Effects of Dietary Supplementation with Epigallocatechin Gallate on Meat Quality and Muscle Antioxidant Capacity of Broilers Subjected to Acute Heat Stress
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methods and Materials
2.1. Animals, Diets, and Management
2.2. Samples and Collection
2.3. Meat Quality Analysis
2.4. Metabolite Content and Enzyme Activity Assay
2.5. Real-Time PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Carcass Traits
3.2. Meat Quality and Muscle Lactic Acid and Glycogen Contents
3.3. The Activities of Antioxidant Enzyme and the Contents of MDA and PC in Muscle
3.4. Expression of Genes Related to Nrf2 Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lara, L.J.; Rostagno, M.H. Impact of heat stress on poultry production. Animals 2013, 3, 356–369. [Google Scholar] [CrossRef] [PubMed]
- Nienaber, J.A.; Hahn, G.L. Livestock production system management responses to thermal challenges. Int. J. Biometeorol. 2007, 52, 149–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- AL-Sagan, A.A.; Khalil, S.; Hussein, E.O.S.; Attia, Y.A. Effects of fennel seed powder supplementation on growth performance, carcass characteristics, meat quality, and economic efficiency of broilers under thermoneutral and chronic heat stress conditions. Animals 2020, 10, 206. [Google Scholar] [CrossRef] [Green Version]
- Attia, Y.A.; Al-Harthi, M.A.; Elnaggar, A.S. Productive, physiological and immunological responses of two broiler strains fed different dietary regimens and exposed to heat stress. Ita. J. Anim. Sci. 2018, 17, 686–697. [Google Scholar] [CrossRef] [Green Version]
- Attia, Y.A.; Hassan, S.S. Broiler tolerance to heat stress at various dietary protein/energy levels. Europ. Poult. Sci. 2017, 81. [Google Scholar] [CrossRef]
- Zhang, C.; Zhao, X.H.; Wang, L.; Yang, L.; Chen, X.Y.; Geng, Z.Y. Resveratrol beneficially affects meat quality of heat-stressed broilers which is associated with changes in muscle antioxidant status. Anim. Sci. J. 2017, 88, 1569–1574. [Google Scholar] [CrossRef] [PubMed]
- Sahin, K.; Orhan, C.; Tuzcu, M.; Sahin, N.; Hayirli, A.; Bilgili, S.; Kucuk, O. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers. Poult. Sci. 2016, 95, 1088–1095. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Hu, Z.; Lu, C.; Bai, K.; Zhang, L.; Wang, T. Effect of various levels of dietary curcumin on meat quality and antioxidant profile of breast muscle in broilers. J. Agric. Food Chem. 2015, 63, 3880–3886. [Google Scholar] [CrossRef]
- Hu, H.; Dai, S.; Li, J.; Wen, A.; Bai, X. Glutamine improves heat stress-induced oxidative damage in the broiler thigh muscle by activating the nuclear factor erythroid 2-related 2/Kelch-like Ech-associated protein 1 signaling pathway. Poult. Sci. 2020, 99, 1454–1461. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.K.; Cheung, C.; Reuhl, K.R.; Liu, A.B.; Lee, M.J.; Lu, Y.P.; Yang, C.S. Effects of green tea polyphenol (-)-epigallocatechin-3-gallate on newly developed high-fat/Western-style diet-induced obesity and metabolic syndrome in mice. J. Agric. Food Chem. 2011, 59, 11862–11871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Yuan, Z.; Zhang, K.; Ding, X.; Bai, S.; Zeng, Q.; Peng, H.; Celi, P. Epigallocatechin-3-gallate protected vanadium-induced eggshell depigmentation via P38mapk-Nrf2/HO-1 signaling pathway in laying hens. Poult. Sci. 2018, 97, 3109–3118. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Lei, X.; Luo, J.; Everaert, N.; Zhao, G.; Wen, J.; Yang, Y. The effect of epigallocatechin-3-gallate on small intestinal morphology, antioxidant capacity and anti-inflammatory effect in heat-stressed broilers. J. Anim. Physiol. Anim. Nutr. 2019, 103, 1030–1038. [Google Scholar] [CrossRef] [PubMed]
- Xue, B.; Song, J.; Liu, L.; Luo, J.; Tian, G.; Yang, Y. Effect of epigallocatechin gallate on growth performance and antioxidant capacity in heat-stressed broilers. Arch. Anim. Nutr. 2017, 71, 362–372. [Google Scholar] [CrossRef]
- Ma, Y.; Shi, Y.; Wu, Q.; Ma, W. Epigallocatechin-3-gallate alleviates vanadium-induced reduction of antioxidant capacity via Keap1-Nrf2-Smaf pathway in the liver, kidney, and ovary of laying hens. Biol. Trace Elem. Res. 2021, 199, 2707–2716. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Wang, C.; Zhao, X.H.; Chen, K.K.; Geng, Z.Y. Effect of L-theanine on meat quality, muscle amino acid profiles, and antioxidant status of broilers. Anim. Sci. J. 2020, 91, e13351. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Yang, L.; Zhao, X.H.; Chen, X.Y.; Wang, L.; Geng, Z.Y. Effect of dietary resveratrol supplementation on meat quality, muscle antioxidative capacity and mitochondrial biogenesis of broilers. J. Sci. Food Agric. 2018, 98, 1216–1221. [Google Scholar] [CrossRef] [PubMed]
- Bai, K.; Huang, Q.; Zhang, J.; He, J.; Zhang, L.; Wang, T. Supplemental effects of probiotic bacillus subtilis fmbj on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poult. Sci. 2017, 96, 74–82. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative Pcr and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Friedman, M. Overview of Antibacterial, Antitoxin, Antiviral, and Antifungal Activities of Tea Flavonoids and Teas. Mol. Nutr. Food Res. 2007, 51, 116–134. [Google Scholar] [CrossRef] [PubMed]
- Nichols, J.A.; Katiyar, S.K. Skin photoprotection by natural polyphenols: Anti-inflammatory, antioxidant and DNA repair mechanisms. Arch. Dermatol. Res. 2010, 302, 71–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Y.C.; Bachrach, U. The specific anti-cancer activity of green tea (-)-epigallocatechin-3-gallate (Egcg). Amino Acids 2002, 22, 131–143. [Google Scholar] [CrossRef]
- Remely, M.; Ferk, F.; Sterneder, S.; Setayesh, T.; Roth, S.; Kepcija, T.; Noorizadeh, R.; Rebhan, I.; Greunz, M.; Beckmann, J.; et al. EGCG prevents high fat diet-induced changes in gut microbiota, decreases of DNA strand breaks, and changes in expression and DNA methylation of Dnmt1 and Mlh1 in C57bl/6j male mice. Oxid. Med. Cell. Longev. 2017, 2017, 3079148. [Google Scholar] [CrossRef] [Green Version]
- Smith, M.O. Nutrient content of carcass parts from broilers reared under cycling high temperatures. Poult. Sci. 1993, 72, 2166–2171. [Google Scholar] [CrossRef]
- Zaboli, G.; Huang, X.; Feng, X.; Ahn, D.U. How can heat stress affect chicken meat quality?—A Review. Poult. Sci. 2019, 98, 1551–1556. [Google Scholar] [CrossRef]
- Lu, Z.; He, X.; Ma, B.; Zhang, L.; Li, J.; Jiang, Y.; Zhou, G.; Gao, F. Chronic heat stress impairs the quality of breast-muscle meat in broilers by affecting redox status and energy-substance metabolism. J. Agric. Food Chem. 2017, 65, 11251–11258. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Du, M.; Xu, Q.; Chen, Y.; Wen, C.; Zhou, Y. Dietary mannan oligosaccharide improves growth performance, muscle oxidative status, and meat quality in broilers under cyclic heat stress. J. Therm. Biol. 2018, 75, 106–111. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Chen, K.K.; Zhao, X.H.; Geng, Z. Protective effects of resveratrol against high ambient temperature-induced spleen dysplasia in broilers through modulating splenic redox status and apoptosis. J. Sci. Food Agric. 2018, 98, 5409–5417. [Google Scholar] [CrossRef]
- Volodina, O.; Ganesan, S.; Pearce, S.C.; Gabler, N.K.; Baumgard, L.H.; Rhoads, R.P.; Selsby, J.T. Short-term heat stress alters redox balance in porcine skeletal muscle. Physiol. Rep. 2017, 5, e13267. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.F.; Bai, K.W.; Su, W.P.; Wang, A.A.; Zhang, L.L.; Huang, K.H.; Wang, T. Curcumin attenuates heat-stress-induced oxidant damage by simultaneous activation of Gsh-related antioxidant enzymes and Nrf2-mediated phase Ii detoxifying enzyme systems in broiler chickens. Poult. Sci. 2018, 97, 1209–1219. [Google Scholar] [CrossRef] [PubMed]
- Surh, Y.J.; Kundu, J.K.; Na, H.K. Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med. 2008, 74, 1526–1539. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, L.; Kwong, M.; Lu, R.; Ginzinger, D.; Lee, C.; Leung, L.; Chan, J.Y. Nrf1 is critical for redox balance and survival of liver cells during development. Mol. Cell. Biol. 2003, 23, 4673–4686. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shanmugam, T.; Selvaraj, M.; Poomalai, S. Epigallocatechin gallate potentially abrogates fluoride induced lung oxidative stress, inflammation via Nrf2/Keap1 signaling pathway in rats: An in-vivo and in-silico study. Int. Immunopharmacol. 2016, 39, 128–139. [Google Scholar] [CrossRef] [PubMed]
Items | 22–42 d | 43–94 d |
---|---|---|
Ingredients (%) | ||
Corn | 62.50 | 75.50 |
Soybean oil Corn protein meal | 2.40 1.20 | 2.50 0.00 |
Soybean meal | 30.33 | 23.77 |
D, L-Methionine | 0.11 | 0.13 |
Salt | 0.30 | 0.30 |
Choline chloride | 0.15 | 0.15 |
CaHPO4·2H2O Limestone | 1.62 1.16 | 1.32 1.10 |
Vitamin premix 1 | 0.03 | 0.03 |
Trace mineral premix 2 | 0.20 | 0.20 |
Total | 100.00 | 100.00 |
Calculated nutrient levels | ||
Metabolizable energy, Mcal/kg | 12.56 | 12.81 |
Crude protein, % | 19.02 | 16.07 |
Lysine, % | 0.99 | 0.85 |
Methionine + cysteine, % | 0.72 | 0.65 |
Available phosphorus, % Calcium, % | 0.40 0.91 | 0.35 0.80 |
Gene | Primer (5’-3’) | GenBank Number |
---|---|---|
β-actin | F: TGATATTGCTGCGCTCGTTG | NM_205518.1 |
R: AACCATCACACCCTGATGTCTG | ||
Nrf2 | F: TTCGCAGAGCACAGATACTTC | NM_205117.1 |
R: TGGGTGGCTGAGTTTGATTAG | ||
HO-1 | F: TGTCCCTCCACGAGTTCAAG | NM_205344.1 |
R: CTCCGAGTTGCTGCCATAGAA | ||
Keap1 | F: CTGCTGGAGTTCGCCTACAC | XM_025145847.1 |
R: CACGCTGTCGATCTGGTATC | ||
NQO1 | F: CTCCGAGTGCTTTGTCTACGA | NM_001277619.1 |
R: ATGGCTGGCATCTCAAACC | ||
SOD1 | F: GGAGTGGCAGAAGTAGAAATAGAAG | NM_205064.1 |
R: AGGTCCAGCATTTCCAGTTAG | ||
CAT | F: GGCGTATGACCCTAGCAACA | NM_001031215.2 |
R: TCTGATAATTGGCCACGCGA | ||
GSH-Px | F: ACGGCGCATCTTCCAAAG | NM_001277853.2 |
R: TGTTCCCCCAACCATTTCTC | ||
GST | F: GGAAGCCATTTTAATGACAGA | XM_ 015284825.2 |
R: TCCTTTAAAAGCCTGTAGCAGA |
Items | CON | AHS | AHS + EGCG | SEM | p-Value |
---|---|---|---|---|---|
Slaughter percentage, % | 87.6 | 85.0 | 87.0 | 0.560 | 0.518 |
Eviscerated carcass percentage, % | 64.5 a | 59.9 b | 63.0 a | 0.641 | 0.004 |
Semi-eviscerated carcass percentage, % | 79.0 | 78.0 | 79.2 | 0.410 | 0.498 |
Breast muscle yield, % | 13.3 | 12.0 | 12.9 | 0.566 | 0.677 |
Leg muscle yield, % | 22.0 | 22.6 | 22.4 | 0.280 | 0.731 |
Items | CON | AHS | AHS + EGCG | SEM | p-Value |
---|---|---|---|---|---|
Drip loss, % | 2.62 b | 3.60 a | 2.97 b | 0.142 | 0.005 |
Cooking loss, % | 19.4 | 23.6 | 20.6 | 0.978 | 0.213 |
Shear force, N | 23.9 | 28.8 | 24.8 | 1.88 | 0.543 |
pH45min | 6.02 | 6.04 | 5.97 | 0.068 | 0.925 |
pH24h | 5.55 a | 5.27 b | 5.66 a | 0.059 | 0.010 |
L*45min | 48.3 | 51.8 | 49.6 | 0.751 | 0.146 |
a*45min | 7.55 a | 5.89 b | 7.37 a | 0.298 | 0.031 |
b*45min | 14.7 | 14.5 | 14.8 | 0.460 | 0.980 |
L*24h | 49.5 b | 54.5 a | 50.0 b | 0.949 | 0.049 |
a*24h | 8.97 a | 6.59 b | 8.58 a | 0.408 | 0.023 |
b*24h | 14.4 | 15.0 | 13.4 | 0.580 | 0.547 |
Items | CON | AHS | AHS + EGCG | SEM | p-Value |
---|---|---|---|---|---|
MDA, nmol/mg protein | 1.98 b | 2.92 a | 2.09 b | 0.177 | 0.049 |
PC, nmol/mg protein | 18.7 | 25.7 | 22.0 | 1.62 | 0.219 |
T-SOD, U/mg protein | 75.2 a | 61.6 b | 68.2 a | 2.34 | 0.045 |
CAT, U/mg protein | 59.5 | 49.9 | 52.2 | 3.59 | 0.521 |
GSH-Px, U/mg protein | 229 | 198 | 220 | 7.45 | 0.250 |
T-SOD/MDA | 42.9 a | 21.6 b | 39.3 a | 3.81 | 0.038 |
CAT/MDA | 28.0 | 18.8 | 25.0 | 2.18 | 0.229 |
GSH-Px/MDA | 125 a | 70.9 b | 108 ab | 9.33 | 0.032 |
Items | CON | AHS | AHS + EGCG | SEM | p-Value |
---|---|---|---|---|---|
Nrf2 | 1.00 a | 0.759 b | 0.981 a | 0.042 | 0.024 |
Keap1 | 1.00 b | 1.469 a | 1.141 b | 0.067 | 0.011 |
HO-1 | 1.00 | 0.898 | 0.946 | 0.037 | 0.601 |
NQO1 | 1.00 a | 0.659 b | 0.903 a | 0.056 | 0.009 |
CAT | 1.00 a | 0.749 b | 0.788 b | 0.046 | 0.027 |
SOD1 | 1.00 | 0.903 | 0.924 | 0.063 | 0.833 |
GSH-Px | 1.00 | 0.891 | 0.968 | 0.026 | 0.199 |
GST | 1.00 | 0.885 | 0.945 | 0.075 | 0.811 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, F.; Wang, X.; Li, Y.; Chen, X.; Geng, Z.; Zhang, C. Effects of Dietary Supplementation with Epigallocatechin Gallate on Meat Quality and Muscle Antioxidant Capacity of Broilers Subjected to Acute Heat Stress. Animals 2021, 11, 3296. https://doi.org/10.3390/ani11113296
Zhao F, Wang X, Li Y, Chen X, Geng Z, Zhang C. Effects of Dietary Supplementation with Epigallocatechin Gallate on Meat Quality and Muscle Antioxidant Capacity of Broilers Subjected to Acute Heat Stress. Animals. 2021; 11(11):3296. https://doi.org/10.3390/ani11113296
Chicago/Turabian StyleZhao, Fei, Xiaocheng Wang, Yang Li, Xingyong Chen, Zhaoyu Geng, and Cheng Zhang. 2021. "Effects of Dietary Supplementation with Epigallocatechin Gallate on Meat Quality and Muscle Antioxidant Capacity of Broilers Subjected to Acute Heat Stress" Animals 11, no. 11: 3296. https://doi.org/10.3390/ani11113296
APA StyleZhao, F., Wang, X., Li, Y., Chen, X., Geng, Z., & Zhang, C. (2021). Effects of Dietary Supplementation with Epigallocatechin Gallate on Meat Quality and Muscle Antioxidant Capacity of Broilers Subjected to Acute Heat Stress. Animals, 11(11), 3296. https://doi.org/10.3390/ani11113296