Integrated Analysis of lncRNA and mRNA Reveals Novel Insights into Wool Bending in Zhongwei Goat
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals and Sample Collection
2.2. RNA Extraction and Sequencing
2.3. Prediction of lncRNAs Target Genes
2.4. Weighted Gene Co-Expression Network Construction (WGCNA)
2.5. qRT-PCR Analysis
2.6. Differential Expression Analysis of lncRNAs and mRNAs
3. Results
3.1. Whole Transcriptome Sequencing Results
3.2. Identification of lncRNAs and mRNAs in Zhongwei Goat Skin
3.3. Differential mRNAs and lncRNAs Expression Levels
3.4. Differential lncRNAs Target Gene Prediction
3.5. Weighted Gene Co-Expression Network Analysis (WGCNA)
3.6. qRT-PCR Verification Result
3.7. GO and KEGG Enrichment Analysis of lncRNAs Targets
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sulayman, A.; Tian, K.; Huang, X.; Tian, Y.; Xu, X.; Fu, X.; Zhao, B.; Wu, W.; Wang, D.; Yasin, A. Genome-wide identification and characterization of long non-coding RNAs expressed during sheep fetal and postnatal hair follicle development. Sci. Rep. 2019, 9, 8501. [Google Scholar] [CrossRef]
- Lv, X.; Chen, W.; Sun, W.; Hussain, Z.; Wang, S.; Wang, J. Analysis of lncRNAs Expression Profiles in Hair Follicle of Hu Sheep Lambskin. Animals 2020, 10, 1035. [Google Scholar] [CrossRef]
- Lv, X.; Chen, L.; He, S.; Liu, C.; Han, B.; Liu, Z.; Yusupu, M.; Blair, H.; Kenyon, P.; Morris, S.; et al. Effect of Nutritional Restriction on the Hair Follicles Development and Skin Transcriptome of Chinese Merino Sheep. Animals 2020, 10, 1058. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Wang, Z.; Zhu, Y.; Wang, W.; Bai, M.; Jiao, Q.; Wang, Y.; Zhao, S.; Yin, X.; Guo, D. LncRNA-000133 from secondary hair follicle of Cashmere goat: Identification, regulatory network and its effects on inductive property of dermal papilla cells. Anim. Biotechnol. 2020, 31, 122–134. [Google Scholar] [CrossRef]
- Statello, L.; Guo, C.J.; Chen, L.L.; Huarte, M. Gene regulation by long non-coding RNAs and its biological functions. Nat. Rev. Mol. Cell Biol. 2021, 22, 96–118. [Google Scholar] [CrossRef] [PubMed]
- Rao, M.R.S. Long Non Coding RNA Biology Preface. Adv. Exp. Med. Biol. 2017, 1008, Vii–Ix. [Google Scholar]
- Atianand, M.K.; Fitzgerald, K.A. Long non-coding RNAs and control of gene expression in the immune system. Trends Mol. Med. 2014, 20, 623–631. [Google Scholar] [CrossRef] [PubMed]
- Robinson, E.K.; Covarrubias, S.; Carpenter, S. The how and why of lncRNA function: An innate immune perspective. Bba-Gene Regul. Mech. 2020, 1863, 194419. [Google Scholar] [CrossRef]
- Fu, X.; Zhao, B.; Tian, K.; Wu, Y.; Suo, L.; Ba, G.; Ciren, D.; De, J.; Awang, C.; Gun, S. Integrated analysis of lncRNA and mRNA reveals novel insights into cashmere fineness in Tibetan cashmere goats. PeerJ 2020, 8, e10217. [Google Scholar] [CrossRef]
- Lv, X.; Gao, W.; Jin, C.; Wang, Y.; Chen, W.; Wang, L.; Zou, S.; Sheng, S.; Chen, L.; Sun, W. Divergently expressed RNA identification and interaction prediction of long non-coding RNA and mRNA involved in Hu sheep hair follicle. Sci. Rep. 2019, 9, 7283. [Google Scholar] [CrossRef]
- Hynd, P.I.; Edwards, N.M.; Hebart, M.; McDowall, M.; Clark, S. Wool fibre crimp is determined by mitotic asymmetry and position of final keratinisation and not ortho- and para-cortical cell segmentation. Animal 2009, 3, 838–843. [Google Scholar] [CrossRef] [PubMed]
- Nay, T.; Johnson, H. Follicle curvature and crimp size in some selected Australian Merino groups. Aust. J. Agric. Res. 1967, 18, 833–840. [Google Scholar] [CrossRef]
- Sennett, R.; Rendl, M. Mesenchymal-epithelial interactions during hair follicle morphogenesis and cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. [Google Scholar] [CrossRef]
- Schneider, M.R.; Schmidt-Ullrich, R.; Paus, R. The Hair Follicle as a Dynamic Miniorgan. Curr. Biol. 2009, 19, R132–R142. [Google Scholar] [CrossRef] [PubMed]
- Jiao, Q.; Yin, R.H.; Zhao, S.J.; Wang, Z.Y.; Zhu, Y.B.; Wang, W.; Zheng, Y.Y.; Yin, X.B.; Guo, D.; Wang, S.Q.; et al. Identification and molecular analysis of a lncRNA-HOTAIR transcript from secondary hair follicle of cashmere goat reveal integrated regulatory network with the expression regulated potentially by its promoter methylation. Gene 2019, 688, 182–192. [Google Scholar] [CrossRef] [PubMed]
- Zhao, R.; Li, J.; Liu, N.; Li, H.; Liu, L.; Yang, F.; Li, L.; Wang, Y.; He, J. Transcriptomic Analysis Reveals the Involvement of lncRNA-miRNA-mRNA Networks in Hair Follicle Induction in Aohan Fine Wool Sheep Skin. Front. Genet. 2020, 11, 590. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef]
- Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.Q.; Zhao, S.Q.; Wei, L.; Gao, G. CPC: Assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 2007, 35, W345–W349. [Google Scholar] [CrossRef]
- Sun, L.; Luo, H.; Bu, D.; Zhao, G.; Yu, K.; Zhang, C.; Liu, Y.; Chen, R.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef]
- Li, A.; Zhang, J.; Zhou, Z. PLEK: A tool for predicting long non-coding RNAs and messenger RNAs based on an improved k-mer scheme. BMC Bioinform. 2014, 15, 311. [Google Scholar] [CrossRef]
- Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: The protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef]
- Li, J.; Ma, W.; Zeng, P.; Wang, J.; Geng, B.; Yang, J.; Cui, Q. LncTar: A tool for predicting the RNA targets of long noncoding RNAs. Brief. Bioinform. 2015, 16, 806–812. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef]
- Young, M.D.; Wakefield, M.J.; Smyth, G.K.; Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010, 11, R14. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Mao, X.; Cai, T.; Luo, J.; Wei, L. KOBAS server: A web-based platform for automated annotation and pathway identification. Nucleic Acids Res. 2006, 34, W720–W724. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zhang, X.D.; Liu, X.; Li, Y.S.; Ding, J.P.; Zhang, X.R.; Zhang, Y.H. Reference gene screening for analyzing gene expression across goat tissue. Asian-Aust. J. Anim. Sci. 2013, 26, 1665–1671. [Google Scholar] [CrossRef]
- Maloney, B.; Balaraman, Y.; Liu, Y.; Chopra, N.; Edenberg, H.J.; Kelsoe, J.; Nurnberger, J.I.; Lahiri, D.K. Lithium alters expression of RNAs in a type-specific manner in differentiated human neuroblastoma neuronal cultures, including specific genes involved in Alzheimer’s disease. Sci. Rep. 2019, 9, 18261. [Google Scholar] [CrossRef] [PubMed]
- Cogburn, L.A.; Trakooljul, N.; Wang, X.; Ellestad, L.E.; Porter, T.E. Transcriptome analyses of liver in newly-hatched chicks during the metabolic perturbation of fasting and re-feeding reveals THRSPA as the key lipogenic transcription factor. BMC Genom. 2020, 21, 109. [Google Scholar] [CrossRef]
- Han, Y.; Liu, Y.; Yang, C.; Gao, C.; Guo, X.; Cheng, J. LncRNA CASC2 inhibits hypoxia-induced pulmonary artery smooth muscle cell proliferation and migration by regulating the miR-222/ING5 axis. Cell. Mol. Biol. Lett. 2020, 25, 21. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Shahid, M.Q.; Wen, M.; Chen, S.; Yu, H.; Jiao, Y.; Lu, Z.; Li, Y.; Liu, X. Global identification and analysis revealed differentially expressed lncRNAs associated with meiosis and low fertility in autotetraploid rice. BMC Plant Biol. 2020, 20, 82. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.M.; Wang, Y.; Liu, S.Q.; Zhou, M.Y.; Guo, Y.R. Profile and validation of dysregulated long noncoding RNAs and mRNAs in ovarian cancer. Oncol. Rep. 2018, 40, 2964–2976. [Google Scholar] [PubMed]
- Cai, H.; Zhu, X.; Li, Z.; Zhu, Y.; Lang, J. lncRNA/mRNA profiling of endometriosis rat uterine tissues during the implantation window. Int. J. Mol. Med. 2019, 44, 2145–2160. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Jin, J.; Xu, Z.; Zuo, B. Functions and Regulatory Mechanisms of lncRNAs in Skeletal Myogenesis, Muscle Disease and Meat Production. Cells 2019, 8, 1107. [Google Scholar] [CrossRef]
- Bildgaard, C.; Do Canto, L.M.; Steffensen, K.D.; Rogatto, S.R. Long Non-coding RNAs Involved in Resistance to Chemotherapy in Ovarian Cancer. Front. Oncol. 2019, 9, 1549. [Google Scholar] [CrossRef]
- George, M.R.; Duan, Q.; Nagle, A.; Kathiriya, I.S.; Huang, Y.; Rao, K.; Haldar, S.M.; Bruneau, B.G. Minimal in vivo requirements for developmentally regulated cardiac long intergenic non-coding RNAs. Development 2019, 146, dev185314. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Fan, Z.; Wang, X.; Mo, M.; Zeng, S.B.; Xu, R.H.; Wang, X.; Wu, Y. PI3K/Akt signaling pathway is essential for de novo hair follicle regeneration. Stem Cell Res. 2020, 11, 144. [Google Scholar] [CrossRef]
- Belmadani, A.; Jung, H.; Ren, D.; Miller, R.J. The chemokine SDF-1/CXCL12 regulates the migration of melanocyte progenitors in mouse hair follicles. Differentiation 2009, 77, 395–411. [Google Scholar] [CrossRef] [PubMed]
- Harmon, C.S.; Nevins, T.D. Evidence that activation of protein kinase A inhibits human hair follicle growth and hair fibre production in organ culture and DNA synthesis in human and mouse hair follicle organ culture. Br. J. Dermatol. 1997, 136, 853–858. [Google Scholar] [CrossRef]
- Drosten, M.; Lechuga, C.G.; Barbacid, M. Ras signaling is essential for skin development. Oncogene 2014, 33, 2857–2865. [Google Scholar] [CrossRef]
- Tang, L.; Liang, Y.; Xie, H.; Yang, X.; Zheng, G. Long non-coding RNAs in cutaneous biology and proliferative skin diseases: Advances and perspectives. Cell Prolif. 2020, 53, e12698. [Google Scholar] [CrossRef]
- Telerman, S.B.; Rognoni, E.; Sequeira, I.; Pisco, A.O.; Lichtenberger, B.M.; Culley, O.J.; Viswanathan, P.; Driskell, R.R.; Watt, F.M. Dermal Blimp1 Acts Downstream of Epidermal TGFbeta and Wnt/beta-Catenin to Regulate Hair Follicle Formation and Growth. J. Investig. Dermatol. 2017, 137, 2270–2281. [Google Scholar] [CrossRef]
- Liu, Y.; Snedecor, E.R.; Choi, Y.J.; Yang, N.; Zhang, X.; Xu, Y.; Han, Y.; Jones, E.C.; Shroyer, K.R.; Clark, R.A.; et al. Gorab Is Required for Dermal Condensate Cells to Respond to Hedgehog Signals during Hair Follicle Morphogenesis. J. Investig. Dermatol. 2016, 136, 378–386. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Gilissen, J.; Jouret, F.; Pirotte, B.; Hanson, J. Insight into SUCNR1 (GPR91) structure and function. Pharmacol. Ther. 2016, 159, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Cai, B.; Zheng, Y.; Ma, S.; Xing, Q.; Wang, X.; Yang, B.; Yin, G.; Guan, F. Long noncoding RNA regulates hair follicle stem cell proliferation and differentiation through PI3K/AKT signal pathway. Mol. Med. Rep. 2018, 17, 5477–5483. [Google Scholar]
- Feutz, A.C.; Barrandon, Y.; Monard, D. Control of thrombin signaling through PI3K is a mechanism underlying plasticity between hair follicle dermal sheath and papilla cells. J. Cell Sci. 2008, 121, 1435–1443. [Google Scholar] [CrossRef]
- Kang, X.; Liu, G.; Liu, Y.; Xu, Q.; Zhang, M.; Fang, M. Transcriptome profile at different physiological stages reveals potential mode for curly fleece in Chinese tan sheep. PLoS ONE 2013, 8, e71763. [Google Scholar] [CrossRef]
- Nakatake, Y.; Hoshikawa, M.; Asaki, T.; Kassai, Y.; Itoh, N. Identification of a novel fibroblast growth factor, FGF-22, preferentially expressed in the inner root sheath of the hair follicle. Biochim. Biophys. Acta 2001, 1517, 460–463. [Google Scholar] [CrossRef]
- Kawano, M.; Komi-Kuramochi, A.; Asada, M.; Suzuki, M.; Oki, J.; Jiang, J.; Imamura, T. Comprehensive analysis of FGF and FGFR expression in skin: FGF18 is highly expressed in hair follicles and capable of inducing anagen from telogen stage hair follicles. J. Investig. Dermatol. 2005, 124, 877–885. [Google Scholar] [CrossRef]









| Sample | Clean Bases | Clean Reads | Clean GC | Clean Q20 (%) | Clean Q30 (%) |
|---|---|---|---|---|---|
| d10801 | 14,610,168,300 | 48,700,561 | 46.05 | 99.01; 95.36 | 96.91; 90.02 |
| d10802 | 18,156,167,100 | 60,520,557 | 45.11 | 99.03; 95.81 | 97.12; 91.05 |
| d10803 | 19,196,462,400 | 63,988,208 | 46.45 | 99.02; 95.71 | 97.09; 90.82 |
| d4501 | 16,044,002,400 | 53,480,008 | 47.09 | 99.03; 95.62 | 96.96; 90.53 |
| d4502 | 15,798,806,400 | 52,662,688 | 46.22 | 98.96; 95.70 | 96.81; 90.81 |
| d4503 | 15,817,844,400 | 52,726,148 | 45.44 | 98.97; 96.10 | 96.85; 91.52 |
| Type | Gene ID/Symbol | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|---|
| mRNA | SUCNR1 | GAGGAACAGGCAGCTCACTA | CCGGACATTTCGCATGACAT |
| SNX11 | AGAACCAAGAGCAGGAGACC | AAACCCGCATTTCTCTGGAG | |
| LOC102181858 | CCCAATGGTCATCTTCTGCC | CCAGGGTTTTAGAGTGCCAT | |
| RAB30 | GAATCCTTCCGTTGCCTTCC | GACCTCTCTCCTTTCAGCCA | |
| LOC102175070 | TGTAGAAACCTGGTCCCTGT | CAGGCCTCTTTTGTCCGTTA | |
| CHRNA3 | CGACTATGATGGGGCTGAGT | CTTTGATGATGGCCCACTCG | |
| SELP | CCGGCAAGTGGAATGATGAG | ACAGGAGCAGGTGTAGTTCC | |
| C10H15orf62 | CAGACACCCTCCACCAATCT | CCCAGGTCCACTTTGAAGGA | |
| lncRNA | LOC102191729 | CATGATGAAGGGAGCACTGC | CATCAAGTCCCGCCTCATTG |
| XLOC_028447 | CGACAGAGCATGCATGTGAA | GCAATGACCGTGAGCCTTAG | |
| XLOC_031120 | GGTTTCCCGCCTTTTCACAT | TGGGACTGCTGTAGGGAAAG | |
| LOC102172600 | CTGCGTTGTCTCATCACTCC | GTTGTTCTTCGGAGGGCTTG | |
| LOC102191351 | ACAGAGAAGAGCGATGTTGC | CTTCTAACCACTGGACTGCC | |
| XLOC_000705 | GGAAACTACTATGGCGGCCT | AGCCACTTCCACAGAGAGAG | |
| XLOC_026573 | ATCTTAGCCACTGGACCACC | ACCTGCTGAACCTGCTGTAT | |
| XLOC_022611 | GTTGGCGAGTGTTCTGAGC | GAAGGCACCTCTCTCGATGA | |
| Reference gene [28] | GAPDH | TGGCAAAGTGGACATCGTTG | GGACTCCACCACGTACTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Liu, Z.; Ye, S.; Liu, Y.; Chen, Q.; Guan, W.; Pu, Y.; Jiang, L.; He, X.; Ma, Y.; et al. Integrated Analysis of lncRNA and mRNA Reveals Novel Insights into Wool Bending in Zhongwei Goat. Animals 2021, 11, 3326. https://doi.org/10.3390/ani11113326
Li X, Liu Z, Ye S, Liu Y, Chen Q, Guan W, Pu Y, Jiang L, He X, Ma Y, et al. Integrated Analysis of lncRNA and mRNA Reveals Novel Insights into Wool Bending in Zhongwei Goat. Animals. 2021; 11(11):3326. https://doi.org/10.3390/ani11113326
Chicago/Turabian StyleLi, Xiaobo, Zhanfa Liu, Shaohui Ye, Yue Liu, Qian Chen, Weijun Guan, Yabin Pu, Lin Jiang, Xiaohong He, Yuehui Ma, and et al. 2021. "Integrated Analysis of lncRNA and mRNA Reveals Novel Insights into Wool Bending in Zhongwei Goat" Animals 11, no. 11: 3326. https://doi.org/10.3390/ani11113326
APA StyleLi, X., Liu, Z., Ye, S., Liu, Y., Chen, Q., Guan, W., Pu, Y., Jiang, L., He, X., Ma, Y., & Zhao, Q. (2021). Integrated Analysis of lncRNA and mRNA Reveals Novel Insights into Wool Bending in Zhongwei Goat. Animals, 11(11), 3326. https://doi.org/10.3390/ani11113326

