L-Arginine Supplementation for Nulliparous Sows during the Last Third of Gestation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Experimental Design and Diets
2.2. Blood Sampling and Analysis
2.3. Litter Traits
2.4. Piglet Skeletal Muscle Tissue Sampling
2.5. Histomorphometric Analysis of Piglet Skeletal Muscle Tissue
2.6. RNA Extraction, cDNA Synthesis and RT-qPCR Assessment
2.7. Statistical Analysis
3. Results
3.1. Thermal Environment
3.2. Sow and Piglet Phenotypic Data
3.3. Biochemical Analysis of Blood Parameters
3.4. Histomorphometry of Piglet Skeletal Muscle Tissue
3.5. Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Père, M.C.; Etienn, M. Uterine blood flow in sows: Effects of pregnancy stage and litter size. Reprod. Nutr. Dev. 2000, 40, 369–382. [Google Scholar] [CrossRef] [Green Version]
- Bérard, J.; Pardo, C.E.; Bethaz, S.; Kreuzer, M.; Bee, G. Intra-uterine crowding decreases average birth weight and affects muscle fiber hyperplasia in piglets. J. Anim. Sci. 2010, 88, 3242–3250. [Google Scholar] [CrossRef] [Green Version]
- Campos, P.H.R.F.; Silva, B.A.N.; Donzele, J.L.; Oliveira, R.F.M.; Knol, E.F. Effects of sow nutrition during gestation on within-litter birth weight variation: A review. Animal 2012, 6, 797–806. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Bazer, F.W.; Davis, T.A.; Jaeger, L.A.; Johnson, G.A.; Kim, S.W.; Knabe, D.A.; Meininger, C.J.; Spencer, T.E.; Yin, Y.L. Important roles for the arginine family of amino acids in swine nutrition and production. Livest. Sci. 2007, 112, 8–22. [Google Scholar] [CrossRef]
- Wu, G.Y.; Bazer, F.W.; Satterfield, M.C.; Li, X.L.; Wang, X.Q.; Johnson, G.A.; Burghardt, R.C.; Dai, Z.; Wang, J.; Wu, Z. Impacts of arginine nutrition on embryonic and fetal development in mammals. Amino Acids 2013, 45, 241–256. [Google Scholar] [CrossRef] [PubMed]
- Bérard, J.; Bee, G. Effects of dietary L-arginine supplementation to gilts during early gestation on foetal survival, growth and myofiber formation. Animal 2010, 4, 1680–1687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Garbossa, C.A.P.; Carvalho Júnior, F.M.; Silveira, H.; Faria, P.B.; Schinckel, A.P.; Abreu, M.L.T.; Cantarelli, V.S. Effects of ractopamine and arginine dietary supplementation for sows on growth performance and carcass quality of their progenies. J. Anim. Sci. 2015, 93, 2872–2884. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Madsen, J.G.; Pardo, C.; Kreuzer, M.; Beel, G. Impact of dietary L-arginine supply during early gestation on myofiber development in newborn pigs exposed to intra-uterine crowding. J. Anim. Sci. Biotechnol. 2017, 8, 58. [Google Scholar] [CrossRef] [PubMed]
- Yao, K.; Yin, Y.L.; Chu, W.; Liu, Z.; Deng, D.; Li, T.; Huang, R.; Zhang, J.; Tan, B.; Wang, W.; et al. Dietary arginine supplementation increases mTOR signaling activity in skeletal muscle of neonatal pigs. J. Nutr. 2008, 138, 867–872. [Google Scholar] [CrossRef]
- Kong, X.; Tan, B.; Yin, Y.; Gao, H.; Li, X.; Jaeger, L.A.; Bazer, F.W.; Wu, G. L-arginine stimulates the mTOR signaling pathway and protein synthesis in porcine trophectoderm cells. J. Nutr. Biochem. 2012, 23, 1178–1183. [Google Scholar] [CrossRef] [PubMed]
- Kalbe, C.; Bérard, J.; Porm, M.; Rehfeldt, C.; Bee, G. Maternal L-arginine supplementation during early gestation affects foetal skeletal myogenesis in pigs. Livest. Sci. 2013, 157, 322–329. [Google Scholar] [CrossRef]
- Chen, R.; Wang, W.; Liu, S.; Pan, J.; Li, T.; Yin, Y. Dietary arginine supplementation altered expression of IGFs and IGF receptors in weaning piglets. J. Cell Anim. Biol. 2013, 7, 44–50. [Google Scholar] [CrossRef]
- Hu, C.J.; Li, F.N.; Duan, Y.H.; Zhang, T.; Li, H.W.; Yin, Y.L.; Wu, G.Y.; Kong, X.F. Dietary supplementation with arginine and glutamic acid alters the expression of amino acid transporters in skeletal muscle of growing pigs. Amino Acids 2019, 51, 1081–1092. [Google Scholar] [CrossRef] [PubMed]
- McPherson, R.L.; Ji, F.; Wu, G.; Blanton, J.R., Jr.; Kim, S.W. Growth and compositional changes of fetal tissues in pigs. J. Anim. Sci. 2004, 82, 2534–2540. [Google Scholar] [CrossRef]
- Du, M.; Wang, B.; Fu, X.; Yang, Q.; Zhu, M.J. Fetal programming in meat production. Meat Sci. 2015, 109, 40–47. [Google Scholar] [CrossRef] [Green Version]
- Rostagno, H.S.; Albino, L.F.T.; Donzele, J.L.; Gomes, P.C.; De Oliveira, R.F.M.; Lopes, D.C.; Ferreira, A.S.; Barreto, S.L.T. Tabelas Brasileiras Para Aves e Suínos: Composição de Alimentos e Exigências Nutricionais, 3rd ed.; Universidade Federal de Viçosa: Viçosa, Brazil, 2011; p. 251. [Google Scholar]
- Zhu, C.; Guo, C.; Gao, K.; Wang, L.; Chen, Z.; Ma, X.Y.; Jiang, Z.Y. Dietary arginine supplementation in multiparous sows during lactation improves the weight gain of suckling piglets. J. Integr. Agric. 2017, 16, 648–655. [Google Scholar] [CrossRef] [Green Version]
- Nuntapaitoon, M.; Muns, R.; Theil, P.K. Tummaruk, L-arginine supplementation in sow diet during late gestation decrease stillborn piglet, increase piglet birth weight and increase immunoglobulin G concentration in colostrum. Theriogenology 2018, 121, 27–34. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lucy, M.C.; Safranski, T.J. Heat stress in pregnant sows: Thermal responses and subsequent performance of sows and their offspring. Mol. Reprod. Dev. 2017, 84, 946–956. [Google Scholar] [CrossRef] [Green Version]
- Ashworth, C.J.; Finch, J.M.; Page, K.R.; Nwagwu, M.O.; Mcardle, H.J. Causes and consequences of fetal growth retardation in pigs. Reprod. (Camb. Engl.) Suppl. 2001, 58, 233–246. [Google Scholar] [CrossRef]
- Reynolds, L.P.; Borowicz, P.P.; Vonnahme, K.A.; Johnson, M.L.; Grazul-Bilska, A.T.; Wallace, J.M.; Caton, J.S.; Redmer, D.A. Animal models of placental angiogenesis. Placenta 2005, 26, 689–708. [Google Scholar] [CrossRef] [PubMed]
- Silva, A.; Dalto, D.; Lozano, A.; de Oliveira, E.; Gavioli, D.; de Oliveira, J.; Romero, N.; da Silva, C. Differences in muscle characteristics of piglets related to the sow parity. Can. J. Anim. Sci. 2013, 93, 471–475. [Google Scholar] [CrossRef]
- Nissen, P.; Jorgensen, P.F.; Oksbjerg, N. Within-litter variation in muscle fiber characteristics, pig performance, and meat quality traits. J. Anim. Sci. 2004, 82, 414–421. [Google Scholar] [CrossRef]
- Braun, T.; Gautel, M. Transcriptional mechanisms regulating skeletal muscle differentiation, growth and homeostasis. Nat. Rev. Mol. Cell Biol. 2011, 12, 349–361. [Google Scholar] [CrossRef] [PubMed]
- Semsarian, C.; Sutrave, P.; Richmond, D.R.; Graham, R.M. Insulin-like growth factor (IGF-I) induces myotube hypertrophy associated with an increase in anaerobic glycolysis in a clonal skeletal-muscle cell model. Biochem. J. 1999, 339, 443–451. [Google Scholar] [CrossRef]
- Barton-Davis, E.R.; Shoturma, D.I.; Sweeney, H.L. Contribution of satellite cells to IGF-I induced hypertrophy of skeletal muscle. Acta Physiol. Scand. 1999, 167, 301–305. [Google Scholar] [CrossRef]
- Grounds, M.D. Reasons for the degeneration of ageing skeletal muscle: A central role for IGF-1 signaling. Biogerontology 2002, 3, 19–24. [Google Scholar] [CrossRef]
- Zanou, N. Gailly, Skeletal muscle hypertrophy and regeneration: Interplay between the myogenic regulatory factors (MRFs) and insulin-like growth factors (IGFs) pathways. Cell. Mol. Life Sci. 2013, 70, 4117–4130. [Google Scholar] [CrossRef]
- Glass, D.J. Skeletal muscle hypertrophy and atrophy signaling pathways. Int. J. Biochem. Cell Biol. 2005, 37, 1974–1984. [Google Scholar] [CrossRef]
- Aguiar, A.F.; Vechetti-Júnior, I.J.; Alves de Souza, R.W.; Castan, E.P.; Milanezi-Aguiar, R.C.; Padovani, C.R.; Carvalho, R.F.; Silva, M.D.P. Myogenin, MyoD and IGF-I regulate muscle mass but not fiber-type conversion during resistance training in rats. Int. J. Sports Med. 2012, 34, 293–301. [Google Scholar] [CrossRef] [PubMed]
- Wilson, E.M.; Hsieh, M.M. Rotwein, Autocrine growth factor signaling by insulin-like growth factor-II mediates MyoD stimulated myocyte maturation. J. Biol. Chem. 2003, 278, 41109–41113. [Google Scholar] [CrossRef] [Green Version]
- Aboalola, D.; Han, V.K.M. Different effects of insulin-like growth factor-1 and insulin like growth factor-2 on myogenic differentiation of humam mesenchymal stem cells. Stem Cells Int. 2017, 2017, 8286248. [Google Scholar] [CrossRef] [Green Version]
- Oksbjerg, N.; Therkildsen, M. Myogenesis and muscle growth and meat quality. In New Aspects of Meat Quality, 1st ed.; Purslow, P.P., Ed.; Buenos Aires: Tandil, Argentina, 2017; Volume 1, pp. 33–62. [Google Scholar] [CrossRef]
- Bass, B.E.; Bradley, C.L.; Johnson, Z.B.; Zier-Rush, C.E.; Boyd, R.D.; Usry, J.L.; Maxwell, C.V.; Frank, J.W. Influence of dietary L-arginine supplementation of sows during late pregnancy on piglet birth weight and sow and litter performance during lactation. J. Anim. Sci. 2017, 95, 248–256. [Google Scholar] [CrossRef]
- Quesnel, H.; Quiniou, N.; Roy, H.; Lottin, A.; Boulot, S.; Gondret, F. Supplying dextrose before insemination and L-arginine during the last third of pregnancy in sow diets: Effects on within-litter variation of piglet birth weight. J. Anim. Sci. 2014, 92, 1445–1450. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hong, J.; Fang, L.H.; Jeong, J.H.; Kim, Y.Y. Effects of L-arginine supplementation during late gestation on reproductive performance, piglet uniformity, blood profiles, and milk composition in high prolific sows. Animals 2020, 10, 1313. [Google Scholar] [CrossRef]
- Palencia, J.Y.P.; Lemes, M.A.G.; Garbossa, C.A.P.; Abreu, M.L.T.; Pereira, L.J.; Zangeronimo, M.G. Arginine for gestating sows and foetal development: A systematic review. J. Physiol. Anim. Nutr. 2017, 102, 204–213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, X.; Yin, Y.L.; Liu, Y.Q.; Liu, X.D.; Liu, Z.Q.; Li, T.J.; Huang, R.L.; Deng, Z.Y. Effect of dietary arginine and N-carbamoylglutamate supplementation on reproduction and gene expression of eNOS, VEGFA and PlGF1 in placenta in late pregnancy of sows. Anim. Reprod. Sci. 2012, 132, 187–192. [Google Scholar] [CrossRef]
- Liu, X.D.; Wu, X.; Yin, Y.L.; Liu, Y.Q.; Geng, M.M.; Yang, H.S.; Blachier, F.; Wu, G.Y. Effects of dietary L-arginine or N-carbamylglutamate supplementation during late gestation of sows on the miR-15b/16, miR-221/222, VEGFA and eNOS expression in umbilical vein. Amino Acids 2012, 42, 2111–2119. [Google Scholar] [CrossRef] [Green Version]
- Che, L.; Yang, P.; Fang, Z.; Lin, Y.; Wu, D. Effects of dietary arginine supplementation on reproductive performance and immunity of sows. Czech J. Anim. Sci. 2013, 58, 167–175. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Bazer, F.W.; Hu, J.; Johnson, G.A.; Spencer, T.E. Polyamine synthesis from proline in the developing porcine placenta. Biol. Reprod. 2005, 72, 842–850. [Google Scholar] [CrossRef]
- Kwon, H.; Wu, G.; Meininger, C.; Bazer, F.W.; Spencer, T.E. Developmental changes in nitric oxide synthesis in the ovine placenta. Biol. Reprod. 2004, 70, 679–686. [Google Scholar] [CrossRef] [PubMed]
- Wu, G.; Bazer, F.W.; Wallace, J.M.; Spencer, T.E. Intrauterine growth retardation: Implications for the animal sciences. J. Anim. Sci. 2006, 84, 2316–2337. [Google Scholar] [CrossRef]
- Reynolds, L.P.; Kirsch, J.D.; Kraft, K.C.; Redmer, D.A. Time-course of the uterine response to estradiol-17b in ovariectomized ewes: Expression of angiogenic factors. Biol. Reprod. 1998, 59, 613–620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vonnahme, K.A.; Wilson, M.E.; Ford, S. Relationship between placental vascular endothelial growth factor expression and placental/endometrial vascularity in the pig. Biol. Reprod. 2001, 64, 1821–1825. [Google Scholar] [CrossRef] [Green Version]
- Edgerton, L.A.; Erb, R.E. Metabolites of progesterone and estrogen in domestic sow urine. I. Effect of pregnancy. J. Anim. Sci. 1971, 32, 515–524. [Google Scholar] [CrossRef]
- Kensinger, R.S.; Collier, R.J.; Bazer, F.W.; Kraeling, R.R. Effect of number of conceptuses on maternal hormone concentrations in the pig. J. Anim. Sci. 1986, 62, 1666–1674. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Hou, Y.; Hu, S.; Bazer, F.W.; Meininger, C.J.; McNeal, C.J.; Wu, G. Catabolism and safety of supplemental L-arginine in animals. Amino Acids 2016, 48, 1541–1552. [Google Scholar] [CrossRef] [PubMed]
- Holanda, D.M.; Marcolla, C.S.; Guimarães, S.E.F.; Neves, M.M.; Hausman, G.J.; Duarte, M.S.; Abreu, M.L.T.; Saraiva, A. Dietary L-arginine supplementation increased mammary gland vascularity of lactating sows. Animal 2019, 13, 790–798. [Google Scholar] [CrossRef]
- Costa, K.A.; Saraiva, A.; Guimarães, J.D.; Marques, D.B.D.; Neves, M.M.; Barbosa, L.M.R.; Villadiego, F.A.C.; Veroneze, R.; de Oliveira, L.F.; Garcia, I.S.; et al. Dietary L-arginine supplementation during early gestation of gilts affects conceptuses development. Theriogenology 2019, 140, 62–71. [Google Scholar] [CrossRef]
Ingredient, % | CON | ARG |
---|---|---|
Corn, 7.88% | 67.58 | 67.58 |
Soybean meal, 45.0% | 16.00 | 16.00 |
Wheat bran | 12.00 | 12.00 |
Dicalcium phosphate | 1.40 | 1.40 |
Inert clay filler | 1.00 | ˗ |
L-arginine, 98.0% | ˗ | 1.00 |
Limestone | 0.750 | 0.750 |
Salt | 0.340 | 0.340 |
L-lysine, 78.0% | 0.215 | 0.215 |
Mineral premix 1 | 0.200 | 0.200 |
Choline chloride | 0.120 | 0.120 |
Vitamin premix 2 | 0.300 | 0.300 |
L-threonine, 98.5% | 0.100 | 0.100 |
Calculated nutritional composition 3 | ||
SID arginine, % | 0.852 | 1.817 |
Calcium, % | 0.700 | 0.700 |
Metabolizable energy, kcal/kg | 3145 | 3145 |
Available phosphorus, % | 0.375 | 0.375 |
SID lysine, % | 0.749 | 0.749 |
SID methionine + cysteine, % | 0.412 | 0.412 |
Crude protein, % | 14.73 | 17.00 |
Sodium, % | 0.154 | 0.154 |
SID threonine, % | 0.554 | 0.554 |
SID tryptophan, % | 0.148 | 0.148 |
Gene 1 | GenBank Number | Sequence | Size, bp |
---|---|---|---|
IGF-1 | NM_214256.1 | F: GAGGCTGGAGATGTACTGTR: TCCTGAACTCCCTCTACTTG | 223 |
IGF-1 R | NM_214172.1 | F: ATCTGATCATCGCCCTACCR: CCCAGCCTGCTGTTATTTC | 163 |
IGF-2 | NM_213883.2 | F: TCTCTGTACCCTTCTGTCTGR: AGAGACTAGCCTGACATGG | 212 |
IGF-2 R | NM_001244473.1 | F: CATCGGGAAGACCTTTGTGR: GCTCTTTCGTCTCGGTTTC | 180 |
MYOD | GU249575.1 | F: ACAGCGGACGACTTCTATGR: GAGTGTTCCTCGGGCTTTA | 196 |
MSTN | NM_214435.2 | F: GCTGTACTCCCACAAAGATGR: CACCCACAGCGATCTACTA | 175 |
MYOG | NM_001012406.1 | F: GGGCATGTAAGGTGTGTAAGR: CCTCAAAGGCCTCATTCAC | 203 |
MRF4 | DQ139775.1 | F: CGCCATCAACTACATCGAGAGGTR: ATCACGAGCCCCCTGGAAT | 193 |
MYF5 | NM_001278775.1 | F: TAGTTCCAGGCTCATCTACCR: CCTCCTTCCTCCTGTGTAA | 181 |
CASP3 | NM_214131.1 | F: GAGGCACAGAATTGGACTGR: CAAGAAGTCTGCCTCAACTG | 167 |
Atrogin-1 | NM_001044588 | F: TCACAGCTCACATCCCTGAGR: GACTTGCCGACTCTCTGGAC | 206 |
MuRF1 | NM_001184756 | F: ATGGAGAACCTGGAGAAGCAR: ACGGTCCATGATCACCTCAT | 158 |
mTOR | XM_003127584.6 | F: GCGATAGACACCCATCTAACCR: CTTCTCTCTGGTCATAGCAACC | 220 |
ACTB | XM_003124280.3 | F: CTTCTAGGCGGACTGTTAGTGR: TGTCGGCGATGCCTGGGTA | 123 |
HPRT1 | NM_001032376.2 | F: CCAGTCAACGGGCGATATAAR: GACCAAGGAAAGCAAGGTTG | 165 |
GAPDH | NM_001206359.1 | F: CAAAGTGGACATTGTCGCCATCAR: AGCTTCCCATTCTCAGCCTTGACT | 210 |
Item | CON | ARG | SEM | p-Value |
---|---|---|---|---|
Sow body weight, kg | ||||
Day 85 | 204.87 | 205.91 | 2.344 | 0.835 |
Day 110 | 228.46 | 227.30 | 2.565 | 0.805 |
Farrowing | 202.32 | 206.27 | 2.604 | 0.299 |
Litter traits | ||||
Total born 2 | 14.33 | 13.18 | 0.656 | 0.458 |
Total born alive 2 | 13.50 | 13.18 | 0.621 | 0.877 |
Stillborn 2 | 0.83 | 0.00 | 0.138 | 0.001 |
Mummified 2 | 0.50 | 0.18 | 0.149 | 0.377 |
Total birth weight, kg 1 | 20.49 | 18.77 | 0.731 | 0.452 |
Total live birth weight, kg 1 | 19.67 | 18.77 | 0.959 | 0.545 |
Piglet weight, kg 1 | 1.51 | 1.46 | 0.005 | 0.285 |
CV 1 | 18.36 | 16.60 | 2.548 | 0.364 |
Weight classes of piglets, % | ||||
<1.0 kg 2 | 52.63 | 47.37 | 0.345 | 0.921 |
1.0 a 1.2 kg 2 | 51.28 | 48.72 | 0.354 | 0.774 |
1.2 a 1.45 kg 2 | 59.09 | 40.91 | 0.798 | 0.214 |
1.45 a 1.7 kg 2 | 50.00 | 50.00 | 0.762 | 0.779 |
>1.7 kg 2 | 55.88 | 44.12 | 0.616 | 0.799 |
Item | CON | ARG | SEM | p-Value |
---|---|---|---|---|
Urea, mg/dL | 21.83 | 25.28 | 2.652 | 0.030 |
Estradiol, pg/mL | 517.67 | 638.36 | 28.99 | 0.035 |
Insulin, UI/mL | 4.35 | 5.17 | 1.359 | 0.446 |
Item | CON | ARG | SEM | p-Value |
---|---|---|---|---|
Longissimus dorsi | ||||
Nucleus, % | 19.17 | 20.30 | 0.520 | 0.286 |
Sarcoplasm, % | 33.64 | 32.86 | 0.839 | 0.653 |
Connective tissue, % | 47.19 | 46.84 | 0.820 | 0.835 |
Cells number (0.131 mm2) | 134.20 | 141.06 | 3.448 | 0.332 |
Semitendinosus | ||||
Nucleus, % | 22.08 | 21.85 | 0.473 | 0.823 |
Sarcoplasm, % | 30.81 | 30.50 | 0.601 | 0.804 |
Connective tissue, % | 47.11 | 47.65 | 0.516 | 0.528 |
Cells number (0.131 mm2) | 136.95 | 131.65 | 2.880 | 0.370 |
Item | CON | ARG | SEM | p-Value |
---|---|---|---|---|
mTOR | 1.10 | 1.31 | 0.025 | 0.130 |
IGF-1 | 1.26 | 1.39 | 0.033 | 0.453 |
IGF-2 | 1.49 | 1.84 | 0.038 | 0.062 |
IGF-1R | 1.60 | 1.63 | 0.063 | 0.868 |
IGF-2R | 1.35 | 1.46 | 0.028 | 0.508 |
MYOD | 1.19 | 1.44 | 0.017 | 0.043 |
MSTN | 2.02 | 1.92 | 0.011 | 0.752 |
MRF4 | 2.00 | 1.94 | 0.070 | 0.782 |
MYOG | 0.78 | 1.08 | 0.009 | 0.003 |
MYF5 | 1.08 | 1.01 | 0.017 | 0.570 |
CASP3 | 1.37 | 1.34 | 0.024 | 0.866 |
Atrogin-1 | 2.57 | 2.52 | 0.366 | 0.921 |
MURF-1 | 1.88 | 1.75 | 0.067 | 0.613 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rodrigues, G.d.A.; Júnior, D.T.V.; Soares, M.H.; Silva, C.B.d.; Fialho, F.A.; Barbosa, L.M.d.R.; Neves, M.M.; Rocha, G.C.; Duarte, M.d.S.; Saraiva, A. L-Arginine Supplementation for Nulliparous Sows during the Last Third of Gestation. Animals 2021, 11, 3476. https://doi.org/10.3390/ani11123476
Rodrigues GdA, Júnior DTV, Soares MH, Silva CBd, Fialho FA, Barbosa LMdR, Neves MM, Rocha GC, Duarte MdS, Saraiva A. L-Arginine Supplementation for Nulliparous Sows during the Last Third of Gestation. Animals. 2021; 11(12):3476. https://doi.org/10.3390/ani11123476
Chicago/Turabian StyleRodrigues, Gustavo de Amorim, Dante Teixeira Valente Júnior, Marcos Henrique Soares, Caroline Brito da Silva, Fernanda Abranches Fialho, Lívia Maria dos Reis Barbosa, Mariana Machado Neves, Gabriel Cipriano Rocha, Marcio de Souza Duarte, and Alysson Saraiva. 2021. "L-Arginine Supplementation for Nulliparous Sows during the Last Third of Gestation" Animals 11, no. 12: 3476. https://doi.org/10.3390/ani11123476
APA StyleRodrigues, G. d. A., Júnior, D. T. V., Soares, M. H., Silva, C. B. d., Fialho, F. A., Barbosa, L. M. d. R., Neves, M. M., Rocha, G. C., Duarte, M. d. S., & Saraiva, A. (2021). L-Arginine Supplementation for Nulliparous Sows during the Last Third of Gestation. Animals, 11(12), 3476. https://doi.org/10.3390/ani11123476