Next Article in Journal
Aerobic Isolates from Gestational and Non-Gestational Lactating Bitches (Canis lupus familiaris)
Previous Article in Journal
Efficacy and Safety of Dexmedetomidine Premedication in Balanced Anesthesia: A Systematic Review and Meta-Analysis in Dogs
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 11
Issue 11
10.3390/ani11113258
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Role of Birds of the Family Corvidae in Transmitting Sarcocystis Protozoan Parasites

by
Evelina Juozaitytė-Ngugu
,
Saulius Švažas
,
Donatas Šneideris
,
Eglė Rudaitytė-Lukošienė
,
Dalius Butkauskas
and
Petras Prakas
*
Nature Research Centre, Akademijos Str. 2, LT-08412 Vilnius, Lithuania
*
Author to whom correspondence should be addressed.
Animals 2021, 11(11), 3258; https://doi.org/10.3390/ani11113258
Submission received: 25 October 2021 / Revised: 11 November 2021 / Accepted: 12 November 2021 / Published: 14 November 2021
(This article belongs to the Section Birds)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Members of the genus Sarcocystis are protozoan parasites that infect mammals, birds, and reptiles. Sarcocystis spp. have an obligatory two-host prey-predator life cycle. Sarcocysts form in the muscles and central nervous system of the intermediate host, while oocysts and sporocysts develop in the small intestine of the definitive host. There is a lack of studies on omnivorous birds of family Corvidae as potential definitive hosts of Sarcocystis spp. Until now, only S. ovalis has been confirmed to be transmitted via corvids. In the current study, 91 small intestine samples from six corvid species from Lithuania were examined for the presence of Sarcocystis spp. that use birds, carnivorous mammals, and cervids as intermediate hosts. Oocysts of Sarcocystis spp. were observed in 43 samples (47.3%) using a light microscope. Based on molecular methods, 11 Sarcocystis spp., (S. columbae, S. cornixi, S. halieti, S. kutkienae, S. lari, S. turdusi, S. wobeseri, S. arctica, S. lutrae, S. ovalis, and S. oviformis) were identified. These results indicate that corvids may transmit some species of Sarcocystis that use birds and mammals as intermediate hosts.

Abstract

Members of the family Corvidae are ecologically flexible omnivorous birds, particularly adaptive to urban habitats, and living in proximity to humans; these birds may serve as definitive hosts (DH) for Sarcocystis spp., but research about this is lacking. In the present study, intestinal samples from 91 corvids collected in Lithuania were molecularly tested by species-specific PCR targeting the ITS1 and cox1 genes and subsequently sequenced for the presence of Sarcocystis spp. Under a light microscope, oocysts of Sarcocystis spp. were observed in 43 samples (47.3%), while molecular methods, detected Sarcocystis spp. in 77 birds (84.6%). Eleven Sarcocystis spp. (S. columbae, S. cornixi, potentially pathogenic S. halieti, S. kutkienae, S. lari, S. turdusi, S. wobeseri, S. arctica, S. lutrae, S. ovalis, and S. oviformis) were identified in the intestinal samples from six corvid species from Lithuania. Infections with multiple Sarcocystis spp. were detected in 79.2% of the infected corvid birds. Three of the identified Sarcocystis spp. use corvids as intermediate hosts (IH); therefore, corvids may serve as IH and DH of the same Sarcocystis species. Based on molecular results and on corvid diet, omnivorous corvids may play an important role in transmitting Sarcocystis spp.

Graphical Abstract

1. Introduction

Representatives of the genus Sarcocystis (Apicomplexa: Sarcocystidae) are parasitic protozoa widespread in reptiles, birds, and mammals. They are characterised by an obligatory prey-predator two-host life cycle [1]. Asexual multiplication with formation of sarcocysts occurs in extra-intestinal tissues, mainly the muscles, of the intermediate host (IH), while sexual stages of the parasite’s life cycle (oocysts and sporocysts) develop in the small intestine of the definitive host (DH) [2]. The sarcocyst structure is one of the most important criteria for describing Sarcocystis spp., and species cannot be distinguished according to the morphology of parasite sexual stages observed in the DH [1].
Birds have been shown to be DH of at least 17 Sarcocystis spp. worldwide [1,2,3,4,5,6,7,8]. Birds of prey have been reported as DH of Sarcocystis spp. that mainly use birds and small mammals (rodents, lagomorphs, etc.) as IH [1,8,9,10]. The role of omnivorous birds in transmitting Sarcocystis spp. is unclear; however, based on phylogenetic studies, omnivorous birds are likely to be involved in transmitting several Sarcocystis spp. that use carnivores and ungulates as IH [11,12,13].
Corvidae is a family of ecologically flexible omnivorous birds, particularly adaptive to urban habitats close to humans [14,15,16,17]. Carrion of mammals and birds constitutes a significant part of the corvid diet, particularly of common ravens (Corvus corax) and hooded crows (C. cornix) [14,18]. Based on their diet, corvids may act as DH of Sarcocystis spp. [19], but they have received little attention [4,20]. Currently, only one Sarcocystis species, S. ovalis, is confirmed to be transmitted by corvids [20,21]. This species employs cervids such as moose (Alces alces), red deer (Cervus elaphus) and sika deer (C. nippon) as IH [22,23,24] and common magpie (Pica pica) [21] and Japanese jungle crow (C. macrorhynchos) as DH [20].
The aim of the current study was to molecularly identify Sarcocystis spp. in intestinal samples from six corvid species from Lithuania.

2. Materials and Methods

2.1. Animal Collection and Oocysts/Sporocysts Isolation

A total of 91 birds from the Corvidae family were collected between 2015 and 2021. All birds were found dead (as a result of collisions with motor vehicles, power lines, buildings, etc.) and obtained from the Kaunas T. Ivanauskas Zoology Museum, the Lithuanian national authority responsible for monitoring dead or wounded wild birds. Bird samples were kept frozen at −20 °C until a microscopic examination had been conducted. Intestinal samples of 33 hooded crows, 25 common ravens, 21 western jackdaws (Coloeus monedula), 5 rooks (Corvus frugilegus), 4 common magpies and 3 Eurasian jays (Garrulus glandarius) were examined for Sarcocystis spp. Oocysts/sporocysts of Sarcocystis spp. were isolated from the intestinal mucosa of each bird using previously described methodology [25]. All samples underwent further molecular analysis, regardless of whether oocysts/sporocysts were visible under a light microscope.

2.2. Molecular Analysis

Sixteen Sarcocystis spp. with birds as confirmed or presumed DH were tested for whether they could be found in the intestinal samples of corvids from Lithuania (Table 1). Ten of these species, (S. calchasi, S. columbae, S. cornixi, S. corvusi, S. fulicae, S. halieti, S. lari, S. turdusi, S. wobeseri, and S. kutkienae) are found in the muscles of birds as IH; two species, (S. arctica, and S. lutrae) use carnivorous mammals as IH; and four remaining species (S. frondea, S. hardangeri, S. ovalis and S. oviformis) employ cervids as IH [1,11,12,26,27].
Approximately 200 µL of intestinal sediment was taken from each sample and prepared for DNA extraction using GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania). Nested PCR (nPCR) was used to amplify DNA fragments of all parasite species in the study. The external primers SU1F/5.8SR2 amplified the internal transcribed spacer 1 (ITS1) region in Sarcocystis spp. that use birds and carnivores as IH [28]. The SF1/SR5 primer pair was applied for the amplification of partial cytochrome c oxidase subunit I (cox1) gene of Sarcocystis spp. that use cervids as IH [29]. Internal nPCR primers, which were developed and used in this study, are listed in Table 1. PCR reactions were conducted using DreamTaq PCR Master Mix (Thermo Fisher Scientific Baltics, Vilnius, Lithuania) according to the manufacturer’s protocol. The PCR cycling conditions were as previously described [25], with modified annealing temperatures (57–65 °C) depending on the primer pairs used. PCR products were visualised, purified, and directly sequenced as previously described [30]. Nucleotide BLAST was used to compare the obtained sequences [31]. The sequences generated in the present study are available in GenBank with Acc. No. OK481182–OK481382.

2.3. Statistical Analysis

The statistical analyses were performed with Quantitative Parasitology 3.0 software [32]. The Sterne’s exact method was used to calculate 95% confidence interval (CI) for prevalence [33]. To compare Sarcocystis spp. detection rates in the analysed host species, it was estimated the overall frequency of positive parasite cases, which was calculated as the ratio of positive cases from the host species sample size multiplied by the 16 Sarcocystis species tested. The unconditional exact test, which is more sensitive in detecting differences, especially in small sample sizes, evaluated differences in the prevalence of the detected Sarcocystis spp. and in the frequency of positive parasite cases [34].

3. Results

3.1. Sarcocystis spp. Identification in Intestine Samples of Birds of Family Corvidae

Microscopic examination detected, Sarcocystis spp. oocysts in 47.3% (43/91) of birds examined (Table 2). Oocysts measuring 20.4 × 19.3 μm (12.3–25.8 × 12.2–23.7 μm; n = 69) were seen under a light microscope in intestinal mucosa, while free sporocysts were not detected. The molecular method detected Sarcocystis spp. 1.8 times more often (77/91, 84.6%), which was significantly higher (p < 0.001) than the microscopic method. In four cases (two hooded crows and two western jackdaws), Sarcocystis spp. were observed microscopically, but species-specific nPCR did not detect amplified DNA fragments of parasites. Molecular examination revealed high Sarcocystis spp. rates in examined corvid species, varying from 66.7% (in western jackdaw and Eurasian jay) to 100% (in common raven and common magpie). Comparing Sarcocystis spp. infection prevalence obtained in three corvid species with adequate sample size to draw reliable conclusions (N > 20), molecular analysis detected significantly lower prevalence (p = 0.0014) in western jackdaw (14/21, 66.7%) than in common raven (25/25, 100%).
All amplified samples were sequenced and identified as belonging to the species for which the species-specific primers were designed. Comparing ITS1 or cox1 sequences generated in the current study revealed the presence of 11 out of 16 examined Sarcocystis spp. (S. columbae, S. cornixi, S. halieti, S. kutkienae, S. lari, S. turdusi, S. wobeseri, S. arctica, S. lutrae, S. ovalis, and S. oviformis) (Table S1). Sequence similarity values were calculated for obtained isolates, within species (sequences obtained during the current study were compared to sequences of the same species available in NCBI GenBank) and, in comparison, to the most closely related Sarcocystis species (Table 3). Detected Sarcocystis spp. were reliably identified, since sequence similarity within specific species did not overlap in values compared to other valid Sarcocystis species. Analysing ITS1 sequences, the highest intraspecific genetic differences were estimated for S. halieti (0–3.5%) and S. lutrae (0–4.6%). The GenBank accession numbers of analysed sequences of Sarcocystis spp. listed in Table 2 are provided in the supplementary material (Table S2).

3.2. Distribution of Sarcocystis spp. in Examined Hosts

All 11 Sarcocystis spp. identified in this study were detected in hooded crow samples (Table 4). Nine Sarcocystis spp. were found in common raven, six in common magpie, five in western jackdaw and three each in rook and Eurasian jay. Sarcocystis wobeseri (n = 51), S. halieti (n = 48) and S. kutkienae (n = 45), were detected more often than other examined species (Table 4). Sarcocystis cornixi (n = 16), S. lari (n = 13) and S. turdusi (n = 13) were detected slightly less, and other Sarcocystis spp. were identified in no more than in five birds. Sarcocystis spp. that use carnivores and cervids as IH were detected only in hooded crow and common raven; however, the number of investigated individuals of other host species was lower, except for western jackdaw (n = 21). When comparing the frequency of positive parasite cases (Table 4) between three corvid species (hooded crow, common raven, and western jackdaw) with adequate sample size to draw reliable conclusions, hooded crow (85/528, 16.1%, p = 0.0054) and common raven (60/400, 15.0%, p = 0.0254) had significantly higher infection rates than western jackdaw (32/336, 9.5%).

3.3. Sarcocystis spp. Mixed Infections

Overall, 84.6% (77/91) of examined corvid birds were positive for at least one Sarcocystis spp. Multiple species of Sarcocystis were common in all corvid host species (Figure 1). Infection with multiple species were found in 79.2% (61/77) of the infected corvid birds, with usually two to four Sarcocystis species in one sample. Six bird each had more than four Sarcocystis species, and a single common magpie and hooded crow contained the most diverse Sarcocystis species, with six and seven parasite species, respectively.

4. Discussion

4.1. Differences in Sarcocystis spp. Detection Using Microscopic and Molecular Methods

Microscopic analysis is essential to describe and characterize Sarcocystis spp. in IH, since parasite species cannot be differentiated by the stages found in DH (oocyst or sporocyst) [1]. Whereas molecular methods can help to identify Sarcocystis spp. from intestinal and faecal samples of predators or omnivorous animals [7,8,10,20,21,25,35,36]. However, detection of Sarcocystis spp. DNA from intestinal and/or faecal samples does not conclusively prove the role of tested animal as DH of these parasites. The detected DNA may also belong to Sarcocystis spp. that had been present in the carrion the bird has been feeding on without infecting analysed animal species. Thus, life cycle experiments are necessary to confirm the results obtained [1]. In the current study, 11 Sarcocystis spp. were identified in mucosal scrapings of corvids based on species-specific nPCR targeting ITS1 or cox1 and subsequent sequencing (Table 3). The overall Sarcocystis spp. detection rate was significantly higher (p < 0.001) by molecular methods (84.6%) than by microscopic examination (47.3%) (Table 2). The study’s findings are consistent with previous research [25,36], showing that molecular methods should be used to examine all samples, rather than just those that are microscopically positive.

4.2. Corvids as Possible DH of some Sarcocystis spp. That Use these Birds as IH

Representatives of the genus Sarcocystis have a diheteroxenous life cycle, meaning different animal species serve as IH and DH [1]. However, some Sarcocystis spp. that use mice, rats and lizards as IH (S. cymruensis, S. dugesii, S. gallotiae, S. muris, S. simonyi, and S. stehlinii) have been shown to have both diheteroxenous and dihomoxenous life cycles, allowing transmission via cannibalism [37,38,39,40,41,42]. Corvids are known to be IH of three Sarcocystis spp. identified in the present study, (S. cornixi [43], S. kutkienae [44] and S. halieti (MZ707148-49, unpublished data) [10]. Sarcocystis cornixi and S. kutkienae form sarcocysts in muscles of corvids, while S. halieti is multi-host adapted, employing birds of several different orders as IH [45,46]. Birds of prey are identified DH of S. cornixi and S. halieti [8,10], and based on phylogenetic placement, birds are the presumed DH of S. kutkienae [44]. As mentioned before, the detected DNA may belong to the sarcocyst from IH that was eaten and was present in intestines without infecting the DH. However, the other possibility that corvids may act both as IH and DH for the same Sarcocystis spp. is intriguing, and more research is needed to reveal this interesting phenomenon. Our data indicate that corvids can feed on carrion of other birds of the Corvidae family, including their conspecifics. For example, groups of hooded crows were observed feeding on carcasses of hooded crows and rooks (presumably killed by poisoning) in a waste disposal area of Klaipeda, Lithuania in January 2016. In several cases, common ravens were recorded feeding on carrion of rooks and western jackdaws killed by cars in Lithuania.

4.3. Occurrence of Sarcocystis Species in the Intestinal Samples of Corvids

In the present study, ten Sarcocystis spp. (S. columbae, S. cornixi, S. halieti, S. kutkienae, S. lari, S. turdusi, S. wobeseri, S. arctica, S. lutrae and S. oviformis) were identified in the intestinal samples of corvids (Table 4) for the first time. It should be noted that DH of S. kutkienae, S. wobeseri, S. arctica, S. lutrae and S. oviformis were unknown [11,12,44,47,48]. Sarcocystis ovalis, which was detected during the current study, was previously determined in faecal and intestinal mucosa samples of common magpie [21] and intestinal mucosa samples of Japanese jungle crow [20]. Of the Sarcocystis spp. identified in this work, S. halieti is potentially pathogenic. Recently, S. halieti-associated encephalitis was reported in a juvenile free-ranging little owl (Athene noctua) from Germany [49]. In this work, S. halieti was one of the most commonly detected species; it was confirmed in hooded crows (n = 20), in common ravens (n = 18), in western jackdaws (n = 7) and in common magpies (n =3) (Table 4). Thus, corvids are likely to be involved in the transmitting pathogenic S. halieti.
In the current study, Sarcocystis spp. were identified in all six studied bird species (hooded crow, common raven, western jackdaw, rook, common magpie, and Eurasian jay). Hooded crow and common raven had significantly higher frequency of positive Sarcocystis spp. cases than western jackdaw. This observation agrees with diet studies of corvids, since common raven and hooded crow are the main scavengers among corvids in Lithuania [50,51]. Carcasses of dead birds and mammals form an important part of the diet of common raven and hooded crow, particularly at waste disposal areas in the winter [51,52]. Common magpie and rook are also frequently observed feeding on carrion of birds [18,51]. Western jackdaws have been observed feeding on small parts of carrion remnants at a waste disposal area in Klaipeda, Lithuania in heavy winter, while Eurasian jays were frequently observed in forests eating the smallest parts of muscles and intestine left in carrion previously used by larger corvids or birds of prey. Based on available data on the corvid diet of and the results of this study, corvids may play an important role in transmitting Sarcocystis spp.
Oocysts or sporocysts of S. calchasi, S. corvusi, S. fulicae, S. hardangeri, and S. frondea were not detected in corvids in this study. Pathogenic S. calchasi infects birds of several orders and has been detected in Germany [53,54], USA [55,56], and Japan [57]. This species is also transmitted by Accipiter hawks [53,54] prevalent in Lithuania [50,52]; however, S. calchasi has not been confirmed in Lithuania yet, may be explained by the possibility that corvids are not the DH of this parasite, or this species is absent or rare in Lithuania. In 2013, S. corvusi was described in the leg muscles of two migrating jackdaws from Lithuania [58], and afterward, there were no more records on this species. Therefore, we hypothesise that this species is absent or rare in the area under investigation. Sarcocysts of S. fulicae were identified solely in muscles of Eurasian coot (Fulica atra) [30], a water bird rarely occurring on land; therefore, corvids have less access to carrion of this species, except for dead individuals rarely found on frozen water bodies in winter [50,51,52]. Sarcocystis hardangeri was identified only in cervids from specific regions of Norway and Iceland [23,59], so, this species is unlikely to be distributed in regions south of Norway. Out of five cervid species examined in Lithuania, S. frondea was found only in introduced sika deer [26]. Therefore, we suppose that S. frondea was not observed in examined corvids due to this species’ low prevalence in Lithuania.

4.4. Molecular Identification of Sarcocystis spp. in Naturally Infected DH

One DH can harbour multiple Sarcocystis species [1,8,10,25]. The present study revealed mixed Sarcocystis spp. infections in 79.2% of the infected corvid birds. The mixed infections in intestinal or faecal samples of naturally infected wild animals cause issues with identifying Sarcocystis spp. In this work, species-specific PCR was applied to detect Sarcocystis spp. Despite the high Sarcocystis spp. detection rate (86.0%), identification of species is sure to be limited. For instance, four samples were microscopically positive for Sarcocystis spp., but molecular analysis did not identify the examined species. These results indicate the presence of other Sarcocystis spp. not tested in the intestinal samples of corvids. Other authors have applied methods apart from species-specific PCR, such as cloning, and metabarcoding, to detect Sarcocystis spp. from samples containing oocysts or sporocysts [60,61,62,63]. However, previously conducted studies were also limited and revealed only a partial diversity of Sarcocystis spp. in certain hosts [8,10,36]. In summary, more sensitive molecular identification techniques of Sarcocystis spp. in intestines and faecal samples of omnivorous animals and predators should be further developed.

5. Conclusions

Based on species-specific nPCR targeting ITS1 or cox1 and subsequent sequencing 11 Sarcocystis spp. that employ birds (S. columbae, S. cornixi, S. halieti, S. kutkienae, S. lari, S. turdusi and S. wobeseri), cervids (S. ovalis and S. oviformis) and carnivorous mammals (S. arctica and S. lutrae) as their IH were identified in the intestinal samples of six corvid species. Ten of these Sarcocystis species were confirmed in corvid intestines for the first time. Therefore, the present study’s results indicate that widespread omnivorous corvids, which live close to humans, could be involved in transmitting these Sarcocystis spp., including potentially pathogenic S. halieti. However, the question remains whether corvids are DH of these identified Sarcocystis spp. or the detected DNA was a residue of food particles present in the intestine of tested birds.
In four cases, light microscopy detected oocysts of Sarcocystis spp. that were not identified by molecular methods. Several other studies also reported that molecular methods were not efficient in revealing the full diversity of Sarcocystis spp. in the intestinal and faecal samples of predators or omnivorous animals. Thus, more sensitive Sarcocystis spp. identification techniques from naturally infected DH must be developed.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/ani11113258/s1. Table S1: Species of Sarcocystis validated in various corvid birds using ITS1 or cox1, Table S2: Sarcocystis species and GenBank accession numbers of sequences used in comparison analysis (Table 3). Sequences obtained in the present study are in boldface.

Author Contributions

Conceptualization, P.P., D.B. and S.Š.; methodology, P.P. and E.R.-L.; software, P.P.; validation, D.B. and P.P.; formal analysis, P.P.; investigation, E.J.-N., D.Š. and E.R.-L.; resources D.B.; data curation, P.P.; writing—original draft preparation, E.J.-N., S.Š., D.Š., E.R.-L., D.B. and P.P.; writing—review and editing, E.J.-N., S.Š., D.Š., E.R.-L., D.B. and P.P.; visualization E.J.-N. and D.Š.; supervision, P.P.; project administration, P.P. and D.B.; funding acquisition, D.B. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Research Council of Lithuania (grant number S-MIP-20-24).

Institutional Review Board Statement

Samples were collected with the permission of the Ministry of Environment of the Republic of Lithuania (2017-03-23 no.26-A4-3119; 2019-03-01 no. 26-A4-1535; 2021-03-31 nr. (26)-SR-89).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data supporting the conclusions of this article are included in the article. The sequences generated in the present study were submitted to the GenBank database under accession numbers OK481182–OK481382.

Acknowledgments

This study was supported by the Open Access research infrastructure of the Nature Research Centre under the Lithuanian open access network initiative. The authors are grateful to Kaunas T. Ivanauskas Zoology Museum for providing bird samples, also to V. Pabrinkis for his great support in bird sampling.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2016. [Google Scholar]
  2. Mehlhorn, H.; Heydorn, A.O. The Sarcosporidia (Protozoa, Sporozoa): Life cycle and fine structure. Adv. Parasitol. 1978, 16, 43–91. [Google Scholar] [CrossRef]
  3. Rommel, M.; Krampitz, H.E. Contributions to the life-cycle of Frenkelia, 1. The identity of Isospora buteonis of Buteo buteo and Frenkelia sp. (F. clethrionomyobuteonis spec. n.) of Clethrionomys glareolus. Berl. MunchTieraerztl. Wschr. 1975, 88, 338–340. [Google Scholar]
  4. Munday, B.L.; Hartley, W.J.; Harrigan, K.E.; Presidente, P.J.; Obendorf, D.L. Sarcocystis and related organisms in Australian Wildlife: II. Survey findings in birds, reptiles, amphibians and fish. J. Wildl. Dis. 1979, 15, 57–73. [Google Scholar] [CrossRef] [Green Version]
  5. Černá, Ž.; Kvasnovska, Z. Life-cycle involving bird-bird relation in Sarcocystis-coccidia with the description of Sarcocystis accipitris sp. n. Folia Parasitol. 1986, 33, 305–309. [Google Scholar]
  6. Svobodová, M. A Sarcocystis species from Goshawk (Accipiter gentilis) with great tit (Parus major) as intermediate host. Acta Protozool. 1996, 35, 223–226. [Google Scholar]
  7. Yabsley, M.J.; Ellis, A.E.; Stallknecht, D.E.; Howerth, E.W. Characterization of Sarcocystis from four species of hawks from Georgia, USA. J. Parasitol. 2009, 95, 256–259. [Google Scholar] [CrossRef] [PubMed]
  8. Mayr, S.L.; Maier, K.; Müller, J.; Enderlein, D.; Gruber, A.D.; Lierz, M. Accipiter hawks (Accipitridae) confirmed as definitive hosts of Sarcocystis turdusi, Sarcocystis cornixi and Sarcocystis sp. ex Phalacrocorax carbo. Parasitol. Res. 2016, 115, 3041–3047. [Google Scholar] [CrossRef]
  9. Svobodová, M.; Vorisek, P.; Votypka, J.; Weidinger, K. Heteroxenous Coccidia (Apicomplexa: Sarcocystidae) in the populations of their final and intermediate hosts: European buzzard and small mammals. Acta Protozool. 2004, 43, 251–260. [Google Scholar]
  10. Gjerde, B.; Vikøren, T.; Hamnes, I.S. Molecular identification of Sarcocystis halieti n. sp., Sarcocystis lari and Sarcocystis truncata in the intestine of a white-tailed sea eagle (Haliaeetus albicilla) in Norway. Int. J. Parasitol. Parasites Wildl. 2018, 7, 1–11. [Google Scholar] [CrossRef]
  11. Gjerde, B.; Schulze, J. Muscular sarcocystosis in two arctic foxes (Vulpes lagopus) due to Sarcocystis arctica n. sp.: Sarcocyst morphology, molecular characteristics and phylogeny. Parasitol. Res. 2014, 113, 811–821. [Google Scholar] [CrossRef]
  12. Gjerde, B.; Josefsen, T.D. Molecular characterisation of Sarcocystis lutrae n. sp. and Toxoplasma gondii from the musculature of two Eurasian otters (Lutra lutra) in Norway. Parasitol. Res. 2015, 114, 873–886. [Google Scholar] [CrossRef] [PubMed]
  13. Gjerde, B.; de la Fuente, C.; Alunda, J.M.; Luzón, M. Molecular characterisation of five Sarcocystis species in domestic sheep (Ovis aries) from Spain. Parasitol. Res. 2020, 119, 215–231. [Google Scholar] [CrossRef] [PubMed]
  14. Cramp, S. Crows to finches. In The Birds of the Western Palearctic; Perrins, C., Cramps, S., Eds.; Oxford University Press: Oxford, UK, 1994. [Google Scholar]
  15. Heinrich, B. Mind of the Raven: Investigations and Adventures with Wolf-Birds Hardcover; Ecco: New York, NY, USA, 1999. [Google Scholar]
  16. Restani, M.; Marzluff, J.M.; Yates, R.E. Effects of anthropogenic food sources on movements, survivorship, and sociality of common ravens in the Arctic. Condor 2001, 103, 399–404. [Google Scholar] [CrossRef]
  17. MarzluffJohn, J.M.; Neatherlin, E. Corvid response to human settlements and campgrounds: Causes, consequences, and challenges for conservation. Biol. Conserv. 2006, 130, 301–314. [Google Scholar] [CrossRef]
  18. Navasaitis, A. Birds of Lithuanian Forests; Mokslas Press: Vilnius, Lithuania, 1983. [Google Scholar]
  19. Chen, X.; Wen, T.; Hu, J.; Liu, T.; Esch, W.G.; Liang, Y.; Li, H.; Huang, S. Sarcocystis dehongensis n. sp. (Apicomplexa: Sarcocystidae) from water buffalo (Bubalus bubalis) in China. Parasitol. Res. 2017, 116, 2145–2150. [Google Scholar] [CrossRef] [PubMed]
  20. Irie, T.; Ikeda, T.; Nakamura, T.; Ichii, O.; Yamada, N.; Ito, T.; Yamazaki, A.; Takai, S.; Yagi, K. First molecular detection of Sarcocystis ovalis in the intestinal mucosa of a Japanese jungle crow (Corvus macrorhynchos) in Hokkaido, Japan. Vet. Parasitol. Reg. Stud. Rep. 2017, 10, 54–57. [Google Scholar] [CrossRef]
  21. Gjerde, B.; Dahlgren, S.S. Corvid birds (Corvidae) act as definitive hosts for Sarcocystis ovalis in moose (Alces alces). Parasitol. Res. 2010, 107, 1445–1453. [Google Scholar] [CrossRef] [PubMed]
  22. Dahlgren, S.S.; Gjerde, B. Sarcocystis in moose (Alces alces): Molecular identification and phylogeny of six Sarcocystis species in moose, and a morphological description of three new species. Parasitol. Res. 2008, 103, 93–110. [Google Scholar] [CrossRef]
  23. Dahlgren, S.S.; Gjerde, B. Molecular characterization of five Sarcocystis species in red deer (Cervus elaphus), including Sarcocystis hjorti n. sp., reveals that these species are not intermediate host specific. Parasitology 2010, 137, 815–840. [Google Scholar] [CrossRef]
  24. Abea, N.; Matsuo, K.; Moribe, J.; Takashima, Y.; Irie, T.; Baba, T.; Gjerde, B. Morphological and molecular characteristics of seven Sarcocystis species from sika deer (Cervus nippon centralis) in Japan, including three new species. Int. J. Parasitol. Parasites Wildl. 2019, 10, 252–262. [Google Scholar] [CrossRef]
  25. Prakas, P.; Balčiauskas, L.; Juozaitytė-Ngugu, E.; Butkauskas, D. The role of mustelids in the transmission of Sarcocystis spp. using cattle as intermediate hosts. Animals 2021, 11, 822. [Google Scholar] [CrossRef]
  26. Rudaitytė-Lukošienė, E.; Prakas, P.; Butkauskas, D.; Kutkienė, L.; Vepštaitė-Monstavičė, I.; Servienė, E. Morphological and molecular identification of Sarcocystis spp. from the sika deer (Cervus nippon), including two new species Sarcocystis frondea and Sarcocystis nipponi. Parasitol. Res. 2018, 117, 1305–1315. [Google Scholar] [CrossRef]
  27. Máca, O.; González-Solís, D. Sarcocystis cristata sp. nov. (Apicomplexa, Sarcocystidae) in the imported great blue turaco Corythaeola cristata (Aves, Musophagidae). Parasit. Vectors 2021, 14, 56. [Google Scholar] [CrossRef]
  28. Gjerde, B. Molecular characterisation of Sarcocystis rileyi from a common eider (Somateria mollissima) in Norway. Parasitol. Res. 2014, 113, 3501–3509. [Google Scholar] [CrossRef] [PubMed]
  29. Gjerde, B. Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome C oxidase subunit I gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef] [PubMed]
  30. Prakas, P.; Butkauskas, D.; Švažas, S.; Juozaitytė-Ngugu, E.; Stanevičius, V. Morphologic and genetic identification of Sarcocystis fulicae n. sp. (Apicomplexa: Sarcocystidae) from the Eurasian coot (Fulica atra). J. Wildl. Dis. 2018, 54, 765–771. [Google Scholar] [CrossRef] [PubMed]
  31. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  32. Rózsa, L.; Reiczigel, J.; Majoros, G. Quantifying parasites in samples of hosts. J. Parasitol. 2000, 86, 228–232. [Google Scholar] [CrossRef]
  33. Reiczigel, J. Confidence intervals for the binomial parameter: Some new considerations. Stat. Med. 2003, 22, 611–621. [Google Scholar] [CrossRef]
  34. Reiczigel, J.; Abonyi-Toth, Z.; Singer, J. An exact confidence set for two binomial proportions and exact unconditional confidence intervals for the difference and ratio of proportions. Comput. Stat. Data Anal. 2008, 52, 5046–5053. [Google Scholar] [CrossRef]
  35. Prakas, P.; Liaugaudaitė, S.; Kutkienė, L.; Sruoga, A.; Švažas, S. Molecular identification of Sarcocystis rileyi sporocysts in red foxes (Vulpes vulpes) and raccoon dogs (Nyctereutes procyonoides) in Lithuania. Parasitol. Res. 2015, 114, 1671–1676. [Google Scholar] [CrossRef] [PubMed]
  36. Prakas, P.; Rudaitytė-Lukošienė, E.; Šneideris, D.; Butkauskas, D. Invasive American mink (Neovison vison) as potential definitive host of Sarcocystis elongata, S. entzerothi, S. japonica, S. truncata and S. silva using different cervid species as intermediate hosts. Parasitol. Res. 2021, 120, 2243–2250. [Google Scholar] [CrossRef]
  37. Matuschka, F.R.; Bannert, B. Cannibalism and autotomy as predator-prey relationship for Monoxenous Sarcosporidia. Parasitol. Res. 1987, 74, 88–93. [Google Scholar] [CrossRef] [PubMed]
  38. Matuschka, F.R. Studies on the life cycle of Sarcocystis dugesii in the madeiran wall lizard Podarcis (syn. Lacerta) dugesii. Parasitol. Res. 1988, 75, 73–75. [Google Scholar] [CrossRef]
  39. Matuschka, F.R.; Bannert, B. Recognition of cyclic transmission of Sarcocystis stehlinii n. sp. in the Gran Canarian giant lizard. J. Parasitol. 1989, 75, 383–387. [Google Scholar] [CrossRef] [PubMed]
  40. Bannert, B. Sarcocystis simonyi sp. nov. (Apicomplexa Sarcocystidae) from the endangered Hierro giant lizard Gallotia simonyi (Reptilia Lacertidae). Parasitol. Res. 1992, 78, 142–145. [Google Scholar] [CrossRef]
  41. Koudela, B.; Modrý, D. Sarcocystis muris possesses both Diheteroxenous and Dihomoxenous characters of life cycle. J. Parasitol. 2000, 86, 877–879. [Google Scholar] [CrossRef]
  42. Hu, J.J.; Liao, J.Y.; Meng, Y.; Guo, Y.M.; Chen, X.W.; Zuo, Y.X. Identification of Sarcocystis cymruensis in wild Rattus flavipectus and Rattus norvegicus from Peoples Republic of China and its transmission to rats and cats. J. Parasitol. 2011, 97, 421–424. [Google Scholar] [CrossRef]
  43. Kutkienė, L.; Prakas, P.; Sruoga, A.; Butkauskas, D. Sarcocystis in the birds family Corvidae with description of Sarcocystis cornixi sp. nov. from the hooded crow (Corvus cornix). Parasitol. Res. 2009, 104, 329–336. [Google Scholar] [CrossRef]
  44. Prakas, P.; Butkauskas, D.; Juozaitytė-Ngugu, E. Molecular and morphological description of Sarcocystis kutkienae sp. nov. from the common raven (Corvus corax). Parasitol. Res. 2020, 119, 4205–4210. [Google Scholar] [CrossRef]
  45. Prakas, P.; Butkauskas, D.; Juozaitytė-Ngugu, E. Molecular identification of four Sarcocystis species in the herring gull, Larus argentatus, from Lithuania. Parasit. Vectors 2020, 13, 1–6. [Google Scholar] [CrossRef]
  46. Prakas, P.; Bea, A.; Juozaitytė-Ngugu, E.; Olano, I.; Villanúa, D.; Švažas, S.; Butkauskas, D. Molecular identification of Sarcocystis halieti in the muscles of two species of birds of prey from Spain. Parasit. Vectors 2021, 14, 414. [Google Scholar] [CrossRef]
  47. Dahlgren, S.S.; Gjerde, B. Sarcocystis in Norwegian roe deer (Capreolus capreolus): Molecular and morphological identification of Sarcocystis oviformis n. sp. and Sarcocystis gracilis and their phylogenetic relationship with other Sarcocystis species. Parasitol. Res. 2009, 104, 993–1003. [Google Scholar] [CrossRef] [PubMed]
  48. Shadbolt, T.; Pocknell, A.; Sainsbury, A.W.; Egerton-Read, S.; Blake, D.P. Molecular identification of Sarcocystis wobeseri-like parasites in a new intermediate host species, the white-tailed sea eagle (Haliaeetus albicilla). Parasitol. Res. 2021, 120, 1845–1850. [Google Scholar] [CrossRef] [PubMed]
  49. Maier-Sam, K.; Kaiponen, T.; Schmitz, A.; Schulze, C.; Bock, S.; Hlinak, A.; Olias, P. Encephalitis associated with Sarcocystis halieti infection in a free-ranging little owl (Athene noctua). J. Wildl. Dis. 2021, 57, 712–714. [Google Scholar] [CrossRef] [PubMed]
  50. Ivanauskas, T. Lithuanian Birds; Mokslas Press: Vilnius, Lithuania, 1964. [Google Scholar]
  51. Logminas, V.; Nedzinskas, V.; Drobelis, E.; Petraitis, A.; Patapavičius, R.; Žalakevičius, M.; Valius, M.; Šablevičius, B.; Gražulevičius, G.; Raudonikis, L.; et al. Lithuanian Fauna. Birds; Mokslas Press: Vilnius, Lithuania, 1990. [Google Scholar]
  52. Kurlavičius, P.; Preikša, Ž.; Skuja, S.; Kirstukas, M.; Brazaitis, G.; Stanevičius, V.; Mačiulis, M.; Jusys, V.; Butleris, A.; Raudonikis, L.; et al. Lithuanian Breeding Bird Atlas; Lututė Press: Kaunas, Lithuania, 2006. [Google Scholar]
  53. Olias, P.; Gruber, A.D.; Hafez, H.M.; Heydorn, A.O.; Mehlhorn, H.; Lierz, M. Sarcocystis calchasi sp. nov. of the Domestic pigeon (Columba livia f. domestica) and the Northern goshawk (Accipiter gentilis): Light and electron microscopical characteristics. Parasitol. Res. 2010, 106, 577–585. [Google Scholar] [CrossRef] [PubMed]
  54. Parmentier, S.L.; Maier-Sam, K.; Failing, K.; Enderlein, D.; Gruber, D.A.; Lierz, M. Prevalence of Sarcocystis calchasi in free-ranging host species: Accipiter hawks and common woodpigeon in Germany. Sci. Rep. 2018, 8, 17610. [Google Scholar] [CrossRef] [PubMed]
  55. Wünschmann, A.; Armien, A.G.; Reed, L.; Gruber, A.D.; Olias, P. Sarcocystis calchasi-associated neurologic disease in a domestic pigeon in North America. Transbound. Emerg. Dis. 2011, 58, 526–530. [Google Scholar] [CrossRef]
  56. Rimoldi, G.; Speer, B.; Wellehan, J.F., Jr.; Bradway, D.S.; Wright, L.; Reavill, D.; Barr, B.C.; Childress, A.; Shivaprasad, H.L.; Chin, R.P. An outbreak of Sarcocystis calchasi encephalitis in multiple psittacine species within an enclosed zoological aviary. J. Vet. Diagn. Investig. 2013, 25, 775–781. [Google Scholar] [CrossRef] [Green Version]
  57. Ushio, N.; Watanabe, K.; Chambers, J.K.; Shibato, T.; Nakayama, H.; Uchida, K. Sarcocystis calchasi encephalitis in a rock pigeon. J. Vet. Med. Sci. 2015, 77, 1523–1526. [Google Scholar] [CrossRef] [Green Version]
  58. Prakas, P.; Kutkienė, L.; Butkauskas, D.; Sruoga, A.; Žalakevičius, M. Molecular and morphological investigations of Sarcocystis corvusi sp. nov. from the Jackdaw (Corvus monedula). Parasitol. Res. 2013, 112, 1163–1167. [Google Scholar] [CrossRef]
  59. Dahlgren, S.S.; Gjerde, B.; Skirnisson, K.; Gudmundsdottir, B. Morphological and molecular identification of three species of Sarcocystis in Reindeer (Rangifer tarandus tarandus) in Iceland. Vet. Parasitol. 2007, 149, 191–198. [Google Scholar] [CrossRef]
  60. Lau, Y.L.; Chang, P.Y.; Subramaniam, V.; Ng, Y.H.; Mahmud, R.; Ahmad, A.F.; Fong, M.Y. Genetic assemblage of Sarcocystis spp. in Malaysian snakes. Parasit. Vectors 2013, 6, 257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  61. Moré, G.; Maksimov, A.; Conraths, F.J.; Schares, G. Molecular identification of Sarcocystis spp. in foxes (Vulpes vulpes) and raccoon dogs (Nyctereutes procyonoides) from Germany. Vet. Parasitol. 2016, 220, 9–14. [Google Scholar] [CrossRef] [PubMed]
  62. Lesniak, I.; Franz, M.; Heckmann, I.; Greenwood, A.D.; Hofer, H.; Krone, O. Surrogate hosts: Hunting dogs and recolonizing grey wolves share their endoparasites. Int. J. Parasitol. Parasites Wildl. 2017, 6, 278–286. [Google Scholar] [CrossRef] [PubMed]
  63. Basso, W.; Alvarez Rojas, C.A.; Buob, D.; Ruetten, M.; Deplazes, P. Sarcocystis infection in red deer (Cervus elaphus) with eosinophilic myositis/fasciitis in Switzerland and involvement of red foxes (Vulpes vulpes) and hunting dogs in the transmission. Int. J. Parasitol. Parasites Wildl. 2020, 13, 130–141. [Google Scholar] [CrossRef]
Animals 11 03258 g001 550
Figure 1. Distribution of the number of Sarcocystis species detected in one sample.
Figure 1. Distribution of the number of Sarcocystis species detected in one sample.
Animals 11 03258 g001
Table
Table 1. The internal primers used for the nPCR of selected Sarcocystis spp.
Table 1. The internal primers used for the nPCR of selected Sarcocystis spp.
SpeciesInternal PrimersProduct Size (bp)
NameSequence (5′-3′)
S. calchasiGsScalFATGAACTGCTTTTTCTTCCTCCATT508
GsScalRGACCGTTCAAATATGCTCTTCTTCT
S. columbaeGsScolFATATGTTCATCCTTTCGTAGCGTTG579
GsScolRGCCATCCCTTTTTCTAAGAGAAGTC
S. cornixiGsScornF2AGTTGTTGACGTTCGTGAGGTC483
GsScornR2ACACACTACTCATTATCTCCTACTCCT
S. corvusiGsScovFTATTCATTCTTTCGGTAGTGTTGAG524
GsScovRTTACTCTTTTAACAGCTTCGCTGAG
S. fulicaeGsSfulFCAAAGATGAAGAAGGTATATACGTGAA449
GsSfulRCTTTACTCTTGAAGAACGACGTTGA
S. halietiGsShalFGATAATTGACTTTACGCGCCATTAC644
GsShalR2CCATCCCTTTTTCTAAAGGAGGTC
S. kutkienaeGsSkutkF2ACACACGGTCGAGTTGATATGAC625
GsSkutkR2TCTTTACCCTTAAACAATTTCGTTG
S. lariGsSlarFTTCGTGAGGTTATTATCATTGTGCT545
GsSlarRGGCGATAGAAATCAAAGCAGTAGTA
S. turdusiGsSturFGATTTTTGATGTCCGTTGAAGTTAT561
GsSturRCATTCAAATATGCTCTCTTCCTTCT
S. wobeseriGsSwobFATGAACTGCTTTTTCTTCCATCTTT532
GsSwobR2CTCCTCTTGAAGGTGGTCGTGT
S. arcticaGsSarcF1CAAGCACAAATGTATCATCGTCTTA524
GsSarcR1TCCTTTTTATTCTCAAATGACTTCG
S. lutraeGsSlutF1GAAACGTCTGAAATGATGATGGTAT528
GsSlutR1AAGAGAAAAAGAAAAACAGCCAGAC
S. frondeaGsSfroF1GCTTATTCGATCTGAAATAGCGAGT495
GsSfroR1ATGATGAGCATAACCGCTGTAAATA
S. hardangeriGsSharF1TTCAATCGTACAATGTGCTCCTTAC653
GsSharR2CCCCAAATACTTGACGACTAGC
S. ovalisGsSovaF2CTTGCACAGCGTTCTATCTGATTAT467
GsSovaR2CCAAACACTTGTCGAGAACCAAT
S. oviformisGsSoviF2TGATTGGCGGATTATGTATTTTG565
GsSoviR2ATGTGGTATTTCAAGATGGCTTCC
Table
Table 2. Detection rates of Sarcocystis spp. established by microscopic and molecular analyses.
Table 2. Detection rates of Sarcocystis spp. established by microscopic and molecular analyses.
Bird SpeciesNSarcocystis spp. Positive Animals
MicroscopyMolecular Analysis
n%95% CIn%95% CI
Hooded crow331854.537.8–71.52884.8 **68.4–93.8
Common raven251664.043.9–80.425100 **86.6–100
Western jackdaw21733.315.9–55.11466.7 *44.9–84.1
Rook5000–50.0480 *34.3–99.0
Common magpie42509.8–90.24100 NS47.3–100
Eurasian jay3000–63.2266.7 NS13.5–98.3
Overall914347.336.9–57.77784.6 ***75.4–90.8
N—number of studied birds; n—number of infected birds; * p < 0.05, ** p < 0.01, *** p < 0.001, NS—not significant.
Table
Table 3. Identification and genetic variation of detected Sarcocystis spp.
Table 3. Identification and genetic variation of detected Sarcocystis spp.
SpeciesGenetic RegionSequence Similarity %
Comparing Sequences of the Same Species Obtained in the Present StudyComparing Sequences of the Same Species Available in GenBankComparing Isolated with Most Closely Related Species *
S. columbaeITS198.9–99.898.9–99.8S. corvusi 93.0–93.2
S. cornixiITS198.6–10098.6–100S. kutkienae 89.1–90.3
S. halietiITS198.7–10096.5–100S. columbae 91.2–92.4
S. kutkienaeITS199.0–10099.0–100S. cornixi 88.4–89.1
S. lariITS199.2–10098.8–100S. jamaicensis 77.9–78.3
S. turdusiITS199.0–10098.6–100S. kutkienae 83.6–86.3
S. wobeseriITS199.2–10099.2–100S. calchasi 91.9–92.7
S. arcticaITS110099.6–100S. felis 88.6–90.0
S. lutraeITS1-95.4–100S. canis 73.2–75.5
S. ovalisCox1-98.1–100S. hardangeri 91.7–92.1
S. oviformisCox110099.8–100S. ovalis 89.6–90.6
* Comparison with valid Sarcocystis species; - only one sequence was obtained.
Table
Table 4. Identification of Sarcocystis spp. in examined corvid samples from Lithuania.
Table 4. Identification of Sarcocystis spp. in examined corvid samples from Lithuania.
Sarcocystis SpeciesThe Family of IHHost Species
Hooded Crow (n = 33)Common Raven (n = 25)Western Jackdaw (n = 21)Rook (n = 5)Common Magpie (n = 4)Eurasian jay (n = 3)Overall (%)
IH = Aves
S. calchasi *Cacatuidae; Columbidae; Phalacrocoracidae; Picidae; Psittaculidae------0 (0)
S. columbaeColumbidae; Laridae22----4 (4.4)
S. cornixiCorvidae66-21116 (17.6)
S. corvusiCorvidae------0 (0)
S. fulicaeRallidae------0 (0)
S. halietiAccipitridae; Corvidae;Laridae; Phalacrocoracidae; Strigidae20187-3-48 (52.7)
S. kutkienaeCorvidae18111013245 (49.4)
S. lariLaridae43231-13 (14.3)
S. turdusiTurdidae, Muscicapidae434-2-13 (14.3)
S. wobeseriAccipitridae; Anatidae; Laridae25129-4151 (56)
IH = Carnivora
S. arcticaCanidae32----5 (5.5)
S. lutraeCanidae; Mustelidae1-----1 (1.1)
IH = Cervidae
S. hardangeri *Cervidae------0 (0)
S. frondeaCervidae------0 (0)
S. ovalisCervidae1-----1 (1.1)
S. oviformisCervidae13----4 (4.4)
Overall (%) ** 85 (16.1)60 (15.0)32 (9.5)6 (7.5)14 (21.9)4 (8.3)201 (13.8)
* Positive DNA controls were not available in this study. ** Frequency of positive parasite cases was estimated as the ratio of positive cases from the host species sample size multiplied by the 16 Sarcocystis species tested.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Juozaitytė-Ngugu, E.; Švažas, S.; Šneideris, D.; Rudaitytė-Lukošienė, E.; Butkauskas, D.; Prakas, P. The Role of Birds of the Family Corvidae in Transmitting Sarcocystis Protozoan Parasites. Animals 2021, 11, 3258. https://doi.org/10.3390/ani11113258

AMA Style

Juozaitytė-Ngugu E, Švažas S, Šneideris D, Rudaitytė-Lukošienė E, Butkauskas D, Prakas P. The Role of Birds of the Family Corvidae in Transmitting Sarcocystis Protozoan Parasites. Animals. 2021; 11(11):3258. https://doi.org/10.3390/ani11113258

Chicago/Turabian Style

Juozaitytė-Ngugu, Evelina, Saulius Švažas, Donatas Šneideris, Eglė Rudaitytė-Lukošienė, Dalius Butkauskas, and Petras Prakas. 2021. "The Role of Birds of the Family Corvidae in Transmitting Sarcocystis Protozoan Parasites" Animals 11, no. 11: 3258. https://doi.org/10.3390/ani11113258

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop