; Díaz, S.; Maté, M.L.; Giovambattista, G.; Vidal-Rioja, L. South American camelid illegal traffic detection by means of molecular markers. Leg. Med. 2011, 13, 289–292. [Google Scholar] [CrossRef]
- Pérez-Cabal, M.Á.; Gutiérrez, J.P.; Cervantes, I.; Alcalde, M.J. Fibre production in South American camelids and other fibre animals. Springer Sci. Bus. Media 2012, 1–241. [Google Scholar]
- Paredes, M.M.; Membrillo, A.; Azor, P.J.; Machaca, J.E.; Torres, D.; Serrano, A.M. Genetic and phenotypic variation in five populations of Huacaya Alpacas (Vicugna pacos) from Peru. Small Rumin. Res. 2013, 111, 31–40. [Google Scholar] [CrossRef]
- Tison, J.L.; Blennow, V.; Palkopoulou, E.; Gustafsson, P.; Roos, A.; Dalén, L. Population structure and recent temporal changes in genetic variation in Eurasian otters from Sweden. Conserv. Genet. 2015, 16, 371–384. [Google Scholar] [CrossRef]
- Thulin, C.G.; Malmsten, J.; Laurila, A. Differences in body mass, health status and genetic variation between insular and mainland brown hares (Lepus europaeus) in Sweden. Eur. J. Wildl. Res. 2012, 58, 897–907. [Google Scholar] [CrossRef]
- Dos Santos, C.H.D.A. Genetic relationships between captive and wild subpopulations of Arapaima gigas (Schinz, in Cuvier, 1822). Int. J. Fish. Aquac. 2014, 6, 108–123. [Google Scholar]
- Hoffmann, L.; Hull, K.L.; Bierman, A.; Badenhorst, R.; Bester-van der Merwe, A.E.; Rhode, C. Patterns of Genetic Diversity and Mating Systems in a Mass-Reared Black Soldier Fly Colony. Insects 2021, 12, 480. [Google Scholar] [CrossRef]
- Gaspari, S.; Azzellino, A.; Airoldi, S.; Hoelzel, A.R. Social kin associations and genetic structuring of striped dolphin populations (Stenella coeruleoalba) in the Mediterranean Sea. Mol. Ecol. 2007, 16, 2922–2933. [Google Scholar] [CrossRef] [PubMed]
- Paredes, M.M.; Membrillo, A.; Gutiérrez, J.P.; Cervantes, I.; Azor, P.J.; Morante, R.; Alonso-Moraga, A.; Molina, A.; Muñoz-Serrano, A. Association of microsatellite markers with fiber diameter trait in Peruvian alpacas (Vicugna pacos). Livest. Sci. 2014, 161, 6–16. [Google Scholar] [CrossRef]
- Barreta, J.; Iñiguez, V.; Saavedra, V.; Romero, F.; Callisaya, A.M.; Echalar, J.; Gutiérrez-Gil, B.; Arranz, J.J. Genetic diversity and population structure of Bolivian alpacas. Small Rumin. Res. 2012, 105, 97–104. [Google Scholar] [CrossRef]
- Paredes, M.; Machaca, J.; Azor, P.J.; Alonso-Moraga, A.; Membrillo, A.; Munoz-Serrano, A. Genetic differentiation of six peruvian alpaca populations. In Fibre Production in South American Camelids and Other Fibre Animals; Wageningen Academic Publishers: Wageningen, The Netherlands, 2012; pp. 161–166. [Google Scholar]
- Morón, J.A.; Veli, E.A.; Membrillo, A.; Paredes, M.M.; Gutiérrez, G.A. Genetic diversity and validation of a microsatellite panel for parentage testing for alpacas (Vicugna pacos) on three Peruvian farms. Small Rumin. Res. 2020, 193, 106246. [Google Scholar] [CrossRef]
- Agapito, J.; Rodríguez, J.; Herrera-Velit, P.; Timoteo, O.; Rojas, P.; Boettcher, P.J.; García, F.; Espinoza, J.R. Parentage testing in alpacas (Vicugna pacos) using semi-automated fluorescent multiplex PCRs with 10 microsatellite markers. Anim. Genet. 2008, 39, 201–203. [Google Scholar] [CrossRef] [PubMed]
- La Manna, V.; La Terza, A.; Ghezzi, S.; Saravanaperumal, S.; Apaza, N.; Huanca, T.; Bozzi, R.; Renieri, C. Analysis of genetic distance between Peruvian Alpaca (Vicugna Pacos) showing two distinct fleece phenotypes, Suri and Huacaya, by means of microsatellite markers. Ital. J. Anim. Sci. 2011, 10, e60. [Google Scholar] [CrossRef] [Green Version]
- Dakin, E.E.; Avise, J.C. Microsatellite null alleles in parentage analysis. Heredity 2004, 93, 504–509. [Google Scholar] [CrossRef]
- Costa, V.; Pérez-González, J.; Santos, P.; Fernández-Llario, P.; Carranza, J.; Zsolnai, A.; Anton, I.; Buzgá, J.; Varga, G.; Monteiro, N.; et al. Microsatellite markers for identification and parentage analysis in the European wild boar (Sus scrofa). BMC Res. Notes 2012, 5, 1–6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siwek, M.; Knol, E.F. Parental reconstruction in rural goat population with microsatellite markers. Ital. J. Anim. Sci. 2010, 9, e50. [Google Scholar] [CrossRef]
- Li, K.; Geng, J.; Qu, J.; Zhang, Y.; Hu, S. Effectiveness of 10 polymorphic microsatellite markers for parentage and pedigree analysis in plateau pika (Ochotona curzoniae). BMC Genet. 2010, 11, 61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weng, Z.; Yang, Y.; Wang, X.; Wu, L.; Hua, S.; Zhang, H.; Meng, Z. Parentage Analysis in Giant Grouper (Epinephelus lanceolatus) Using Microsatellite and SNP Markers from Genotyping-by-Sequencing Data. Genes 2021, 12, 1042. [Google Scholar] [CrossRef]
- Bustamante, A.V.; Zambelli, A.; De Lamo, D.A.; Von Thungen, J.; Vidal-Rioja, L. Genetic variability of guanaco and llama populations in Argentina. Small Rumin. Res. 2002, 44, 97–101. [Google Scholar] [CrossRef]
- Fornal, A.; Kowalska, K.; Zabek, T.; Piestrzynska-Kajtoch, A.; Musiał, A.D.; Ropka-Molik, K. Genetic Variability and Population Structure of Polish Konik Horse Maternal Lines Based on Microsatellite Markers. Genes 2021, 12, 546. [Google Scholar] [CrossRef] [PubMed]
- Radko, A.; Smołucha, G.; Koseniuk, A. Microsatellite DNA Analysis for Diversity Study, Individual Identification and Parentage Control in Pig Breeds in Poland. Genes 2021, 12, 595. [Google Scholar] [CrossRef]
- Radko, A.; Podbielska, A. Microsatellite DNA Analysis of Genetic Diversity and Parentage Testing in the Popular Dog Breeds in Poland. Genes 2021, 12, 485. [Google Scholar] [CrossRef] [PubMed]




| Locus | Primer (5′-3′) Forward | Primer (5′-3′) Reverse | Concentration F + R (μM) * | Dye | Size Range (bp) | Multiplex | Reference |
|---|---|---|---|---|---|---|---|
| LCA5 | GTGGTTTTTGCCCAAGCTC | ACCTCCAGTCTGGGGATTTC | 3 | VIC | 178–218 | 1 | [24] |
| LCA8 | GCTGAACCACAATGCAAAGA | AATGCAGATGTGCCTCAGTT | 2.5 | NED | 211–261 | [24] | |
| LCA19 | TAAGTCCAGCCCCACACTCA | GGTGAAGGGGCTTGATCTTC | 2.5 | 6—FAM | 80–122 | [24] | |
| LCA37 | AAACCTAATTACCTCCCCCA | CCATGTAGTTGCAGGACACG | 3 | PET | 124–174 | [24] | |
| LCA56 | ATGGTGTTTACAGGGCGTTG | GCATTACTGAAAAGCCCAGG | 2.5 | NED | 130–168 | [25] | |
| LCA65 | TTTTTCCCCTGTGGTTGAAT | AACTCAGCTGTTGTCAGGGG | 2.5 | 6—FAM | 159–193 | [25] | |
| LCA66 | GTGCAGCGTCCAAATAGTCA | CCAGCATCGTCCAGTATTCA | 2.5 | 6—FAM | 216–266 | [25] | |
| LCA94 | GTCCATTCATCCAGCACAGG | ACATTTGGCAATCTCTGGAGAA | 2.5 | PET | 187–213 | [26] | |
| LCA99 | CAGGTATCAGGAGACGGGCT | AGCATTTATCAAGGAACACCAGC | 2.5 | VIC | 263–297 | [26] | |
| LGU49 | TCTAGGTCCATCCCTGTTGC | GTGCTGGAATAGTGCCCAGT | 2.5 | PET | 219–255 | [27] | |
| LGU50 | CTGCTGTGCTTGTCACCCTA | AGCACCACATGCCTCTAAGT | 2.5 | NED | 183–201 | [27] | |
| YWLL44 | CTCAACAATGCTAGACCTTGG | GAGAACACAGGCTGGTGAATA | 4 | VIC | 84–136 | [28] | |
| YWLL29 | GAAGGCAGGAGAAAAGGTAG | CAGAGGCTTAATAACTTGCAG | 2.5 | 6—FAM | 210–236 | 2 | [28] |
| YWLL36 | AGTCTTGGTGTGGTGGTAGAA | TGCCAGGATACTGACAGTGAT | 2.5 | PET | 142–180 | [28] | |
| YWLL40 | CACATGACCATGTCCCCTTAT | CCAGTGACAGTGTGACTAAGA | 2.5 | 6—FAM | 174–200 | [28] | |
| YWLL43-X | ATACCTCTCTTGCTCTCTCTC | CCTCTACAACCATGTTAGCCA | 2.5 | VIC | 124–156 | [28] | |
| YWLL46 | AAGCAGAGTGATTTAACCGTG | GGATGACTAAGACTGCTCTGA | 2 | NED | 84–109 | [28] |
| Putative Hybrid 1 | Control Hybrid 2 | Putative Hybrid 3 | ||||
|---|---|---|---|---|---|---|
| alpaca | llama | alpaca | llama | alpaca | llama | |
| q | 0.002 | 0.998 | 0.926 | 0.074 | 0.003 | 0.997 |
| Locus | Potential Hybrid 1 | Control-Hybrid 2 | Potential Hybrid 3 |
|---|---|---|---|
| LCA5 | 188/190 | 188/202 b | 194/ |
| LCA8 | 245/ | 239/241 | 241/255 a |
| LCA19 | 86/ | 86/102 b | 86/ |
| LCA37 | 144/146 a | 140/156 b | 132 b/150 |
| LCA56 | 139/ | 139/141 | 137/139 |
| LCA65 | 169/173 | 171/ | 169/175 |
| LCA66 | 220/260 | 224/226 b | 224/ |
| LCA94 | 193/ | 191/199 b | 191/193 |
| LCA99 | 278/286 | 282/288 b | 286/ |
| LGU49 | 231/239 | 221 b/231 | 217 a/239 |
| LGU50 | 193/ | 187 b/193 | 191 a/193 |
| YWLL44 | 96/ | 86/122 b | 96/112 |
| YWLL29 | 220/ | 218/220 | 218/220 |
| YWLL36 | 156/ | 150/156 | 152/154 |
| YWLL40 | 186/ | 186/188 | 186/ |
| YWLL43-X | 158/ | 152 b/156 | 136 a/ |
| YWLL46 | 105/109 | 97/105 | 103/ |
| All Individuals except Three Putative Hybrids | Individuals with q ≥ 0.98 | |||||
|---|---|---|---|---|---|---|
| Locus | Alleles Identified Only in Alpacas | Alleles Identified Only in Llamas | Alleles Shared between Both Species | Alleles Identified Only in Alpacas | Alleles Identified Only in Llamas | Alleles Common to Both Species |
| LCA5 | 182 a, 186, 192, 196, 200, 202, 204, 206 | - | 188, 190, 194 | 186, 192, 196, 200, 202, 204, 206 | - | 188, 190, 194 |
| LCA8 | 231, 251, 261 | 257 | 237, 239, 241, 243, 245, 249, 253 a, 255 a | 231, 251, 253 a, 261 | 255 a, 257 | 237, 239, 241, 243, 245, 249 |
| LCA19 | 88, 96, 98, 100, 102, 104, 106, 108, 112, 116, 120 | - | 86, 90, 92 a, 94 | 88, 92 a, 96, 98, 100, 102, 104, 106, 108, 112, 116, 120 | - | 86, 90, 94 |
| LCA37 | 132, 152, 154, 156, 158, 160, 164, 166, 168, 172 | 146, 184 | 134, 136, 140, 142 a, 144, 148, 150 | 132, 142 a, 152, 154, 156, 158, 160, 164, 166, 168, 172 | 146, 184 | 134, 136, 140, 144, 148, 150 |
| LCA56 | 135, 143, 145, 149, 155, 161, 163, 165, 167 | - | 133, 137, 139, 141 | 135, 143, 145, 149, 155, 161, 163, 165, 167 | - | 133, 137, 139, 141 |
| LCA65 | 165, 167, 177, 179, 181, 183, 185, 187, 189, 191 | - | 169, 171, 173, 175 | 165, 167, 177, 179, 181, 183, 185, 187, 189, 191 | - | 169, 171, 173, 175 |
| LCA66 | 226, 229, 231, 232, 236, 238, 240, 242, 246, 256, 262 | - | 220, 222, 224, 228, 230 a, 254, 260 | 226, 229, 230 a, 231, 232, 236, 238, 240, 242, 246, 256, 262 | - | 220, 222, 224, 228, 254, 260 |
| LCA94 | 195, 199, 201, 205, 207 | - | 189, 191, 193 | 195, 199, 201, 205, 207 | - | 189, 191, 193 |
| LCA99 | 264, 272, 276, 280, 288, 292 | - | 268, 274, 278, 282, 284 a, 286, 290, 294 | 264, 272, 276, 280, 284 a, 288, 292 | - | 268, 274, 278, 282, 286, 290, 294 |
| LGU49 | 221, 229, 233, 235, 237, 245, 247 | 217 | 225, 227 a, 231, 239, 241, 243 | 221, 229, 233, 235, 237, 245, 247 | 217, 227 a | 225, 231, 239, 241, 243 |
| LGU50 | 183, 189 | 191 | 187 a, 193, 195 | 183, 187 a, 189 | 191 | 193, 195 |
| YWLL44 | 94, 108, 110, 116, 118, 120, 122, 124, 128 | - | 86, 96, 98, 102, 104, 106, 112, 114 | 94, 108, 110, 116, 118, 120, 122, 124, 128 | - | 86, 96, 98, 102, 104, 106, 112, 114 |
| YWLL29 | 214, 222, 224 | 232 | 216 a, 218, 220, 226, 228 | 214, 216 a, 222, 224 | 232 | 218, 220, 226, 228 |
| YWLL36 | 142, 162, 164, 168, 172, 174, 176, 178 | - | 148, 150, 152, 154, 156, 158, 170 | 142, 162, 164, 168, 172, 174, 176, 178 | - | 148, 150, 152, 154, 156, 158, 170 |
| YWLL40 | 180, 184, 190 | - | 182, 186, 188 | 180, 184, 190 | - | 182, 186, 188 |
| YWLL43-X | 130, 140, 146, 152, 160 | 142 | 136 a, 144, 148, 150, 156, 158 | 130, 140, 146, 152, 160 | 136 a, 142 | 144, 148, 150, 156, 158 |
| YWLL46 | 113 | 107 | 97, 103, 105, 109 | 113 | 107 | 97, 103, 105, 109 |
| Locus | Na | Ar | Ho | He | Fis | p Value | HWE | PIC | NE-1P | NE-2P | NE-I | F (Null) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| LCA19 | 15 | 5.652 | 0.682 | 0.680 | −0.002 | 0.000 | *** | 0.654 | 0.703 | 0.516 | 0.128 | −0.0020 |
| LCA65 | 14 | 7.672 | 0.853 | 0.866 | 0.015 | 0.811 | ns | 0.852 | 0.424 | 0.267 | 0.032 | 0.0077 |
| LCA66 | 18 | 7.426 | 0.770 | 0.817 | 0.058 | 0.873 | ns | 0.801 | 0.508 | 0.336 | 0.050 | 0.0341 |
| YWLL44 | 17 | 8.037 | 0.834 | 0.874 | 0.045 | 0.998 | ns | 0.862 | 0.403 | 0.251 | 0.028 | 0.0237 |
| LCA5 | 11 | 5.336 | 0.843 | 0.775 | −0.088 | 0.977 | ns | 0.742 | 0.610 | 0.431 | 0.084 | −0.0454 |
| LCA99 | 14 | 7.068 | 0.829 | 0.839 | 0.012 | 0.000 | *** | 0.821 | 0.482 | 0.315 | 0.044 | 0.0090 |
| LCA56 | 13 | 6.568 | 0.802 | 0.803 | 0.001 | 0.996 | ns | 0.779 | 0.547 | 0.372 | 0.063 | 0.0012 |
| LGU50 | 5 | 4.044 | 0.700 | 0.679 | −0.031 | 0.853 | ns | 0.625 | 0.739 | 0.573 | 0.157 | −0.0176 |
| LCA8 | 11 | 7.047 | 0.853 | 0.853 | 0.000 | 0.624 | ns | 0.836 | 0.458 | 0.294 | 0.039 | −0.0012 |
| LCA37 | 17 | 7.950 | 0.871 | 0.857 | −0.017 | 0.621 | ns | 0.842 | 0.437 | 0.279 | 0.035 | −0.0099 |
| LCA94 | 8 | 5.831 | 0.816 | 0.813 | −0.004 | 0.549 | ns | 0.787 | 0.547 | 0.371 | 0.061 | −0.0023 |
| LGU49 | 13 | 7.330 | 0.848 | 0.844 | −0.005 | 0.900 | ns | 0.828 | 0.468 | 0.303 | 0.041 | −0.0045 |
| YWLL40 | 6 | 3.846 | 0.604 | 0.674 | 0.105 | 0.105 | ns | 0.615 | 0.750 | 0.588 | 0.165 | 0.0590 |
| YWLL29 | 8 | 5.600 | 0.760 | 0.752 | −0.011 | 0.638 | ns | 0.723 | 0.630 | 0.447 | 0.091 | −0.0038 |
| YWLL43-X | 11 | 4.381 | 0.406 | 0.658 | 0.384 | 0.000 | *** | 0.603 | 0.751 | 0.588 | 0.172 | 0.2461 |
| YWLL46 | 5 | 2.885 | 0.382 | 0.406 | 0.057 | 0.972 | ns | 0.368 | 0.916 | 0.788 | 0.391 | 0.0359 |
| YWLL36 | 15 | 7.776 | 0.820 | 0.870 | 0.057 | 0.014 | * | 0.857 | 0.415 | 0.260 | 0.030 | 0.0295 |
| TOTAL | 201 | |||||||||||
| AVERAGE | 6.140 | 0.745 | 0.768 | 0.034 | 0.741 | 0.576 | 0.411 | 0.095 | 0.021 | |||
| CNE-1P | 0.00004997 | CE-1P | 0.99995003 | CNE-I | 2.144 × 10−20 | |||||||
| CNE-2P | 0.00000010 | CE-2P | 0.9999999 | |||||||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Podbielska, A.; Piórkowska, K.; Szmatoła, T. Microsatellite-Based Genetic Structure and Hybrid Detection in Alpacas Bred in Poland. Animals 2021, 11, 2193. https://doi.org/10.3390/ani11082193
Podbielska A, Piórkowska K, Szmatoła T. Microsatellite-Based Genetic Structure and Hybrid Detection in Alpacas Bred in Poland. Animals. 2021; 11(8):2193. https://doi.org/10.3390/ani11082193
Chicago/Turabian StylePodbielska, Angelika, Katarzyna Piórkowska, and Tomasz Szmatoła. 2021. "Microsatellite-Based Genetic Structure and Hybrid Detection in Alpacas Bred in Poland" Animals 11, no. 8: 2193. https://doi.org/10.3390/ani11082193
APA StylePodbielska, A., Piórkowska, K., & Szmatoła, T. (2021). Microsatellite-Based Genetic Structure and Hybrid Detection in Alpacas Bred in Poland. Animals, 11(8), 2193. https://doi.org/10.3390/ani11082193

