Comparative Study of Biological Characteristics, and Osteoblast Differentiation of Mesenchymal Stem Cell Established from Camelus dromedarius Skeletal Muscle, Dermal Skin, and Adipose Tissues
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Media
2.2. Establishment and Culture of Skeletal Muscle, Dermal Skin, and Adipose Tissue-Derived Mesenchymal Stem Cells
2.3. Cell Proliferation Analysis
2.4. Cell Cycle Analysis
2.5. In Vitro Differentiation into Adipocyte, and Chondrocyte
2.6. In Vitro Differentiation into Osteoblast
2.7. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
2.8. Alkaline Phosphatase Activity
2.9. Calcium Colorimetric Assay
2.10. Statistical Analysis
3. Results
3.1. Establishment of MSCs Derived from Skeletal Muscle, Dermal Skin, and Adipose Tissues
3.2. In Vitro Adipogenic and Chondrogenic Lineage Differentiation Capacity of MSCs
3.3. In Vitro Osteogenic Differentiation Capacity of MSCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nielsen, K.S. The physiology of the camel. Sci. Am. 1959, 201, 140–151. [Google Scholar] [CrossRef] [PubMed]
- Saadeldin, I.M.; Swelum, A.A.A.; Elsafadi, M.; Mahmood, A.; Alfayez, M.; Alowaimer, A.N. Cumulus cells of camel (Camelus dromedarius) antral follicles are multipotent stem cells. Theriogenology 2018, 118, 233–242. [Google Scholar] [CrossRef]
- Alshamisi, N.S.; Ksiksi, T.S.; Ashraf, S.S. Hematology analysis as a potential tool to predict bone fracture in Arabian racing camels (Camelus dromedaries). J. Anim. Plant Sci. 2013, 23, 763–770. [Google Scholar]
- Yaszemski, M.J.; Payne, R.G.; Hayes, W.C.; Langer, R.; Mikos, A.G. Evolution of bone transplantation: Molecular, cellular and tissue strategies to engineer human bone. Biomaterials 1996, 17, 175–185. [Google Scholar] [CrossRef]
- Laurencin, C.; Khan, Y.; El-Amin, S.F. Bone graft substitutes. Expert Rev. Med. Devices 2006, 3, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Kloss, F.R.; Offermanns, V.; Kloss-Brandstätter, A. Comparison of allogeneic and autogenous bone grafts for augmentation of alveolar ridge defects-A 12-month retrospective radiographic evaluation. Clin. Oral Implants Res. 2018, 29, 1163–1175. [Google Scholar] [CrossRef] [PubMed]
- Nissan, J.; Marilena, V.; Gross, O.; Mardinger, O.; Chaushu, G. Histomorphometric analysis following augmentation of the posterior mandible using cancellous bone-block allograft. J. Biomed. Mater. Res. A 2011, 97, 509–513. [Google Scholar] [CrossRef] [PubMed]
- Son, Y.B.; Kang, Y.H.; Lee, H.J.; Jang, S.J.; Bharti, D.; Lee, S.L.; Jeon, B.G.; Park, B.W.; Rho, G.J. Evaluation of odonto/osteogenic differentiation potential from different regions derived dental tissue stem cells and effect of 17β-estradiol on efficiency. BMC Oral Health 2021, 21, 15. [Google Scholar] [CrossRef] [PubMed]
- Son, Y.B.; Bharti, D.; Kim, S.B.; Bok, E.Y.; Lee, S.Y.; Ho, H.J.; Lee, S.L.; Rho, G.J. Hematological patterns and histopathological assessment of Miniature Pigs in the experiments on human mesenchymal stem cell transplantation. Int. J. Med. Sci. 2021, 18, 1259–1268. [Google Scholar] [CrossRef]
- Shivakumar, S.B.; Lee, H.J.; Son, Y.B.; Bharti, D.; Ock, S.A.; Lee, S.L.; Kang, Y.H.; Park, B.W.; Rho, G.J. In vitro differentiation of single donor derived human dental mesenchymal stem cells into pancreatic β cell-like cells. Biosci. Rep. 2019, 39, BSR20182051. [Google Scholar] [CrossRef]
- King, N.M.; Perrin, J. Ethical issues in stem cell research and therapy. Stem Cell Res. Ther. 2014, 5, 85. [Google Scholar] [CrossRef]
- Marcacci, M.; Kon, E.; Moukhachev, V.; Lavroukov, A.; Kutepov, S.; Quarto, R.; Mastongiacomo, M.; Cancedda, R. Stem cells associated with macroporous bioceramics for long bone repair: 6-to 7-year outcome of a pilot clinical study. Tissue Eng. 2007, 13, 947–955. [Google Scholar] [CrossRef] [PubMed]
- Arinzeh, T.L.; Peter, S.J.; Archambault, M.P.; van den Bos, C.; Gordon, S.; Kraus, K.; Smith, A.; Kadiyala, S. Allogeneic Mesenchymal Stem Cells Regenerate Bone in a Critical-Sized Canine Segmental Defect. J. Bone Jt. Surg. Am. 2003, 85, 1927–1935. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.H.; Lee, H.J.; Jang, S.J.; Byun, J.H.; Lee, J.S.; Lee, H.C.; Park, W.U.; Lee, J.H.; Rho, G.J.; Park, B.W. Immunomodulatory properties and in vivo osteogenesis of human dental stem cells from fresh and cryopreserved dental follicles. Differentiation 2015, 90, 48–58. [Google Scholar] [CrossRef]
- Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone tissue engineering: Recent advances and challenges. Crit. Rev. Biomed. Eng. 2012, 40, 363–408. [Google Scholar] [CrossRef]
- Charbord, P. Bone marrow mesenchymal stem cells: Historical overview and concepts. Hum. Gene Ther. 2010, 21, 1045–1056. [Google Scholar] [CrossRef]
- Čamernik, K.; Mihelič, A.; Mihalič, R.; Presen, D.M.; Janež, A.; Trebše, R.; Marc, J.; Zupan, J. Skeletal-muscle-derived mesenchymal stem/stromal cells from patients with osteoarthritis show superior biological properties compared to bone-derived cells. Stem Cell Res. 2019, 38, 101465. [Google Scholar] [CrossRef]
- Castro-Manrreza, M.E.; Bonifaz, L.; Castro-Escamilla, O.; Monroy-García, A.; Cortés-Morales, A.; Hernández-Estévez, E.; Hernández-Cristino, J.; Mayani, H.; Montesinos, J.J. Mesenchymal Stromal Cells from the Epidermis and Dermis of Psoriasis Patients: Morphology, Immunophenotype, Differentiation Patterns, and Regulation of T Cell Proliferation. Stem Cells Int. 2019, 2019, 454179. [Google Scholar] [CrossRef]
- Miana, V.V.; González, E.A.P. Adipose tissue stem cells in regenerative medicine. Ecancermedicalscience 2018, 12, 822. [Google Scholar] [CrossRef]
- Yu, J.M.; Wu, X.; Gimble, J.M.; Guan, X.; Freitas, M.A.; Bunnell, B.A. Age-related changes in mesenchymal stem cells derived from rhesus macaque bone marrow. Aging 2011, 10, 66–79. [Google Scholar] [CrossRef]
- Ceusters, J.; Lejeune, J.P.; Sandersen, C.; Niesten, A.; Lagneaux, L.; Serteyn, D. From skeletal muscle to stem cells: An innovative and minimally-invasive process for multiple species. Sci. Rep. 2017, 7, 696. [Google Scholar] [CrossRef]
- Niu, X.; Li, J.; Zhao, X.; Wang, Q.; Wang, G.; Hou, R.; Li, X.; An, P.; Yin, G.; Zhang, K. Dermal mesenchymal stem cells: A resource of migration-associated function in psoriasis? Stem Cell Res. Ther. 2019, 10, 54. [Google Scholar] [CrossRef]
- Fideles, S.O.M.; Ortiz, A.C.; Assis, A.F.; Duarte, M.J.; Oliveira, F.S.; Passos, G.A.; Beloti, M.M.; Rosa, A.L. Effect of cell source and osteoblast differentiation on gene expression profiles of mesenchymal stem cells derived from bone marrow or adipose tissue. J. Cell. Biochem. 2019, 120, 11842–11852. [Google Scholar] [CrossRef]
- Lee, W.J.; Hah, Y.S.; Ock, S.A.; Lee, J.H.; Jeon, R.H.; Park, J.S.; Lee, S.I.; Rho, N.Y.; Rho, G.J.; Lee, S.L. Cell source-dependent in vivo immunosuppressive properties of mesenchymal stem cells derived from the bone marrow and synovial fluid of minipigs. Exp. Cell Res. 2015, 133, 273–288. [Google Scholar] [CrossRef] [PubMed]
- Seeman, E.; Delmas, P.D. Bone quality—The material and structural basis of bone strength and fragility. N. Engl. J. Med. 2006, 354, 2250–2261. [Google Scholar] [CrossRef]
- Boivin, G.; Farlay, D.; Bala, Y.; Doublier, A.; Meunier, P.J.; Delmas, P.D. Influence of remodeling on the mineralization of bone tissue. Osteoporos. Int. 2009, 20, 1023–1026. [Google Scholar] [CrossRef] [PubMed]
- Tate, M.L.K.; Adamson, J.R.; Tami, A.E.; Bauer, T.W. The osteocytes. Int. J. Biochem. Cell Biol. 2004, 36, 1–8. [Google Scholar] [CrossRef]
- Park, H.C.; Son, Y.B.; Lee, S.L.; Rho, G.J.; Kang, Y.H.; Park, B.W.; Byun, S.H.; Hwang, S.C.; Cho, I.A.; Cho, Y.C.; et al. Effects of Osteogenic-Conditioned Medium from Human Periosteum-Derived Cells on Osteoclast Differentiation. Int. J. Med. Sci. 2017, 14, 1389–1401. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Karaöz, E.; Doğan, B.N.; Aksoy, A.; Gacar, G.; Akyüz, S.; Ayhan, S.; Genç, Z.S.; Yürüker, S.; Duruksu, G.; Demircan, P.C.; et al. Isolation and in vitro characterization of dental pulp stem cells from natal teeth. Histochem. Cell Biol. 2010, 133, 95–112. [Google Scholar] [CrossRef]
- Kashyap, V.; Rezende, N.C.; Scotland, K.B.; Shaffer, S.M.; Persson, J.L.; Gudas, L.J.; Mongan, N.P. Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev. 2009, 18, 1093–1108. [Google Scholar] [CrossRef]
- Yoshimura, H.; Muneta, T.; Nimura, A.; Yokoyama, A.; Koga, H.; Sekiya, I. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell Tissue Res. 2007, 327, 449–462. [Google Scholar] [CrossRef]
- Lee, A.Y.; Lee, J.; Kim, C.L.; Lee, K.S.; Lee, S.H.; Gu, N.Y.; Kim, J.M.; Lee, B.C.; Koo, O.J.; Song, J.Y.; et al. Comparative studies on proliferation, molecular markers and differentiation potential of mesenchymal stem cells from various tissues (adipose, bone marrow, ear skin, abdominal skin, and lung) and maintenance of multipotency during serial passages in miniature pig. Res. Vet. Sci. 2015, 100, 114–124. [Google Scholar] [CrossRef]
- Mohammadi-Sangcheshmeh, A.; Shafiee, A.; Seyedjafari, E.; Dinarvand, P.; Toghdory, A.; Bagherizadeh, I.; Schellander, K.; Cinar, M.U.; Soleimani, M. Isolation, characterization, and mesodermic differentiation of stem cells from adipose tissue of camel (Camelus dromedarius). In Vitro Dev. Biol. Anim. 2013, 49, 147–154. [Google Scholar] [CrossRef]
- Saadeldin, I.M.; Swelum, A.A.A.; Noreldin, A.E.; Tukur, H.A.; Abdelazim, A.M.; Abomughaid, M.M.; Alowaimer, A.N. Isolation and Culture of Skin-Derived Differentiated and Stem-Like Cells Obtained from the Arabian Camel (Camelus dromedarius). Anumals 2019, 9, 378. [Google Scholar] [CrossRef]
- Kim, H.J.; Sung, I.Y.; Cho, Y.C.; Kang, M.S.; Rho, G.J.; Byun, J.H.; Park, W.U.; Son, M.G.; Park, B.W.; Lee, H.J.; et al. Three-Dimensional Spheroid Formation of Cryopreserved Human Dental Follicle-Derived Stem Cells Enhances Pluripotency and Osteogenic Induction Properties. Tissue Eng. Regen. Med. 2019, 16, 513–523. [Google Scholar] [CrossRef]
- Shen, C.; Yang, C.; Xu, S.; Zhao, H. Comparison of osteogenic differentiation capacity in mesenchymal stem cells derived from human amniotic membrane (AM), umbilical cord (UC), chorionic membrane (CM), and decidua (DC). Cell Biosci. 2019, 9, 17. [Google Scholar] [CrossRef]
- Jafary, F.; Hanachi, P.; Gorjipour, K. Osteoblast Differentiation on Collagen Scaffold with Immobilized Alkaline Phosphatase. Int. J. Organ Transplant. Med. 2017, 8, 195–202. [Google Scholar]
- Blair, H.C.; Larrouture, Q.C.; Li, Y.; Lin, H.; Beer-Stoltz, D.; Liu, L.; Tuan, R.S.; Robinson, L.J.; Schlesinger, P.H.; Nelson, D.J. Osteoblast Differentiation and Bone Matrix Formation In Vivo and In Vitro. Tissue Eng. Part B Rev. 2017, 23, 268–280. [Google Scholar] [CrossRef]
- Boonrungsiman, S.; Gentleman, E.; Carzaniga, R.; Evans, N.D.; McComb, D.W.; Porter, A.E.; Stevens, M.M. The role of intracellular calcium phosphate in osteoblast-mediated bone apatite formation. Proc. Natl. Acad. Sci. USA 2012, 109, 14170–14175. [Google Scholar] [CrossRef]






| Gene Name (Symbol) | Primers Sequence | Product Size (bp) | Anneal. Temp (°C) | 
|---|---|---|---|
| POU class 5 homeobox 1 (OCT4) | F: CGAGAGGATTTTGAGGCTGC R: GAGTACAGTGTGGTGAAGTGAG | 122 | 60 | 
| Sex determining region Y-box 2 (SOX2) | F: CTCGCAGACCTACATGAACG R: TGGGAGGAAGAGGAAACCAC | 144 | 60 | 
| Nanog homeobox (NANOG) | F: AGCACAGAGAAGCAGGAAGA R: CCACCGCTTACATTTCATTC | 213 | 60 | 
| Lipoprotein lipase (LPL) | F: GAGAGTGTTACCTACACCAA R: GCCTTTACTCTGATCTTCTC | 248 | 60 | 
| fatty acid-binding protein 4 (FABP4) | F: GTGACCATCAGTGTGAATG R: GCACCTCCTTCTAAAGTTAC | 152 | 60 | 
| the type X collagen gene (COL10A1) | F: TATCCAGCTATAGGCAGTC R: TCGTAGGTGTACATTACAGG | 194 | 60 | 
| Agreecan (ACAN) | F: TGTGGAGGGTGTTACTGAAC R: GACTGATGACCCTTCTACCC | 154 | 60 | 
| Runt-related transcription factor 2 (Runx2) | F: GACAGAAGCTTGATGACTCT R: GTAATCTGACTCTGTCCTTG | 166 | 60 | 
| Osteocalcin | F: AGTGAGATGGTGAAGAGACT R: TAGGTTGTGCCGTAGAAG | 176 | 60 | 
| Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) | F: GCTGAGTACGTTGTGGAGTC R: TCACGCCCATCACAAACATG | 133 | 60 | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Son, Y.-B.; Jeong, Y.I.; Jeong, Y.W.; Hossein, M.S.; Tinson, A.; Singh, K.K.; Hwang, W.S. Comparative Study of Biological Characteristics, and Osteoblast Differentiation of Mesenchymal Stem Cell Established from Camelus dromedarius Skeletal Muscle, Dermal Skin, and Adipose Tissues. Animals 2021, 11, 1017. https://doi.org/10.3390/ani11041017
Son Y-B, Jeong YI, Jeong YW, Hossein MS, Tinson A, Singh KK, Hwang WS. Comparative Study of Biological Characteristics, and Osteoblast Differentiation of Mesenchymal Stem Cell Established from Camelus dromedarius Skeletal Muscle, Dermal Skin, and Adipose Tissues. Animals. 2021; 11(4):1017. https://doi.org/10.3390/ani11041017
Chicago/Turabian StyleSon, Young-Bum, Yeon Ik Jeong, Yeon Woo Jeong, Mohammad Shamim Hossein, Alex Tinson, Kuhad Kuldip Singh, and Woo Suk Hwang. 2021. "Comparative Study of Biological Characteristics, and Osteoblast Differentiation of Mesenchymal Stem Cell Established from Camelus dromedarius Skeletal Muscle, Dermal Skin, and Adipose Tissues" Animals 11, no. 4: 1017. https://doi.org/10.3390/ani11041017
APA StyleSon, Y.-B., Jeong, Y. I., Jeong, Y. W., Hossein, M. S., Tinson, A., Singh, K. K., & Hwang, W. S. (2021). Comparative Study of Biological Characteristics, and Osteoblast Differentiation of Mesenchymal Stem Cell Established from Camelus dromedarius Skeletal Muscle, Dermal Skin, and Adipose Tissues. Animals, 11(4), 1017. https://doi.org/10.3390/ani11041017
 
         
                                                
 
       