Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Serodiagnosis of SRLV
2.3. Blood Sampling and RNA Isolation
RNA Quality Assessment
2.4. Microarray Analysis
2.5. Signal Detection and Statistical Analysis
2.6. Validation of Microarray Data
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sihvonen, L.; Hirvelä-Koski, V.; Nuotio, L.; Kokkonen, U.M. Serological survey and epidemiological investigation of maedi-visna in sheep in Finland. Vet. Microbiol. 1999, 65, 265–270. [Google Scholar] [CrossRef] [Scilit]
- Cork, L.C.; Hadlow, W.J.; Crawford, T.B.; Gorham, J.R.; Piper, R.C. Infectious leukoencephalomyelitis of young goats. J. Infect. Dis. 1974, 129, 134–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adams, D.S.; Oliver, R.E.; Ameghino, E.; DeMartini, J.C.; Verwoerd, D.W.; Houwers, D.J.; Waghela, S.; Gorham, J.R.; Hyllseth, B.; Dawson, M. Global survey of serological evidence of caprine arthritis-encephalitis virus infection. Vet. Rec. 1984, 115, 493–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaba, J.; Ganter, M.; Czopowicz, M. Humoral immune response to caprine arthritis-encephalitis virus in goat herds. Cent. J. Immunol. 2010, 35, 196–198. [Google Scholar]
- McNeilly, T.N.; Baker, A.; Brown, J.K.; Collie, D.; MacLachlan, G.; Rhind, S.M.; Harkiss, G.D. Role of Alveolar Macrophages in Respiratory Transmission of Visna/Maedi Virus. J. Virol. 2008, 82, 1526–1536. [Google Scholar] [CrossRef] [Scilit]
- Villoria, M.; Leginagoikoa, I.; Luján, L.; Pérez, M.; Salazar, E.; Berriatua, E.; Juste, R.A.; Minguijón, E. Detection of Small Ruminant Lentivirus in environmental samples of air and water. Small Rumin. Res. 2013, 110, 155–160. [Google Scholar] [CrossRef] [Scilit]
- Nowicka, D.; Czopowicz, M.; Szalus-Jordanow, O.; Witkowski, L.; Bagnicka, E.; Kaba, J. Seropositive bucks and within-herd prevalence of small ruminant lentivirus infection. Cent. Eur. J. Immunol. 2015, 40, 283–286. [Google Scholar] [CrossRef] [Scilit]
- Blacklaws, B.A. Small ruminant lentiviruses: Immunopathogenesis of visna-maedi and caprine arthritis and encephalitis virus. Comp. Immunol. Microbiol. Infect. Dis. 2012, 35, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Gendelman, H.E.; Narayan, O.; Molineaux, S.; Clements, J.E.; Ghotbi, Z. Slow, persistent replication of lentiviruses: Role of tissue macrophages and macrophage precursors in bone marrow. Proc. Natl. Acad. Sci. USA 1985, 82, 7086–7090. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorrell, M.D.; Brandon, M.R.; Sheffer, D.; Adams, R.J.; Narayan, O. Ovine lentivirus is macrophagetropic and does not replicate productively in T lymphocytes. J. Virol. 1992, 66, 2679–2688. [Google Scholar] [CrossRef] [Scilit]
- Jarczak, J.; Słoniewska, D.; Kaba, J.; Bagnicka, E. The expression of cytokines in the milk somatic cells, blood leukocytes and serum of goats infected with small ruminant lentivirus. BMC Vet. Res. 2019, 15, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Reczyńska, D.; Zalewska, M.; Czopowicz, M.; Kaba, J.; Zwierzchowski, L.; Bagnicka, E. Small ruminant lentivirus infection influences expression of acute phase proteins and cathelicidin genes in milk somatic cells and peripheral blood leukocytes of dairy goats. Vet. Res. 2018, 49, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Reczyńska, D.; Zalewska, M.; Czopowicz, M.; Kaba, J.; Zwierzchowski, L.; Bagnicka, E. Acute phase protein levels as an auxiliary tool in diagnosing viral diseases in ruminants—A review. Viruses 2018, 10, 502. [Google Scholar] [CrossRef] [Scilit]
- Ravazzolo, A.P.; Nenci, C.; Vogt, H.R.; Waldvogel, A.; Obexer-Ruff, G.; Peterhans, E.; Bertoni, G. Viral load, organ distribution, histopathological lesions, and cytokine mRNA expression in goats infected with a molecular clone of the caprine arthritis encephalitis virus. Virology 2006, 350, 116–127. [Google Scholar] [CrossRef] [Scilit]
- Kaba, J.; Winnicka, A.; Zaleska, M.; Nowicki, M.; Bagnicka, E. Influence of chronic caprine arthritis-encephalitis virus infection on the population of peripheral blood leukocytes. Pol. J. Vet. Sci. 2011, 14, 585–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaba, J.; Strzałkowska, N.; Jóźwik, A.; Krzyzewski, J.; Bagnicka, E. Twelve-year cohort study on the influence of caprine arthritis-encephalitis virus infection on milk yield and composition. J. Dairy Sci. 2012, 95, 1617–1622. [Google Scholar] [CrossRef] [Scilit]
- Pławińska-Czarnak, J.; Bagnicka, E.; Kaba, J.; Bogdan, J.; Zarzyńska, J. Analysis of the CAEV Infection Impact on the Milk Yield and Milk Scc of Polish Dairy Goats. J. Microbiol. Biotechnol. Food Sci. 2014, 10, 39–42. [Google Scholar]
- Jarczak, J.; Kaba, J.; Reczyńska, D.; Bagnicka, E. Impaired expression of cytokines as a result of viral infections with an emphasis on small ruminant lentivirus infection in goats. Viruses 2016, 8, 186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pławińska-Czarnak, J.; Zarzyńska, J.; Majewska, A.; Jank, M.; Kaba, J.; Bogdan, J.; Anusz, K.; Bagnicka, E. Selected tissues of two polish goat breeds do not differ on genomic level. Anim. Sci. Pap. Reports 2019, 37, 53–64. [Google Scholar]
- Kowalski, M. Normy żywienia kóz mlecznych. (Standard of ruminants’ feeding: Nutrient) [In Polish]. In Normy Żywienia Przeżuwaczy: Wartość Pokarmowa Francuskich i Krajowych Pasz dla Przeżuwaczy. (Standard of Dairy Goats’ Feeding. In: NRIAP-INTA) [In Polish]; Strzelecki, J., Ed.; Research Institute of Animal Production (IZ PIB-INRA): Kraków, Poland, 2009; pp. 109–119. [Google Scholar]
- Czopowicz, M.; Szaluś-Jordanow, O.; Moroz, A.; Mickiewicz, M.; Witkowski, L.; Markowska-Daniel, I.; Bagnicka, E.; Kaba, J. Use of two commercial caprine arthritis-encephalitis immunoenzymatic assays for screening of arthritic goats. J. Vet. Diagnostic Investig. 2018, 30, 36–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaba, J.; Rola, M.; Materniak, M.; Kuźmak, J.; Nowicki, M. Isolation and characterization of caprine arthritis encephalitis virus in goats from Poland. Pol. J. Vet. Sci. 2009, 12, 183–188. [Google Scholar]
- Nalbert, T.; Czopowicz, M.; Szaluś-Jordanow, O.; Moroz, A.; Mickiewicz, M.; Witkowski, L.; Markowska-Daniel, I.; Puchała, R.; Bagnicka, E.; Kaba, J. Effect of immediately-after-birth weaning on the development of goat kids born to small ruminant lentivirus-positive dams. Animals 2019, 9, 822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pławińska-Czarnak, J.; Ochnio, L.; Zarzyńska, J.; Bogdan, J.; Kaba, J.; Majewska, A.; Bagnicka, E. Design and implementation of a database enhancing the collection, management and analysis of data in an animal sciences project. Anim. Sci. Pap. Rep. 2018, 36, 159–170. [Google Scholar]
- Kõressaar, T.; Lepamets, M.; Kaplinski, L.; Raime, K.; Andreson, R.; Remm, M. Primer3-masker: Integrating masking of template sequence with primer design software. Bioinformatics 2018, 34, 1937–1938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kibbe, W.A. OligoCalc: An online oligonucleotide properties calculator. Nucleic Acids Res. 2007, 35, 43–46. [Google Scholar] [CrossRef] [Scilit]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [Scilit]
- Finot, L.; Marnet, P.G.; Dessauge, F. Reference gene selection for quantitative real-time PCR normalization: Application in the caprine mammary gland. Small Rumin. Res. 2011, 95, 20–26. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Elsevier Pathway Studio. 2018–2021. Available online: www.pathwaystudio.com (accessed on 26 February 2021).
- Morikawa, M.; Derynck, R.; Miyazono, K. TGF-β and the TGF-β family: Context-dependent roles in cell and tissue physiology. Cold Spring Harb. Perspect. Biol. 2016, 8, a021873. [Google Scholar] [CrossRef] [Scilit]
- Yoshikawa, R.; Izumi, T.; Nakano, Y.; Yamada, E.; Moriwaki, M.; Misawa, N.; Ren, F.; Kobayashi, T.; Koyanagi, Y.; Sato, K. Small ruminant lentiviral Vif proteins commonly utilize cyclophilin A, an evolutionarily and structurally conserved protein, to degrade ovine and caprine APOBEC3 proteins. Microbiol. Immunol. 2016, 60, 427–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshida, T.; Hamano, A.; Ueda, A.; Takeuchi, H.; Yamaoka, S. Human SMOOTHENED inhibits human immunodeficiency virus type 1 infection. Biochem. Biophys. Res. Commun. 2017, 493, 132–138. [Google Scholar] [CrossRef] [Scilit]
- Qu, L.; Caterina, M.J. Accelerating the reversal of inflammatory pain with NPD1 and its receptor GPR37. J. Clin. Investig. 2018, 128, 3246–3249. [Google Scholar] [CrossRef] [Scilit]
- Stonos, N.; Wootton, S.K.; Karrow, N. Immunogenetics of small ruminant lentiviral infections. Viruses 2014, 6, 3311–3333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pisoni, G.; Castiglioni, B.; Stella, A.; Boettcher, P.J.; Genini, S.; Giuffra, E.; Moroni, P. Microarray analysis of gene expression of milk leukocytes in healthy goats. Vet. Res. Commun. 2008, 32, 219–221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pisoni, G.; Moroni, P.; Genini, S.; Stella, A.; Boettcher, P.J.; Cremonesi, P.; Scaccabarozzi, L.; Giuffra, E.; Castiglioni, B. Differentially expressed genes associated with Staphylococcus aureus mastitis in dairy goats. Vet. Immunol. Immunopathol. 2010, 135, 208–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brym, P.; Kamiński, S. Microarray analysis of differential gene expression profiles in blood cells of naturally BLV-infected and uninfected Holstein–Friesian cows. Mol. Biol. Rep. 2017, 44, 109–127. [Google Scholar] [CrossRef] [Scilit]
- Gonçalves, C.M.; Castro, M.A.A.; Henriques, T.; Oliveira, M.I.; Pinheiro, H.C.; Oliveira, C.; Sreenu, V.B.; Evans, E.J.; Davis, S.J.; Moreira, A.; et al. Molecular cloning and analysis of SSc5D, a new member of the scavenger receptor cysteine-rich superfamily. Mol. Immunol. 2009, 46, 2585–2596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narayan, O.; Kennedy-Stoskopf, S.; Sheffer, D.; Griffin, D.E.; Clements, J.E. Activation of caprine arthritis-encephalitis virus expression during maturation of monocytes to macrophages. Infect. Immun. 1983, 41, 67–73. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vacca, P.; Cantoni, C.; Vitale, M.; Prato, C.; Canegallo, F.; Fenoglio, D.; Ragni, N.; Moretta, L.; Mingari, M.C. Crosstalk between decidual NK and CD14+ myelomonocytic cells results in induction of Tregs and immunosuppression. Proc. Natl. Acad. Sci. USA 2010, 107, 11918–11923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cristinelli, S.; Angelino, P.; Janowczyk, A.; Delorenzi, M.; Ciuffi, A. HIV modifies the m6A and m5C epitranscriptomic landscape of the host cell. bioRxiv 2021. [Google Scholar] [CrossRef] [Scilit]
- Ijaz, B.; Ahmad, W.; Das, T.; Shabbiri, K.; Husnain, T.; Hassan, S. HCV infection causes cirrhosis in human by step-wise regulation of host genes involved in cellular functioning and defense during fibrosis: Identification of bio-markers. Genes Dis. 2019, 6, 304–317. [Google Scholar] [CrossRef] [Scilit]
- Schwefel, D.; Fröhlich, C.; Eichhorst, J.; Wiesner, B.; Behlke, J.; Aravind, L.; Daumke, O. Structural basis of oligomerization in septin-like GTPase of immunity-associated protein 2 (GIMAP2). Proc. Natl. Acad. Sci. USA 2010, 107, 20299–20304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ponti, W.; Paape, M.; Bronzo, V.; Pisoni, G.; Pollera, C.; Moroni, P. Phenotypic alteration of blood and milk leukocytes in goats naturally infected with caprine arthritis-encephalitis virus (CAEV). Small Rumin. Res. 2008, 78, 176–180. [Google Scholar] [CrossRef] [Scilit]
- Marazziti, D.; Golini, E.; Gallo, A.; Lombardi, M.S.; Matteoni, R.; Tocchini-Valentini, G.P. Cloning of GPR37, a gene located on chromosome 7 encoding a putative g- protein-coupled peptide receptor, from a human frontal brain EST library. Genomics 1997, 45, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Marazziti, D.; Golini, E.; Mandillo, S.; Magrelli, A.; Witke, W.; Matteoni, R.; Tocchini-Valentini, G.P. Altered dopamine signaling and MPTP resistance in mice lacking the Parkinson’s disease-associated GPR37/parkin-associated endothelin-like receptor. Proc. Natl. Acad. Sci. USA 2004, 101, 10189–10194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marazziti, D.; Di Pietro, C.; Golini, E.; Mandillo, S.; Matteoni, R.; Tocchini-Valentini, G.P. Induction of macroautophagy by overexpression of the Parkinson’s disease-associated GPR37 receptor. FASEB J. 2009, 23, 1978–1987. [Google Scholar] [CrossRef] [Scilit]
- Gandía, J.; Fernández-Dueñas, V.; Moratõ, X.; Caltabiano, G.; González-Muñiz, R.; Pardo, L.; Stagljar, I.; Ciruela, F. The Parkinson’s disease-associated GPR37 receptor-mediated cytotoxicity is controlled by its intracellular cysteine-rich domain. J. Neurochem. 2013, 125, 362–372. [Google Scholar] [CrossRef] [Scilit]
- Lopes, J.P.; Morató, X.; Souza, C.; Pinhal, C.; Machado, N.J.; Canas, P.M.; Silva, H.B.; Stagljar, I.; Gandía, J.; Fernández-Dueñas, V.; et al. The role of parkinson’s disease-associated receptor GPR37 in the hippocampus: Functional interplay with the adenosinergic system. J. Neurochem. 2015, 134, 135–146. [Google Scholar] [CrossRef] [Scilit]
- Meyer, R.C.; Giddens, M.M.; Schaefer, S.A.; Hall, R.A. GPR37 and GPR37L1 are receptors for the neuroprotective and glioprotective factors prosaptide and prosaposin. Proc. Natl. Acad. Sci. USA 2013, 110, 9529–9534. [Google Scholar] [CrossRef] [Scilit]
- Yang, H.J.; Vainshtein, A.; Maik-Rachline, G.; Peles, E. G protein-coupled receptor 37 is a negative regulator of oligodendrocyte differentiation and myelination. Nat. Commun. 2016, 7, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Zhu, C.; Huang, X.; Cai, J.; Wang, H.; Wang, X.; He, S.; Liu, C.; Yang, X.; Zhang, Y.; et al. A low level of GPR37 is associated with human hepatocellular carcinoma progression and poor patient survival. Pathol. Res. Pract. 2014, 210, 885–892. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Wang, Y.; Nan, X.; He, S.; Xu, X.; Zhu, X.; Tang, J.; Yang, X.; Yao, L.; Wang, X.; et al. The role of the orphan G protein-coupled receptor 37 (GPR37) in multiple myeloma cells. Leuk. Res. 2014, 38, 225–235. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Hu, L.; Zang, M.; Zhang, B.; Duan, Y.; Fan, Z.; Li, J.; Su, L.; Yan, M.; Zhu, Z.; et al. REG4 promotes peritoneal metastasis of gastric cancer through GPR37. Oncotarget 2016, 7, 27874–27888. [Google Scholar] [CrossRef] [Scilit]
- Zheng, X.; Asico, L.D.; Ma, X.; Konkalmatt, P.R. G protein-coupled receptor 37L1 regulates renal sodium transport and blood pressure. Am. J. Physiol. Ren. Physiol. 2019, 316, F506–F516. [Google Scholar] [CrossRef] [Scilit]
- Bang, S.; Xie, Y.K.; Zhang, Z.J.; Wang, Z.; Xu, Z.Z.; Ji, R.R. GPR37 regulates macrophage phagocytosis and resolution of inflammatory pain. J. Clin. Investig. 2018, 128, 3568–3582. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Steger, A.; Mahner, S.; Jeschke, U.; Heidegger, H. The formation and therapeutic update of tumor-associated macrophages in cervical cancer. Int. J. Mol. Sci. 2019, 20, 3310. [Google Scholar] [CrossRef] [Scilit]
- Groh, M.; Albulescu, L.O.; Cristini, A.; Gromak, N. Senataxin: Genome Guardian at the Interface of Transcription and Neurodegeneration. J. Mol. Biol. 2017, 429, 3181–3195. [Google Scholar] [CrossRef] [Scilit]
- Suraweera, A.; Lim, Y.C.; Woods, R.; Birrell, G.W.; Nasim, T.; Becherel, O.J.; Lavin, M.F. Functional role for senataxin, defective in ataxia oculomotor apraxia type 2, in transcriptional regulation. Hum. Mol. Genet. 2009, 18, 3384–3396. [Google Scholar] [CrossRef] [Scilit]
- De Amicis, A.; Piane, M.; Ferrari, F.; Fanciulli, M.; Delia, D.; Chessa, L. Role of senataxin in DNA damage and telomeric stability. DNA Repair (Amst.) 2011, 10, 199–209. [Google Scholar] [CrossRef] [Scilit]
- Suraweera, A.; Becherel, O.J.; Chen, P.; Rundle, N.; Woods, R.; Nakamura, J.; Gatei, M.; Criscuolo, C.; Filla, A.; Chessa, L.; et al. Senataxin, defective in ataxia oculomotor apraxia type 2, is involved in the defense against oxidative DNA damage. J. Cell Biol. 2007, 177, 969–979. [Google Scholar] [CrossRef] [Scilit]
- Vantaggiato, C.; Bondioni, S.; Airoldi, G.; Bozzato, A.; Borsani, G.; Rugarli, E.I.; Bresolin, N.; Clementi, E.; Bassi, M.T. Senataxin modulates neurite growth through fibroblast growth factor 8 signalling. Brain 2011, 134, 1808–1828. [Google Scholar] [CrossRef] [Scilit]
- Becherel, O.J.; Yeo, A.J.; Stellati, A.; Heng, E.Y.H.; Luff, J.; Suraweera, A.M.; Woods, R.; Fleming, J.; Carrie, D.; McKinney, K.; et al. Senataxin Plays an Essential Role with DNA Damage Response Proteins in Meiotic Recombination and Gene Silencing. PLoS Genet. 2013, 9. [Google Scholar] [CrossRef] [Scilit]
- Miller, M.S.; Rialdi, A.; Sook, J.; Ho, Y.; Tilove, M.; Moshkina, N.P.; Peralta, Z.; Noel, J.; Melegari, C.; Maestre, A.; et al. The helicase senataxin suppresses the antiviral transcriptional response and controls viral biogenesis. Nat. Immunol. 2015, 16, 485–494. [Google Scholar] [CrossRef] [Scilit]
- Wagschal, A.; Rousset, E.; Basavarajaiah, P.; Contreras, X.; Harwig, A.; Laurent-Chabalier, S.; Nakamura, M.; Chen, X.; Zhang, K.; Meziane, O.; et al. Microprocessor, Setx, Xrn2, and Rrp6 co-operate to induce premature termination of transcription by RNAPII. Cell 2012, 150, 1147–1157. [Google Scholar] [CrossRef] [Scilit]
- Skourti-Stathaki, K.; Proudfoot, N.J.; Gromak, N. Human Senataxin Resolves RNA/DNA Hybrids Formed at Transcriptional Pause Sites to Promote Xrn2-Dependent Termination. Mol. Cell 2011, 42, 794–805. [Google Scholar] [CrossRef] [Scilit]
- Bilbao-Arribas, M.; Abendaño, N.; Varela-Martínez, E.; Reina, R.; De Andrés, D.; Jugo, B.M. Expression analysis of lung miRNAs responding to ovine VM virus infection by RNA-seq. BMC Genom. 2019, 20, 62. [Google Scholar] [CrossRef] [Scilit]





| Gene Name (Gene Symbol) | Forward | Reverse | NCBI Accession Number | Type of Gene/Source |
|---|---|---|---|---|
| Primer (5′–3′) | ||||
| Capra hircus GTPase, IMAP family member 2 (GIMAP2) | GCTCATGGACTTGACTGAGA | ACAGCTTGGATTAGGGCTTT | XM_018047470.1 | target |
| Capra hircus G protein-coupled receptor 37 (GPR37) | TGCAAGGAAAATCCGCAAAG | CAGAAGGAACTGGCTGATGA | XM_005679413.3 | target |
| Capra hircus scavenger receptor cysteine-rich family member with 5 domains (SSC5D) | GACCTCACCTCAGCCTCTAT | GGTAGGTGGAGAGGTTACTTG | XM_018063058.1 XM_018063057.1 | target |
| Capra hircus senataxin (SETX) | GGTAGACGGCTTTTCTTTCC | TCTTCTGCTTCCCAAGTTTCC | XM_018056034.1 | target |
| Ribosomal protein large, P0 (RPLP0) | CAACCCTGAAGTGCTTGACAT | AGGCAGATGGATCAGCCA | NM_001012682.1 | Reference gene [28] |
| 18S ribosomal RNA (18S rRNA) | CAAATTACCCACTCCCGACCC | AATGGATCCTCGCGGAAGG | DQ_066896.1 | Reference gene [28] |
| Gene Name (Gene Symbol) | Biological Function | Capra hircus Microarray (Direction of Expression Changes) | RT-qPCR | ||||
|---|---|---|---|---|---|---|---|
| Fold Change | Regulation | p-Value | Fold Change | Regulation | p-Value | ||
| Capra hircus GTPase, IMAP family member 2 (GIMAP2) | Protein binding GTP binding, identical protein binding | 2.938 | up | 0.015 | 2.640 | up | 0.003 |
| Capra hircus scavenger receptor cysteine-rich family member with 5 domains (SSC5D) | Fibronectin binding, scavenger receptor activity, protein binding, extracellular matrix binding | 2.206 | up | 0.033 | 4.309 | up | 0.012 |
| Capra hircus senataxin (SETX) | Nucleotide binding, transcription, termination site sequence-specific DNA binding, DNA binding, DNA helicase activity, helicase activity | 3.193 | up | 0.015 | 1.06 | up | 0.780 |
| Capra hircus G protein-coupled receptor 37 (GPR37) | G-protein coupled receptor activity, protein binding, G-protein coupled peptide receptor activity, Hsp70 protein binding | −13.305 | down | 0.015 | −3.892 | down | 0.002 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pławińska-Czarnak, J.; Majewska, A.; Zarzyńska, J.; Bogdan, J.; Kaba, J.; Anusz, K.; Bagnicka, E. Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation. Animals 2021, 11, 940. https://doi.org/10.3390/ani11040940
Pławińska-Czarnak J, Majewska A, Zarzyńska J, Bogdan J, Kaba J, Anusz K, Bagnicka E. Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation. Animals. 2021; 11(4):940. https://doi.org/10.3390/ani11040940
Chicago/Turabian StylePławińska-Czarnak, Joanna, Alicja Majewska, Joanna Zarzyńska, Janusz Bogdan, Jarosław Kaba, Krzysztof Anusz, and Emilia Bagnicka. 2021. "Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation" Animals 11, no. 4: 940. https://doi.org/10.3390/ani11040940
APA StylePławińska-Czarnak, J., Majewska, A., Zarzyńska, J., Bogdan, J., Kaba, J., Anusz, K., & Bagnicka, E. (2021). Gene Expression Profile in Peripheral Blood Nuclear Cells of Small Ruminant Lentivirus-Seropositive and Seronegative Dairy Goats in Their First Lactation. Animals, 11(4), 940. https://doi.org/10.3390/ani11040940

