Transcriptional Profiling of Porcine Blastocysts Produced In Vitro in a Chemically Defined Culture Medium
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. In Vivo Embryo Production
2.2. In Vitro Embryo Production
2.3. Sample Preparation and RNA Extraction
2.4. Microarray Hybridization
2.5. Microarray Data Analyses
2.6. Validation of Results by q-PCR
2.7. Experimental Design
3. Results
3.1. Results of In Vivo and In Vitro Embryo Production
3.2. Transcriptional Profile
3.3. Gene Ontology and Pathway Enrichment Analysis
3.4. Validation by qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Acknowledgments
Conflicts of Interest
References
- Whitworth, K.M.; Agca, C.; Kim, J.-G.; Patel, R.V.; Springer, G.K.; Bivens, N.J.; Forrester, L.J.; Mathialagan, N.; Green, J.A.; Prather, R.S. Transcriptional profiling of pig embryogenesis by using a 15-K member unigene set specific for pig reproductive tissues and embryos. Biol. Reprod. 2005, 72, 1437–1451. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Miles, J.R.; Blomberg, L.A.; Krisher, R.L.; Everts, R.E.; Sonstegard, T.S.; Van Tassell, C.P.; Zuelke, K.A. Comparative transcriptome analysis of in vivo- and in vitro-produced porcine blastocysts by small amplified RNA-serial analysis of gene expression (SAR-SAGE). Mol. Reprod. Dev. 2008, 75, 976–988. [Google Scholar] [CrossRef] [PubMed]
- Bauer, B.K.; Isom, S.C.; Spate, L.D.; Whitworth, K.M.; Spollen, W.G.; Blake, S.M.; Springer, G.K.; Murphy, C.N.; Prather, R.S. Transcriptional profiling by deep sequencing identifies differences in mRNA transcript abundance in in vivo-derived versus in vitro-cultured porcine blastocyst stage embryos. Biol. Reprod. 2010, 83, 791–798. [Google Scholar] [CrossRef] [PubMed]
- Canovas, S.; Ivanova, E.; Romar, R.; García-Martínez, S.; Soriano-Úbeda, C.; García-Vázquez, F.A.; Saadeh, H.; Andrews, S.; Kelsey, G.; Coy, P. DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids. Elife 2017, 6. [Google Scholar] [CrossRef]
- Yuan, Y.; Spate, L.D.; Redel, B.K.; Tian, Y.; Zhou, J.; Prather, R.S.; Roberts, R.M. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Theriogenology 2013, 79, 392–398. [Google Scholar] [CrossRef]
- Gil, M.A.; Gomis, J.; Angel, M.A.; Sanchez-Osorio, J.; Maside, C.; Cuello, C.; Parrilla, I.; Roca, J.; Vazquez, J.M.; Martinez, E.A. The in vitro and in vivo developmental capacity of selected porcine monospermic zygotes. Theriogenology 2013, 79, 392–398. [Google Scholar] [CrossRef]
- Kikuchi, K.; Onishi, A.; Kashiwazaki, N.; Iwamoto, M.; Noguchi, J.; Kaneko, H.; Akita, T.; Nagai, T. Successful piglet production after transfer of blastocysts produced by a modified in vitro system. Biol. Reprod. 2002, 66, 1033–1041. [Google Scholar] [CrossRef]
- Almiñana, C.; Gil, M.A.; Cuello, C.; Parrilla, I.; Caballero, I.; Sanchez-Osorio, J.; Vazquez, J.M.; Roca, J.; Martinez, E.A. Capability of frozen-thawed boar spermatozoa to sustain pre-implantational embryo development. Anim. Reprod. Sci. 2010, 121, 145–151. [Google Scholar] [CrossRef]
- Myers, M.W.; Broussard, J.R.; Menezo, Y.; Prough, S.G.; Blackwell, J.; Godke, R.A.; Thibodeaux, J.K. Established cell lines and their conditioned media support bovine embryo development during in-vitro culture. Hum. Reprod. 1994, 9, 1927–1931. [Google Scholar] [CrossRef]
- Malekshah, A.K.; Moghaddam, A.E.; Daraka, S.M. Comparison of conditioned medium and direct co-culture of human granulosa cells on mouse embryo development. Indian J. Exp. Biol. 2006, 44, 189–192. [Google Scholar]
- Bhardwaj, R.; Ansari, M.M.; Parmar, M.S.; Chandra, V.; Sharma, G.T. Stem Cell Conditioned Media Contains Important Growth Factors and Improves In vitro Buffalo Embryo Production. Anim. Biotechnol. 2016, 27, 118–125. [Google Scholar] [CrossRef] [PubMed]
- Gray, C.W.; Morgan, P.M.; Kane, M.T. Purification of an embryotrophic factor from commercial bovine serum albumin and its identification as citrate. J. Reprod. Fertil. 1992, 94, 471–480. [Google Scholar] [CrossRef]
- Biggers, J.D.; Summers, M.C.; McGinnis, L.K. Polyvinyl alcohol and amino acids as substitutes for bovine serum albumin in culture media for mouse preimplantation embryos. Hum. Reprod. Update 1997, 3, 125–135. [Google Scholar] [CrossRef] [PubMed]
- Orsi, N.M.; Leese, H.J. Amino acid metabolism of preimplantation bovine embryos cultured with bovine serum albumin or polyvinyl alcohol. Theriogenology 2004, 61, 561–572. [Google Scholar] [CrossRef]
- Vanroose, G.; Van Soom, A.; de Kruif, A. From co-culture to defined medium: State of the art and practical considerations. Reprod. Domest. Anim. 2001, 36, 25–28. [Google Scholar] [CrossRef]
- van der Valk, J.; Brunner, D.; De Smet, K.; Fex Svenningsen, A.; Honegger, P.; Knudsen, L.E.; Lindl, T.; Noraberg, J.; Price, A.; Scarino, M.L.; et al. Optimization of chemically defined cell culture media--replacing fetal bovine serum in mammalian in vitro methods. Toxicol. In Vitro 2010, 24, 1053–1063. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, K. Development and Application of a Chemically Defined Medium for the In vitro Production of Porcine Embryos. J. Reprod. Dev. 2011, 57, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, K.; Suzuki, C.; Onishi, A. Defined system for in vitro production of porcine embryos using a single basic medium. J. Reprod. Dev. 2008, 54, 208–213. [Google Scholar] [CrossRef] [PubMed]
- Spate, L.D.; Brown, A.; Redel, B.K.; Whitworth, K.M.; Prather, R.S. PS48 can replace bovine serum albumin in pig embryo culture medium, and improve in vitro embryo development by phosphorylating AKT. Mol. Reprod. Dev. 2015, 82, 315–320. [Google Scholar] [CrossRef]
- Cambra, J.M.; Martinez, C.A.; Maside, C.; Rodriguez-Martinez, H.; Martinez, E.A.; Gil, M.A.; Cuello, C. The cytokine platelet factor 4 successfully replaces bovine serum albumin for the in vitro culture of porcine embryos. Theriogenology 2019. [Google Scholar] [CrossRef]
- Pursel, V.G.; Johnson, L.A. Freezing of boar spermatozoa: Fertilizing capacity with concentrated semen and a new thawing procedure. J. Anim. Sci. 1975, 40, 99–102. [Google Scholar] [CrossRef]
- Martinez, E.A.; Martinez, C.A.; Nohalez, A.; Sanchez-Osorio, J.; Vazquez, J.M.; Roca, J.; Parrilla, I.; Gil, M.A.; Cuello, C. Nonsurgical deep uterine transfer of vitrified, in vivo-derived, porcine embryos is as effective as the default surgical approach. Sci. Rep. 2015, 5, 10587. [Google Scholar] [CrossRef]
- Martinez, E.A.; Angel, M.A.; Cuello, C.; Sanchez-Osorio, J.; Gomis, J.; Parrilla, I.; Vila, J.; Colina, I.; Diaz, M.; Reixach, J.; et al. Successful non-surgical deep uterine transfer of porcine morulae after 24 hour culture in a chemically defined medium. PLoS ONE 2014. [Google Scholar] [CrossRef] [PubMed]
- Wright, J. Photographic illustrations of embryo developmental stage and quality codes. In Manual of the International Embryo Transfer Society; IETS: Savoy, IL, USA, 1998; pp. 167–170. [Google Scholar]
- Abeydeera, L.R.; Day, B.N. In vitro penetration of pig oocytes in a modified Tris-buffered medium: Effect of BSA, caffeine and calcium. Theriogenology 1997, 48, 537–544. [Google Scholar] [CrossRef]
- Petters, R.M.; Wells, K.D. Culture of pig embryos. J. Reprod. Fertil. Suppl. 1993, 48, 61–73. [Google Scholar] [CrossRef] [PubMed]
- Martinez, C.A.; Cambra, J.M.; Gil, M.A.; Parrilla, I.; Alvarez-Rodriguez, M.; Rodriguez-Martinez, H.; Cuello, C.; Martinez, E.A. Seminal Plasma Induces Overexpression of Genes Associated with Embryo Development and Implantation in Day-6 Porcine Blastocysts. Int. J. Mol. Sci. 2020, 21, 3662. [Google Scholar] [CrossRef] [PubMed]
- Van Gelder, R.N.; von Zastrow, M.E.; Yool, A.; Dement, W.C.; Barchas, J.D.; Eberwine, J.H. Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc. Natl. Acad. Sci. USA 1990, 87, 1663–1667. [Google Scholar] [CrossRef] [PubMed]
- Bolstad, B.M.; Irizarry, R.A.; Astrand, M.; Speed, T.P. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics 2003, 19, 185–193. [Google Scholar] [CrossRef] [PubMed]
- Kanehisa, M. The KEGG database. Novartis Found. Symp. 2002, 247, 91–93, 119–128, 244–252. [Google Scholar] [PubMed]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef] [PubMed]
- NCBI resource coordinators Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2016, 44, D7–D19. [CrossRef] [PubMed]
- Yates, A.D.; Achuthan, P.; Akanni, W.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Azov, A.G.; Bennett, R.; et al. Ensembl 2020. Nucleic Acids Res. 2019, 48, D682–D688. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Marijanovic, Z.; Laubner, D.; Moller, G.; Gege, C.; Husen, B.; Adamski, J.; Breitling, R. Closing the gap: Identification of human 3-ketosteroid reductase, the last unknown enzyme of mammalian cholesterol biosynthesis. Mol. Endocrinol. 2003, 17, 1715–1725. [Google Scholar] [CrossRef] [PubMed]
- Xin, Y.; Li, C.; Guo, Y.; Xiao, R.; Zhang, H.; Zhou, G. RNA-Seq analysis reveals a negative role of MSMO1 with a synergized NSDHL expression during adipogenesis of 3T3-L1. Biosci. Biotechnol. Biochem. 2019, 83, 641–652. [Google Scholar] [CrossRef] [PubMed]
- Morrisett, J.D.; Pownall, H.J.; Gotto, A.M.J. Bovine serum albumin. Study of the fatty acid and steroid binding sites using spin-labeled lipids. J. Biol. Chem. 1975, 250, 2487–2494. [Google Scholar] [CrossRef]
- Watanabe, S.; Tani, T.; Watanabe, S.; Seno, M. Effects of free fatty acids on the binding of steroid hormones to bovine serum albumin. Lipids 1990, 25, 633–638. [Google Scholar] [CrossRef]
- del Collado, M.; Saraiva, N.Z.; Lopes, F.L.; Gaspar, R.C.; Padilha, L.C.; Costa, R.R.; Rossi, G.F.; Vantini, R.; Garcia, J.M. Influence of bovine serum albumin and fetal bovine serum supplementation during in vitro maturation on lipid and mitochondrial behaviour in oocytes and lipid accumulation in bovine embryos. Reprod. Fertil. Dev. 2016, 28, 1721–1732. [Google Scholar] [CrossRef]
- Quinones, Q.J.; de Ridder, G.G.; Pizzo, S.V. GRP78: A chaperone with diverse roles beyond the endoplasmic reticulum. Histol. Histopathol. 2008, 23, 1409–1416. [Google Scholar] [CrossRef]
- Ibrahim, I.M.; Abdelmalek, D.H.; Elfiky, A.A. GRP78: A cell’s response to stress. Life Sci. 2019, 226, 156–163. [Google Scholar] [CrossRef]
- Lim, K.T.; Jang, G.; Ko, K.H.; Lee, W.W.; Park, H.J.; Kim, J.J.; Lee, S.H.; Hwang, W.S.; Lee, B.C.; Kang, S.K. Improved in vitro bovine embryo development and increased efficiency in producing viable calves using defined media. Theriogenology 2007, 67, 293–302. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Liu, Y.; Kong, D. Mechanism of chromosomal DNA replication initiation and replication fork stabilization in eukaryotes. Sci. China. Life Sci. 2014, 57, 482–487. [Google Scholar] [CrossRef]
- Díaz-Díaz, C.; Fernandez de Manuel, L.; Jimenez-Carretero, D.; Montoya, M.C.; Clavería, C.; Torres, M. Pluripotency Surveillance by Myc-Driven Competitive Elimination of Differentiating Cells. Dev. Cell 2017, 42, 585–599.e4. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.-B.; Zhang, K.; Folger, J.K.; Knott, J.G.; Smith, G.W. Evidence supporting a functional requirement of SMAD4 for bovine preimplantation embryonic development: A potential link to embryotrophic actions of follistatin. Biol. Reprod. 2014, 91, 62. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chu, G.C.; Dunn, N.R.; Anderson, D.C.; Oxburgh, L.; Robertson, E.J. Differential requirements for Smad4 in TGFbeta-dependent patterning of the early mouse embryo. Development 2004, 131, 3501–3512. [Google Scholar] [CrossRef]
- Massagué, J. TGFβ signalling in context. Nat. Rev. Mol. Cell Biol. 2012, 13, 616–630. [Google Scholar] [CrossRef] [PubMed]
- Roberts, A.B.; Sporn, M.B. Differential expression of the TGF-beta isoforms in embryogenesis suggests specific roles in developing and adult tissues. Mol. Reprod. Dev. 1992, 32, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez, A.; Allegrucci, C.; Alberio, R. Modulation of pluripotency in the porcine embryo and iPS cells. PLoS ONE 2012, 7, e49079. [Google Scholar] [CrossRef] [PubMed]
- Muchardt, C.; Yaniv, M. The mammalian SWI/SNF complex and the control of cell growth. Semin. Cell Dev. Biol. 1999, 10, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Duan, X.; Chen, K.-L.; Zhang, Y.; Cui, X.-S.; Kim, N.-H.; Sun, S.-C. ROCK inhibition prevents early mouse embryo development. Histochem. Cell Biol. 2014, 142, 227–233. [Google Scholar] [CrossRef]
- Zhang, J.Y.; Dong, H.S.; Oqani, R.K.; Lin, T.; Kang, J.W.; Jin, D. Il Distinct roles of ROCK1 and ROCK2 during development of porcine preimplantation embryos. Reproduction 2014, 148, 99–107. [Google Scholar] [CrossRef] [PubMed]
- Goossens, K.; Van Soom, A.; Van Zeveren, A.; Favoreel, H.; Peelman, L.J. Quantification of fibronectin 1 (FN1) splice variants, including two novel ones, and analysis of integrins as candidate FN1 receptors in bovine preimplantation embryos. BMC Dev. Biol. 2009, 9, 1. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.; Jeong, Y.I.; Park, S.M.; Lee, J.Y.; Kim, J.H.; Park, S.W.; Hossein, M.S.; Jeong, Y.W.; Kim, S.; Hyun, S.H.; et al. Beneficial effects of brain-derived neurotropic factor on in vitro maturation of porcine oocytes. Reproduction 2007, 134, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Du, F.; Liu, X.; Ruan, Q.; Wu, Z.; Lei, C.; Deng, Y.; Luo, C.; Jiang, J.; Shi, D.; et al. Brain-derived neurotrophic factor (BDNF) is expressed in buffalo (Bubalus bubalis) ovarian follicles and promotes oocyte maturation and early embryonic development. Theriogenology 2019, 130, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Rizos, D.; Clemente, M.; Bermejo-Alvarez, P.; de La Fuente, J.; Lonergan, P.; Gutiérrez-Adán, A. Consequences of in vitro culture conditions on embryo development and quality. Reprod. Domest. Anim. 2008, 43 (Suppl. 4), 44–50. [Google Scholar] [CrossRef]
- Canovas, S.; Ross, P.J.; Kelsey, G.; Coy, P. DNA Methylation in Embryo Development: Epigenetic Impact of ART (Assisted Reproductive Technologies). Bioessays 2017, 39. [Google Scholar] [CrossRef] [PubMed]
- Petrussa, L.; Van de Velde, H.; De Rycke, M. Dynamic regulation of DNA methyltransferases in human oocytes and preimplantation embryos after assisted reproductive technologies. Mol. Hum. Reprod. 2014, 20, 861–874. [Google Scholar] [CrossRef]
- Campden, R.I.; Zhang, Y. The role of lysosomal cysteine cathepsins in NLRP3 inflammasome activation. Arch. Biochem. Biophys. 2019, 670, 32–42. [Google Scholar] [CrossRef]
- Eskelinen, E.-L.; Saftig, P. Autophagy: A lysosomal degradation pathway with a central role in health and disease. Biochim. Biophys. Acta 2009, 1793, 664–673. [Google Scholar] [CrossRef]
- Hu, Y.-X.; Han, X.-S.; Jing, Q. Autophagy in Development and Differentiation. Adv. Exp. Med. Biol. 2019, 1206, 469–487. [Google Scholar] [CrossRef]
- Leese, H.J. Quiet please, do not disturb: A hypothesis of embryo metabolism and viability. Bioessays 2002, 24, 845–849. [Google Scholar] [CrossRef]
- Baumann, C.G.; Morris, D.G.; Sreenan, J.M.; Leese, H.J. The quiet embryo hypothesis: Molecular characteristics favoring viability. Mol. Reprod. Dev. 2007, 74, 1345–1353. [Google Scholar] [CrossRef] [PubMed]
- Leese, H.J.; Guerif, F.; Allgar, V.; Brison, D.R.; Lundin, K.; Sturmey, R.G. Biological optimization, the Goldilocks principle, and how much is lagom in the preimplantation embryo. Mol. Reprod. Dev. 2016, 83, 748–754. [Google Scholar] [CrossRef]
- El Mouatassim, S.; Guérin, P.; Ménézo, Y. Mammalian oviduct and protection against free oxygen radicals: Expression of genes encoding antioxidant enzymes in human and mouse. Eur. J. Obstet. Gynecol. Reprod. Biol. 2000, 89, 1–6. [Google Scholar] [CrossRef]
- Guerin, P.; El Mouatassim, S.; Menezo, Y. Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Hum. Reprod. Update 2001, 7, 175–189. [Google Scholar] [CrossRef]
- Pompella, A.; Visvikis, A.; Paolicchi, A.; De Tata, V.; Casini, A.F. The changing faces of glutathione, a cellular protagonist. Biochem. Pharmacol. 2003, 66, 1499–1503. [Google Scholar] [CrossRef]
- Nordberg, J.; Arnér, E.S. Reactive oxygen species, antioxidants, and the mammalian thioredoxin system. Free Radic. Biol. Med. 2001, 31, 1287–1312. [Google Scholar] [CrossRef]
- Harris, E.D. Regulation of antioxidant enzymes. FASEB J. 1992, 6, 2675–2683. [Google Scholar] [CrossRef] [PubMed]
- Budanov, A.V.; Sablina, A.A.; Feinstein, E.; Koonin, E.V.; Chumakov, P.M. Regeneration of peroxiredoxins by p53-regulated sestrins, homologs of bacterial AhpD. Science 2004, 304, 596–600. [Google Scholar] [CrossRef] [PubMed]
- Cadet, J.; Wagner, J.R. DNA base damage by reactive oxygen species, oxidizing agents, and UV radiation. Cold Spring Harb. Perspect. Biol. 2013, 5. [Google Scholar] [CrossRef] [PubMed]
- Menezo, Y.J.; Russo, G.; Tosti, E.; El Mouatassim, S.; Benkhalifa, M. Expression profile of genes coding for DNA repair in human oocytes using pangenomic microarrays, with a special focus on ROS linked decays. J. Assist. Reprod. Genet. 2007, 24, 513–520. [Google Scholar] [CrossRef] [PubMed]
- He, P.; Li, Z.; Xu, F.; Ru, G.; Huang, Y.; Lin, E.; Peng, S. AMPK Activity Contributes to G2 Arrest and DNA Damage Decrease via p53/p21 Pathways in Oxidatively Damaged Mouse Zygotes. Front. Cell Dev. Biol. 2020, 8, 539485. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.-H.; Ju, J.-Q.; Li, X.-H.; Xu, Y.; Wang, J.-D.; Ren, Y.-P.; Lu, X.; Sun, S.-C. Inhibition of survivin induces spindle disorganization, chromosome misalignment, and DNA damage during mouse embryo development. Cell Cycle 2020, 19, 2148–2157. [Google Scholar] [CrossRef] [PubMed]
- Hu, L.-L.; Liao, B.-Y.; Wei, J.-X.; Ling, Y.-L.; Wei, Y.-X.; Liu, Z.-L.; Luo, X.-Q.; Wang, J.-L. Podophyllotoxin Exposure Causes Spindle Defects and DNA Damage-Induced Apoptosis in Mouse Fertilized Oocytes and Early Embryos. Front. Cell Dev. Biol. 2020, 8, 600521. [Google Scholar] [CrossRef] [PubMed]
- Pegg, A.E.; Byers, T.L. Repair of DNA containing O6-alkylguanine. FASEB J. 1992, 6, 2302–2310. [Google Scholar] [CrossRef] [PubMed]
- Imani Nejad, M.; Yang, D.; Shen, B.; Gates, K.S. Oxidative activation of leinamycin E1 triggers alkylation of guanine residues in double-stranded DNA. Chem. Commun. Camb. 2018, 54, 256–259. [Google Scholar] [CrossRef]
- Zumbrun, S.D.; Hoffman, B.; Liebermann, D.A. Distinct mechanisms are utilized to induce stress sensor gadd45b by different stress stimuli. J. Cell. Biochem. 2009, 108, 1220–1231. [Google Scholar] [CrossRef]
- Alekseev, S.; Luijsterburg, M.S.; Pines, A.; Geverts, B.; Mari, P.-O.; Giglia-Mari, G.; Lans, H.; Houtsmuller, A.B.; Mullenders, L.H.F.; Hoeijmakers, J.H.J.; et al. Cellular concentrations of DDB2 regulate dynamic binding of DDB1 at UV-induced DNA damage. Mol. Cell. Biol. 2008, 28, 7402–7413. [Google Scholar] [CrossRef]
- Poetsch, A.R. The genomics of oxidative DNA damage, repair, and resulting mutagenesis. Comput. Struct. Biotechnol. J. 2020, 18, 207–219. [Google Scholar] [CrossRef]
- García-Rodríguez, A.; Gosálvez, J.; Agarwal, A.; Roy, R.; Johnston, S. DNA Damage and Repair in Human Reproductive Cells. Int. J. Mol. Sci. 2018, 20, 31. [Google Scholar] [CrossRef]
- Ménézo, Y.; Dale, B.; Cohen, M. DNA damage and repair in human oocytes and embryos: A review. Zygote 2010, 18, 357–365. [Google Scholar] [CrossRef] [PubMed]
- Tomasini, R.; Samir, A.A.; Vaccaro, M.I.; Pebusque, M.J.; Dagorn, J.C.; Iovanna, J.L.; Dusetti, N.J. Molecular and functional characterization of the stress-induced protein (SIP) gene and its two transcripts generated by alternative splicing. SIP induced by stress and promotes cell death. J. Biol. Chem. 2001, 276, 44185–44192. [Google Scholar] [CrossRef] [PubMed]
- Gommeaux, J.; Cano, C.; Garcia, S.; Gironella, M.; Pietri, S.; Culcasi, M.; Pébusque, M.-J.; Malissen, B.; Dusetti, N.; Iovanna, J.; et al. Colitis and colitis-associated cancer are exacerbated in mice deficient for tumor protein 53-induced nuclear protein 1. Mol. Cell. Biol. 2007, 27, 2215–2228. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.-S.; Jeong, Y.-J.; Jun, J.-H.; Kim, N.-H. Insulin-like growth factor-I alters apoptosis related genes and reduces apoptosis in porcine parthenotes developing in vitro. Theriogenology 2005, 63, 1070–1080. [Google Scholar] [CrossRef] [PubMed]
- Park, S.Y.; Kim, E.Y.; Cui, X.S.; Tae, J.C.; Lee, W.D.; Kim, N.H.; Park, S.P.; Lim, J.H. Increase in DNA fragmentation and apoptosis-related gene expression in frozen-thawed bovine blastocysts. Zygote 2006, 14, 125–131. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Zhang, D. Effect of retinoic acid on apoptosis and expression of Fas proteins in mouse blastocysts cultured in vitro. J. Huazhong Univ. Sci. Technolog. Med. Sci. 2008, 28, 239–242. [Google Scholar] [CrossRef]
- Susin, S.A.; Lorenzo, H.K.; Zamzami, N.; Marzo, I.; Snow, B.E.; Brothers, G.M.; Mangion, J.; Jacotot, E.; Costantini, P.; Loeffler, M.; et al. Molecular characterization of mitochondrial apoptosis-inducing factor. Nature 1999, 397, 441–446. [Google Scholar] [CrossRef]
- Boumela, I.; Assou, S.; Aouacheria, A.; Haouzi, D.; Dechaud, H.; De Vos, J.; Handyside, A.; Hamamah, S. Involvement of BCL2 family members in the regulation of human oocyte and early embryo survival and death: Gene expression and beyond. Reproduction 2011, 141, 549–561. [Google Scholar] [CrossRef]
- Gil, M.A.; Cuello, C.; Parrilla, I.; Vazquez, J.M.; Roca, J.; Martinez, E.A. Advances in Swine In vitro Embryo Production Technologies. Reprod. Domest. Anim. 2010, 45, 40–48. [Google Scholar] [CrossRef]








| Gene | ID | Forward (5′→3′) | Reverse (5′→3′) | Size | Efficiency | R2 |
|---|---|---|---|---|---|---|
| BAX | NM_214285.1 | GCTGACGGCAACTTCAACTG | GCGTCCCAAAGTAGGAGAGG | 202 | 90.3 | 0.993 |
| BMP4 | NM_001101031 | TACATGCGGGATCTTTACCG | AAGCAGAGTTTTCGCTGGTC | 172 | 110.1 | 0.995 |
| GADD45B | XM_005654701 | ACCCTCATCCAGTCGTTTTG | GCTTTTCCAGGCATCTGTGT | 171 | 104.5 | 0.998 |
| GPX4 | NM_214407.1 | GAGCTTTAGCCGCCTGTTC | GGTACTTGTCCAGGTTCACCA | 176 | 105.7 | 0.997 |
| HSD17B7 | NM_001185137 | AGCGATTCATGTGTTCTCCA | GGATGTCCTCAAGGCTGAAA | 218 | 99.1 | 0.994 |
| HSPA5 | XM_001927795 | GGAAACTGCTGAGGCTTATTTG | TCCCCTTCCCTCTTATCCAG | 189 | 102.7 | 0.993 |
| MYC | NM_001005154 | TCGGACTCTCTGCTCTCCTC | GCTGCCTCTTTTCCACAGAA | 157 | 102.0 | 0.997 |
| POLB | XM_005657652 | GTTTGCCAGCTTCCCAGTAA | CCACAGGACGGATTGTGTATT | 193 | 98.6 | 0.992 |
| SCARB2 | NM_001244155 | TGGTTTTCCCAGTGATGTATCT | CAGGTGAAGATCAGACCGAAG | 154 | 98.5 | 0.996 |
| SMARCA1 | XM_003135362 | CCTCCAAAACAGCCAAATGT | GGTGTAAGAGGTTCAGCTCCA | 191 | 94.6 | 0.995 |
| SOD1 | NM_001190422.1 | GGATCAAGAGAGGCACGTTG | CTGCCCAAGTCATCTGGTTT | 159 | 91.8 | 0.999 |
| TP53INP1 | XM_001925224 | CCAGGTAGTCCCAGAGTGGA | TAAGATTTTGGCGACGAAGG | 184 | 91.4 | 0.999 |
| GAPDH | NM_001206359 | ATCACTGCCACCCAGAAGAC | AGATCCACAACCGACACGTT | 194 | 96.6 | 0.999 |
| RPL19 | XM_003131509 | AGCCTGTGACTGTCCATTCC | AGTACCCTTCCGCTTACCGA | 95 | 99.3 | 0.998 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cambra, J.M.; Martinez, E.A.; Rodriguez-Martinez, H.; Gil, M.A.; Cuello, C. Transcriptional Profiling of Porcine Blastocysts Produced In Vitro in a Chemically Defined Culture Medium. Animals 2021, 11, 1414. https://doi.org/10.3390/ani11051414
Cambra JM, Martinez EA, Rodriguez-Martinez H, Gil MA, Cuello C. Transcriptional Profiling of Porcine Blastocysts Produced In Vitro in a Chemically Defined Culture Medium. Animals. 2021; 11(5):1414. https://doi.org/10.3390/ani11051414
Chicago/Turabian StyleCambra, Josep M., Emilio A. Martinez, Heriberto Rodriguez-Martinez, Maria A. Gil, and Cristina Cuello. 2021. "Transcriptional Profiling of Porcine Blastocysts Produced In Vitro in a Chemically Defined Culture Medium" Animals 11, no. 5: 1414. https://doi.org/10.3390/ani11051414
APA StyleCambra, J. M., Martinez, E. A., Rodriguez-Martinez, H., Gil, M. A., & Cuello, C. (2021). Transcriptional Profiling of Porcine Blastocysts Produced In Vitro in a Chemically Defined Culture Medium. Animals, 11(5), 1414. https://doi.org/10.3390/ani11051414

