Next Article in Journal
Influence of Days after Calving and Thermal Stress on the Efficacy of a Progesterone-Based Treatment in Acyclic Italian Mediterranean Buffalo
Previous Article in Journal
Effects of Replacing Grass with Foliage on Growth Rate and Feed Intake in Goats—A Systematic Review and Meta-Analysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 11
Issue 11
10.3390/ani11113165
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Lycopene Supplementation Could Alleviate Aflatoxin B1 Induced Intestinal Damage through Improving Immune Function and Anti-Oxidant Capacity in Broilers

by
Md Touhiduzzaman Sarker
,
Xiaoli Wan
,
Haiming Yang
and
Zhiyue Wang
*
College of Animal Science and Technology, Yangzhou University, No. 48 Wenhui East Road, Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
Animals 2021, 11(11), 3165; https://doi.org/10.3390/ani11113165
Submission received: 9 August 2021 / Revised: 6 September 2021 / Accepted: 3 November 2021 / Published: 5 November 2021
(This article belongs to the Section Animal Nutrition)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Aflatoxin B1 (AFB1) is a common and devastating food-borne fungal toxic in the broiler industry. AFB1 has adverse effects on the world poultry industry as it impairs the health, performance, intestinal integrity, and immunity of broilers. There has been a great economic concern in the global poultry production, leading to billions of dollars loss every year due to AFB1. Antibiotic-free broiler production relies on feed supplementation as an alternative to antibiotic usage. We previously reported that dietary supplementation with lycopene (LYC) has shown a promising effect on performance and intestinal integrity in the broilers infected with AFB1. However, there are few reports on the effects of LYC on the intestinal development and antioxidant capacity in the broiler against AFB1. The present study was conducted to evaluate the effects of LYC supplementation on the intestinal immune function, barrier function, and antioxidant capacity of broilers fed with an AFB1 contaminated diet. The findings of this research highlighted that the diet supplemented with LYC has a potential effect to improve intestinal health and reduce AFB1 related oxidative and inflammatory status. Hence, this study suggested that addition of LYC in broiler poultry production alleviates the AFB1 toxicity.

Abstract

The present study aims to evaluate the effects of lycopene (LYC) supplementation on the intestinal immune function, barrier function, and antioxidant capacity of broilers fed with aflatoxinB1 (AFB1) contaminated diet. A total of 144 one-day-old male Arbor Acres broilers were randomly divided into three dietary treatment groups; each group consisted of six replicates (eight birds in each cage). Treatments were: (1) a basal diet containing neither AFB1 nor LYC (Control), (2) basal diet containing 100 µg/kg AFB1, and (3) basal diets with 100 µg/kg AFB1 and 200 mg/kg LYC (AFB1 and LYC). The results showed that dietary LYC supplementation ameliorated the AFB1 induced broiler intestinal changes by decreasing the inflammatory cytokines interferon-γ (IFN-γ), interleukin 1beta (IL-1β), and increasing mRNA abundances of cludin-1 (CLDN-1) and zonula occludens-1 (ZO-1) in the jejunum mucosa. On the other hand, AFB1-induced increases in serum diamine oxidase (DAO) activities, D-lactate concentration, mucosal malondialdehyde (MDA), and hydrogen peroxide (H2O2) concentrations were reversed by dietary LYC supplementation (p < 0.05). Additionally, LYC supplementation ameliorated the redox balance through increasing the antioxidant enzyme activities and their related mRNA expression abundances compared to AFB1 exposed broilers. In conclusion, dietary supplementation with LYC could alleviate AFB1 induced broiler intestinal immune function and barrier function damage and improve antioxidants status.

1. Introduction

The small intestine is a physiological and mechanical barrier consisting of intestinal epithelial and tight junction proteins. It is essential for protecting the gut organs from pathogens, toxins, and other potentially hazardous substances, and forms a structure to preserve the intestinal epithelial and barrier function [1]. AFB1 is produced by fungi (Aspergillus flavus and Aspergillus parasiticus) and is a common contaminated poultry feed [2]. AFB1 can also compromise the fundamental intestinal function, and disruption of intestinal epithelial results in leaky gut, contributing to bacterial translocation [3,4,5]. When tight junction proteins claudin (CLDN), occludin (OCLN), and zonula occludens-1 (ZO-1) are affected by aflatoxinB1 (AFB1), more translocation of bacteria and toxins will take place, resulting in increased oxidative response and a state of inflammation. It enhances the generation of free radicals, prolongs oxidative damage, and leads to cell damage and, finally, animal death [6,7]. As oxidative stress has a significant impact on the AFB1 toxicity mechanism, adding antioxidants (e.g., lycopene and curcumin) to animals’ diets increased their antioxidant and immunity system, protecting them against AFB1 toxicity [8,9,10]. Dietary treatments, such as lycopene (LYC) supplementation and derived items high in antioxidants have been shown to reduce the harmful effects of AFB1 contamination on birds by reducing the detrimental consequences of intestinal damage [11,12,13].
Lycopene is among the most effective antioxidants in the carotenoid family; its activity against biological reactive oxygen species (ROS) may prevent or alleviate oxidative damage to tissues and cells in animals [14]. It has been shown that LYC supplementation could improve antioxidant capacity and regulate lipid metabolism in chickens [15,16]. In numerous epidemiological studies, LYC has been shown to have anti-inflammatory, anti-cancer, anti-cardiovascular disease, and detoxifying properties [17,18,19,20]. Recently, Sahin et al. [21] reported that LYC activated antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers. According to Rivas et al. [22], an LYC-rich diet may help to reduce oxidative stress, restrict the detrimental effects of ROS on bone cells, and prevent osteoporosis. LYC also protected lymphocytes against oxidative stress and improved immune function [23]. Compared with other carotenoids (β-carotene, lutein, and zeaxanthin), LYC is the most efficient singlet oxygen quencher [24]. However, the majority of broiler research have focused on the impacts of dietary LYC supplementation on broiler performance and metabolism [16,25,26]. It remains uncertain whether LYC has a regulatory role in the inflammatory and oxidative stress of the broiler gut. Based on prior investigations, we assume that dietary LYC supplements can ameliorate intestinal injury in broilers. The purpose of this research was to find out more about the AFB1 induced intestinal damage and investigate whether LYC supplementation exerts anti-inflammatory and antioxidant effects on the intestinal damages in the AFB1 contaminated broilers.

2. Materials and Methods

2.1. Ethical Statement

This experiment was conducted in the College of Animal Science and Technology, Yangzhou University, China, and all protocols were approved by the Yangzhou University animal care and ethics committee (Approval Number: SYXK (Su) 2016-0020).

2.2. Experimental Birds, Diets, and Management

A total of 144 one-day-old male Arbor Acres broilers were obtained from a commercial hatchery (Nantong, Jiangsu Province, China). The broiler chicks were indiscriminately allocated to 3 dietary treatment groups; each group comprised 6 replicates (cages) of 8 broilers in each replicate. Treatments were (1) a basal diet containing neither AFB1 nor LYC (Control), (2) basal diet containing 100 µg/kg AFB1, and (3) basal diets supplemented with 100 µg/kg AFB1 and 200 mg/kg LYC (AFB1 + LYC). In an environmentally controlled facility house, all birds were reared under a cage breeding system. The breeding house temperature was 32–34 °C for the first 3 days, and then subsequently decreased 2–3 °C every week until the final temperature was achieved at 21 ± 1 °C during the 42-d experimental trial. During the trial, all broilers had unrestricted access to mash feed and fresh water, and the lighting cycle was 23 h of light and 1 h of darkness. Corn-soybean-based diets were developed in accordance with NRC [27] to fulfill the nutritional needs for broilers throughout the 1–21 day (starter) and 22–42 day (grower) experimental periods (Table 1).
Aflatoxin B1 (Purity ≥ 98%, HPLC) and Lycopene (Purity ≥ 80%, HPLC) were purchased from Shanghai Yuanye Biotechnology Co. Ltd. (Shanghai, China). The effective dose of AFB1 in the broiler diets and LYC supplementation was optimized according to previous studies [21,28,29].

2.3. Collection of Samples and Measurement

The blood samples were collected in tubes by puncture of the brachial vein. The serum was extracted from the blood samples and then stored at −70 °C for subsequent analysis after centrifugation (cence DL-5M) at 3500 rpm for 10 min at 4 °C. After obtaining blood samples, the broilers were euthanized by cervical dislocation, and the small intestine segments (jejunum) were promptly removed. Afterward, the intestine segments were opened longitudinally and flushed with ice-cold sodium chloride saline. The jejunal mucosa was collected into sterile plastic tubes by scraping a sterile glass microscope slide. The mucosal samples were promptly frozen in liquid nitrogen and kept at −70 °C for further examination.

2.4. Preparation of Intestinal Mucosal Homogenate

Approximately 0.2 g of intestinal tissue samples (jejunum mucosa) were weighed and homogenized with cold sodium chloride saline solution (4 °C) at a ratio of 1:9 (wt/vol) using an ultraturrax homogenizer (Shanghai Jing Xin). The homogenized solution was then centrifuged for 10 min at 4 °C at 2500 rpm, and the supernatant was collected and kept at −20 °C for future analysis (see below).

2.5. Assay of Mucosal Inflammatory, Serum D-Lactate, and Diamine Oxidase (DAO) Status

The concentrations of interleukin-1β (IL-1β), interleukin -10 (IL-10), and interferon-γ (IFN-γ), and serum D-lactate concentration, and diamine oxidase (DAO) activities were measured using a spectrophotometric method. The commercial enzyme-linked immunosorbent assays (ELISA) kits (Nanjing Jian Cheng Bioengineering Institute, Nanjing, China) were used to determine the concentrations of the jejunal mucosa according to the manufacture instruction: add 100 µL of tissue samples in sample dilution buffer per well at 96-well microplate; cover the plate with foil paper and incubate it for 30 min at 37 °C; after that, remove the liquid and wash the plate 3 times at 300 µL of washing solution; add 100 µL conjugate solution to each well and incubate for 30 min at 21 °C; repeat the wash 3 times at 300 µL of washing solution; add 100 µL of substrate solution to each well and incubate for 15 min at 21 °C in the dark to properly cover the plate with aluminum foil paper; finally, add 100 µL stop solution to each well to stop the reaction. Determine the optical density (OD) of each well immediately, using the spectrophotometer to 450 nm.

2.6. Assay of Antioxidant Parameters

According to the manufacturer’s instructions, the antioxidant parameters in the jejunal mucosa were determined using commercial kits (Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). Glutathione-S-transferase (GSH-ST, catalog No. A004) was assayed by 0.1 µL of homogenate tissue samples and mixed with 0.3 µL matrix buffer to constitute the reaction mixture and incubated 37°C at 10 min. The mixture was then added to a working solution and dehydrate alcohol 1 mL, respectively, and centrifuged 3500 rpm for 10 min then the absorbance was determined at 412 nm. Similarly constituted reaction mixture without the samples containing the enzyme served as a reference blank. The activity of Glutathione peroxidase (GSH-PX, catalog No. A005) was assayed by 0.2 µL of homogenate tissue samples, mixed with 0.3 µL 1 mmol/L GSH solution and working solution 0.2 µL to constitute the reaction mixture, and incubated at 37 °C for 5 min. The mixture was then added reagent working solution 1 mL and centrifuged 3500 rpm for 10 min then the absorbance was determined at 412 nm. The activity of Catalase (CAT, catalog No. A007-1-1) was assayed by splits hydrogen peroxide, resulted in the loss of absorbance, and was determined at 405 nm. The activity of glutathione reductase (GR, catalog No. A062-1-1) was assayed by 20 µL of homogenate tissue samples was mixed with a 2.4 mL working solution to constitute the reaction mixture. After that, the absorbance was determined at 340 nm for 30 s and then incubated at 37 °C for 2 min, before again measuring the absorbance at 340 nm for 2 min 30 s. The concentration of glutathione (GSH, catalog No. A064-2-1) was assayed by 100 µL of homogenate tissue samples and mixed with 100 µL and 12.5 µL reagents, respectively, to constitute the reaction mixture, incubated at 5 min in room temperature, and then the absorbance was determined at 405 nm. A similarly constituted reaction mixture, without the samples, served as a reference blank. The concentration of malondialdehyde (MDA, catalog No. A003-1) was assayed by 50 µL of homogenate tissue samples and mixed with 1500 µL and 50 µL reagents, respectively, to constitute the reaction mixture, and 500 µL 50% glacial acetic acid, then incubated at 95 °C for 40 min. After that, it was cooled with tap water and centrifuged 3500 rpm for 10 min, then the absorbance was determined at 532 nm. The concentration of hydrogen peroxide (H2O2, catalog No. A064-1-1) was assayed by 100 µL of homogenate tissue samples and mixed with 1 mL reagent to constitute the reaction mixture, then the absorbance at was determined 405 nm. The concentration of total protein (TP, catalog No. A045-2) was assayed by 500 µL of homogenate tissue samples mixed with 3 mL Coomassie brilliant blue reagent to constitute the reaction mixture, then the absorbance was determined at 595 nm using a spectrophotometer (Thermo scientific multiskan FC, Shanghai, China). All findings from the intestinal mucosa were standardized against the total protein concentration.

2.7. Total RNA Extraction and mRNA Quantification

According to the manufacturer’s instruction, the total RNA of the jejunum mucosa sample was isolated using the TRIzol reagent kit (Tiangen Biotechnology, Beijing, China). The purity and concentration of extracted RNA were evaluated using the Nanodrop ND-1000 UV-spectrophotometer and electrophoresis on 1 percent agarose gel (Nano Drop Technologies, Wilmington, DE, USA). The RNA samples within the 260/280 OD ratios 1.8–2.0 were chosen for further reaction. Samples of RNA were diluted with RNase-free water to the concentration of 0.5 µg/µL. After dilution, 1 µg of that total RNA was reverse-transcribed into complementary DNA (cDNA), a 1st standard cDNA synthesis super Mix for qPCR reagent kits with a gDNA digesta plus (Yeasen Biotechnology Co. Ltd. Shanghai, China) was following the manufacturer instruction. Real-time PCR was performed using the Hifair supermix (Yeasen Biotechnology Co. Ltd. Shanghai, China) on the Quant Studio 5 Real-Time PCR system (Thermo Scientific, Wilmington, NC, USA). To normalize the expression of the other target genes, the β-actin gene was chosen as the housekeeping gene. The primers were synthesized by Yeasen Biotech (Yeasen Biotechnology Co. Ltd. Shanghai, China), and the primer sequences are presented in Table 2. The reaction mixture comprised of 2 µL of cDNA template, 0.4 µL each of the forward and reverse primers, 10 µL of SYBR master mix (Yeasen Biotechnology Co. Ltd. Shanghai, China), 0.4 µL of ROX reference dye, and 6.8 µL of double-distilled water. The PCR reaction program cycling parameters consisted of a pre-run at 95 °C for 30 s, 40 cycles at 95 °C for 5 s, followed by a 60 for 30 s with a final melting temperature at 95°C for 10 s, followed by an increase in temperature from 65 to 95 °C with a temperature change rate of 0.5 °C/s. The relative mRNA expression levels of target genes (fold changes) were analyzed by the 2−ΔΔCt technique [30] after normalization against the reference housekeeping gene β-actin. The mRNA abundance of each target gene of broilers in the control group was assigned a value of 1.

2.8. Statistical Analysis

Statistical analysis of all data was performed by one-way ANOVA using SPSS software (version 21, SPSS, Inc., Armonk, New York, USA). Differences among the group were examined using Duncan’s multiple range test. Statistical significance was considered at p < 0.05, and 0.05 < p < 0.10 defined as a tendency towards significance. All results are expressed as the mean and standard error of the means (SEM).

3. Results

3.1. Inflammatory Cytokines Concentration of the Intestine Mucosa

Compared with the control group, AFB1 contaminated broiler had a significantly higher (p < 0.05) concentration of IFN-γ at 21 and 42 d, and lower IL-10 at 21 d in the jejunum mucosa (Table 3). The increased mucosal IFN-γ concentration of AFB1 contaminated group broilers was reduced, and decreased IL-10 concentration was increased by dietary LYC supplementation.

3.2. Inflammatory Related Gene Expression of the Intestine Mucosa

Compared with the control group, AFB1 contaminated broilers diet tended to increase (p = 0.061) mRNA levels of IL-1β. In addition, dietary LYC supplementation had no effects on altered mRNA levels. On the other hand, AFB1 contaminated diet and dietary LYC supplementation did not alter mRNA levels on IL-10, IL-6 IL-2, and INF-γ in the jejunum mucosa (Figure 1).

3.3. D-Lactate Concentration and DAO Activity in Serum

AFB1-contaminated broilers showed significantly greater (p < 0.05) serum D-lactate concentrations at 21 d (Figure 2A) and DAO activity at 42 d (Figure 2B) as compared to the control group. However, compared to the control group, the D-lactate concentration at 42 d (p = 0.092) and the DAO activities at 21 d tended to increase (p = 0.077) in the AFB1 broiler group. The administration of dietary LYC significantly reduced (p < 0.05) serum DAO activities compared to the AFB1 contaminated broiler group.

3.4. Tight Junction Related Genes Expression of the Intestine Mucosa

CLDN-1 and ZO-1 mRNA abundances in the jejunal mucosa were significantly lower (p < 0.05) in the AFB1 group compared to the control group (Figure 2C). In addition, supplementation with LYC significantly increased (p < 0.05) the expression of CLDN-1 and ZO-1 in the jejunal mucosa of the broiler intestine. There was no effect of the AFB1 toxic contamination or dietary LYC supplementation on the expression of OCLN, CLDN2, and CLDN3 in the jejunum mucosa (Figure 2C).

3.5. Oxidative Status of the Intestine Mucosa

The findings in Table 4 indicated that the jejunal H2O2 and MDA concentrations in the AFB1-induced group were substantially higher (p < 0.05) than those in the control group at 21 and 42 d. However, dietary LYC supplementation significantly decreased (p < 0.05) H2O2 and MDA concentration in the jejunum mucosa compared to the AFB1 group.

3.6. Antioxidant Enzyme Activities of the Intestine Mucosa

Broilers fed a diet contaminated with AFB1 had significantly decreased (p < 0.05) CAT at 21 d and GSH, GST, GSH-Px, GR, and CAT at 42 d in the jejunum as compared with those in the control group. On the other hand, dietary LYC supplementation significantly increased (p < 0.05) GSH, GST, and GR antioxidant enzyme activities as compared to the AFB1 group (Table 5).

3.7. Antioxidant Related Gene Expression of the Intestine Mucosa

Compared with the control group, the AFB1 toxic effect significantly decreased (p < 0.05) the mRNA gene expression of Cu/ZnSOD, MnSOD, and CAT in the jejunal mucosa (Figure 3). In addition, supplementation with dietary LYC significantly increased (p < 0.05) the expression of HO-1, Cu/ZnSOD, MnSOD, and CAT compared with the AFB1 group in the jejunal mucosa of broilers. The expression of jejunual Nrf2 (p = 0.086) trended to be increased by dietary LYC supplementation.

4. Discussion

The intestinal epithelium serves as a significant physical barrier to external antigens and pathogens, and disturbances are becoming more linked to infectious and non-infectious disorders [31]. A large body of research has shown that AFB1 contamination can affect the intestinal barrier of broilers through toxic and pathological challenges, resulting in the reduction in growth and performance [32,33,34]. In our previous study we reported that dietary supplementation with lycopene (LYC) has shown a promising effect on growth performance and intestinal integrity in the broilers infected with AFB1 [35]. In the current study, AFB1 toxic contamination increased IFN-γ and decreased IL-10 concentration in the jejunum mucosa of the broiler’s intestine, suggesting that AFB1-induced inflammatory response. Our findings are consistent with previous research suggesting that AFB1 might cause inflammation response [36,37]. The possible explanation might be that the AFB1 induces significant alterations in inflammatory mediator cytokines that may ultimately affect intestinal barrier function. Several types of research have revealed that the integrity of the intestine barrier can be altered by different inflammatory cytokines, such as IL-1β, INF-γ, and IL-10 [38,39]. The pro-inflammatory cytokine INF-γ concentration could increase a cellular permeability by decreasing the tight junction protein ZO-1 and CLDN1 levels in the AFB1 infected broilers. In addition, IL-10 antagonizes the effects of pro-inflammatory cytokines such as INF-γ and IL-1β on the tight junction protein, which leads to decreased intestinal permeability [40]. Therefore, we determined the mRNA levels of inflammatory cytokines of the intestinal mucosa, which can reflect the broiler’s inflammatory status. We demonstrated in our present study that AFB1 contamination increased the mRNA expression levels of IL-1β that influence the inflammatory status of the jejunum mucosa in the broilers’ intestine.
In the present study, our results showed that dietary LYC supplementation significantly decreased INF-γ concentration while increased IL-10 accumulation in the intestinal mucosa of AFB1 contaminated broilers. Similarly, Hashem et al. [41] revealed that LYC could prevent inflammation in rats by stimulating the production of anti-inflammatory cytokines such as IL-10 through its strong antioxidant property during colitis. Thus, results indicated that LYC supplementation could attenuate AFB1-induced inflammation via enhancing anti-inflammatory properties, suppressing nuclear factor-kappa B (NF-κB) [42] and activating the Nrf2/HO-1 pathway in broilers. A study by Luo and Wu [43] found that LYC treatment led to significant increases in serum IL-10 levels in rats with gastric cancer. It is generally known that IL-10, a potent anti-inflammatory cytokine, suppresses the production of pro-inflammatory cytokines, and mitigates immunological responses [44]. In addition, LYC decreased adhesion molecules, pro-inflammatory cytokines, and genes involved in inflammation [45]. These modifications could be attributed to the fact that cytokines are essential components of the host defense system and play a crucial role in defending against bacterial infections [46].
The intestinal epithelial barrier performs as an intestinal permeability; its function is to absorb the digestive nutrient, electrolytes, and water, and serve as a natural defense against the toxin, antigens, and enteric pathogens that are crucial for the bird’s health and growth [47]. AFB1 contamination may increase the permeability of the intestinal epithelial layer, resulting in excessive and uncontrolled passage of pathogenic and foreign material entering the broilers, and leading to inflammatory and oxidative responses. Gao et al. [48] found decreased tight junction protein expression (CLDN-3, occluding, and ZO-1) and disrupted intestinal permeability structure in differentiated Caco-2 cells exposed to AFB1. In the current study, we observed that intestinal permeable barrier function was impaired by AFB1 contamination, as evidenced by the increased circulating D-lactate concentration, and changed tight junction mRNA abundances of CLDN1 and ZO-1 in the intestinal mucosa. Generally, serum D-lactate concentration levels are quite low in animals. Thus, D-lactate accumulation in the systematic circulation can increase intestinal permeability induced by tight junction disorder due to AFB1 toxic contamination. AFB1 enhanced intestinal permeability in broilers by increasing the expression of CLDN1 and numerous amino acid transporters [5]. The disruptions of tight junctions increased the paracellular permeability of intestinal mucosa and were considered high pathological status [49]. On the contrary, diamine oxidase (DAO) is an intracellular enzyme produced by the intestine epithelium and present in the intestinal mucosa [5]. While disruption of the intestinal structural barrier changed tight junction genes (CLDN1 and ZO-1), expression and intestinal cells undergo necrosis condition, resulting in increased circulating DAO activity [50]. DAO activity is also an index to evaluate intestinal permeability and mucosal injury. Importantly, our result showed that dietary LYC supplementation significantly decreased serum D-lactate concentration and DAO activity and upregulated the tight junction-related mRNA abundance of CLDN1 and ZO-1 in the intestine mucosal compared to that of the AFB1 damaged broilers. CLDN1 and ZO-1 are the most critical components in the tight junctions’ structural and functional organization and help protect against pathogenic development [51]. Our study also showed that LYC modulated the expression of CLDN1 and ZO-1 along with its anti-toxic effects.
Aflatoxin B1 increased ROS generation, causing them to attack cell membrane lipids and change the fluidity and permeability of the cell membrane, resulting in oxidative damage [52]. Oxidative stress is a critical element of the disruption of mucosal barrier function [53]. It has been observed that dietary AFB1 contamination may reduce antioxidant enzymes activities and non-enzymatic antioxidant levels in broilers [37,54,55]. Our current experimental results showed that a diet contaminated with AFB1 significantly enhanced the concentration of MDA and H2O2, and decreased the antioxidant enzyme activities of GSH-Px, GST, and GR, and concentration of GSH in the small intestinal mucosa of the broilers. The results of the present investigation are consistent with previous studies, which show that AFB1 in broilers might generate oxidative stress [8,55,56,57]. MDA concentration is determined as an index of lipid peroxidation and is one of the main symptoms of the animal’s toxicity and carcinogenesis [58,59]. H2O2 is the main component of the ROS that is responsible for redox balance. The GST, CAT, and GSH-Px are important enzymes and GSH is the non-enzymatic components of the endogenous antioxidant defense system, which protect the organs and cells against free molecule production and lipid peroxidation [60]. In addition, the presence of CAT and GSH-Px antioxidant defense component and adequate amount of GSH reduced the oxidative stress by catalyzes H2O2 to water and O2 [61,62].
However, the results indicated that dietary LYC supplementation could ameliorate intestinal MDA and H2O2 accumulation by increasing antioxidants enzyme activities, thereby reducing oxidative stress exposed due to AFB1 toxic contamination in the broilers. Our results are consistent with Sahin et al. [21] they found that dietary LYC increased activities of GSH-PX, CAT, and GSH concentration and decreased MDA concentration in heat stressed broilers. According to a prior study, LYC supplementation had an antioxidant effect against T-2 toxin and zearalenone-induced toxicities [14]. Another research reported the protective and therapeutic effect of LYC against oxidative stress and epididymal epithelial cell damage caused by AFB1 [63]. This can be explained by the fact that LYC can prevent oxidative stress and limit free radical production to protect animals by increasing the antioxidant defense system [64].
Moreover, several studies have revealed that dysregulation of the Nrf2 signaling pathway was associated with AFB1 induced oxidative damage [33]. The Nrf2-HO-1 pathway is widely established for its importance in redox equilibrium in cells and tissues. Our experimental results showed increased mRNA levels of HO-1 and Nrf2 in LYC supplementation group, indicating that LYC might exert an antioxidant effect by activating the Nrf2-HO-1 signaling pathway. Nrf2 is a significant transcription factor, regulate antioxidant-related genes (HO-1, Cu/ZnSOD, CAT, and MnSOD) expression and induce cellular defense mechanisms against oxidative stress [65,66]. Several studies have revealed that LYC had antioxidant and anti-inflammatory effects, and supplementation with LYC effectively fight against inflammatory-related disorders [67,68]. Therefore, the results indicated that LYC play an important role in preventing the AFB1-induced oxidative damage via enhancing activation mRNA abundances of Nrf2 signaling pathway.

5. Conclusions

Our results indicate that dietary LYC supplementation could alleviate intestinal damages of AFB1 contaminated broilers by ameliorating inflammatory responses and reducing the oxidative stress of the intestinal mucosa. Therefore, LYC can be used as a broiler feed supplement to improve immunological and antioxidant status.

Author Contributions

M.T.S.: Conceptualization, Data curation, Formal analysis, Software, Investigation, Resources, and Writing—original draft; X.W.: Conceptualization, Investigation, Methodology, Resources, and Writing—reviewing and editing; H.Y.: Conceptualization, Investigation, Validation, and Writing—reviewing and editing; Z.W.: Funding acquisition, Project administration, and Supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (31802095).

Institutional Review Board Statement

This experiment was conducted according to the guideline of the Declaration of Helsinki and all protocols were approved by the Yangzhou University animal care and ethics committee in the College of Animal Science and Technology, Yangzhou University, China.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this research study are available on request from the corresponding author.

Acknowledgments

The assistance of my teachers and lab mates in this work are greatly acknowledged.

Conflicts of Interest

Authors declare no conflict of interest.

References

  1. Constantinescu, C.S.; Chou, I.-J. Intestinal bacterial antigens, toxin-induced pathogenesis and immune cross-reactivity in neuromyelitis optica and multiple sclerosis. Neuro-Immuno-Gastroenterology 2016, 227–236. [Google Scholar]
  2. Grenier, B.; Applegate, T.J. Modulation of intestinal functions following mycotoxin ingestion: Meta-analysis of published experiments in animals. Toxins 2013, 5, 396–430. [Google Scholar] [CrossRef] [Green Version]
  3. Gratz, S.; Wu, Q.; El-Nezami, H.; Juvonen, R.; Mykkänen, H.; Turner, P. Lactobacillus rhamnosus strain GG reduces aflatoxin B1 transport, metabolism, and toxicity in Caco-2 cells. Appl. Environ. Microbiol. 2007, 73, 3958–3964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Ilan, Y. Leaky gut and the liver: A role for bacterial translocation in nonalcoholic steatohepatitis. World J. Gastroenterol. WJG 2012, 18, 2609. [Google Scholar] [CrossRef] [PubMed]
  5. Chen, X.; Naehrer, K.; Applegate, T. Interactive effects of dietary protein concentration and aflatoxin B1 on performance, nutrient digestibility, and gut health in broiler chicks. Poult. Sci. 2016, 95, 1312–1325. [Google Scholar] [CrossRef]
  6. Shen, H.-M.; Shi, C.-Y.; Lee, H.-P.; Ong, C.-N. Aflatoxin B1-induced lipid peroxidation in rat liver. Toxicol. Appl. Pharmacol. 1994, 127, 145–150. [Google Scholar] [CrossRef] [PubMed]
  7. Surai, P.F. Natural Antioxidants in Avian Nutrition and Reproduction; Nottingham University Press: Nottingham, UK, 2002. [Google Scholar]
  8. Zhang, N.-Y.; Qi, M.; Zhao, L.; Zhu, M.-K.; Guo, J.; Liu, J.; Gu, C.-Q.; Rajput, S.A.; Krumm, C.S.; Qi, D.-S. Curcumin prevents aflatoxin B1 hepatoxicity by inhibition of cytochrome P450 isozymes in chick liver. Toxins 2016, 8, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Li, Y.; Ma, Q.; Zhao, L.; Guo, Y.; Duan, G.; Zhang, J.; Ji, C. Protective efficacy of alpha-lipoic acid against aflatoxinB1-induced oxidative damage in the liver. Asian-Australas. J. Anim. Sci. 2014, 27, 907. [Google Scholar] [CrossRef]
  10. Abdel-Hamid, A.A.; Firgany, A.E.-D.L. Vitamin E supplementation ameliorates aflatoxin B1-induced nephrotoxicity in rats. Acta Histochem. 2015, 117, 767–779. [Google Scholar] [CrossRef] [PubMed]
  11. Saada, H.N.; Rezk, R.G.; Eltahawy, N.A. Lycopene protects the structure of the small intestine against gamma-radiation-induced oxidative stress. Phytother. Res. 2010, 24, S204–S208. [Google Scholar] [CrossRef] [PubMed]
  12. Xu, F.; Yu, K.; Yu, H.; Wang, P.; Song, M.; Xiu, C.; Li, Y. Lycopene relieves AFB1-induced liver injury through enhancing hepatic antioxidation and detoxification potential with Nrf2 activation. J. Funct. Foods 2017, 39, 215–224. [Google Scholar] [CrossRef]
  13. Zhang, J.; Wang, P.; Xu, F.; Huang, W.; Ji, Q.; Han, Y.; Shao, B.; Li, Y. Protective effects of lycopene against AFB1-induced erythrocyte dysfunction and oxidative stress in mice. Res. Vet. Sci. 2020, 129, 103–108. [Google Scholar] [CrossRef] [PubMed]
  14. Boeira, S.P.; Borges Filho, C.; Del’fabbro, L.; Roman, S.S.; Royes, L.F.F.; Fighera, M.R.; Jessé, C.R.; Oliveira, M.S.; Furian, A.F. Lycopene treatment prevents hematological, reproductive and histopathological damage induced by acute zearalenone administration in male Swiss mice. Exp. Toxicol. Pathol. 2014, 66, 179–185. [Google Scholar] [CrossRef]
  15. Lee, K.-W.; Choo, W.-D.; Kang, C.-W.; An, B.-K. Effect of lycopene on the copper-induced oxidation of low-density lipoprotein in broiler chickens. Springerplus 2016, 5, 1–8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Sun, B.; Chen, C.; Wang, W.; Ma, J.; Xie, Q.; Gao, Y.; Chen, F.; Zhang, X.; Bi, Y. Effects of lycopene supplementation in both maternal and offspring diets on growth performance, antioxidant capacity and biochemical parameters in chicks. J. Anim. Physiol. Anim. Nutr. 2015, 99, 42–49. [Google Scholar] [CrossRef]
  17. Herzog, A.; Siler, U.; Spitzer, V.; Seifert, N.; Denelavas, A.; Hunziker, P.B.; Hunziker, W.; Goralczyk, R.; Wertz, K. Lycopene reduced gene expression of steroid targets and inflammatory markers in normal rat prostate. FASEB J. 2005, 19, 1–24. [Google Scholar] [CrossRef]
  18. Giovannucci, E.; Rimm, E.B.; Liu, Y.; Stampfer, M.J.; Willett, W.C. A prospective study of cruciferous vegetables and prostate cancer. Cancer Epidemiol. Prev. Biomark. 2003, 12, 1403–1409. [Google Scholar]
  19. Costa-Rodrigues, J.; Pinho, O.; Monteiro, P. Can lycopene be considered an effective protection against cardiovascular disease? Food Chem. 2018, 245, 1148–1153. [Google Scholar] [CrossRef] [PubMed]
  20. Li, W.; Jiang, B.; Cao, X.; Xie, Y.; Huang, T. Protective effect of lycopene on fluoride-induced ameloblasts apoptosis and dental fluorosis through oxidative stress-mediated Caspase pathways. Chem.-Biol. Interact. 2017, 261, 27–34. [Google Scholar] [CrossRef]
  21. Sahin, K.; Orhan, C.; Tuzcu, M.; Sahin, N.; Hayirli, A.; Bilgili, S.; Kucuk, O. Lycopene activates antioxidant enzymes and nuclear transcription factor systems in heat-stressed broilers. Poult. Sci. 2016, 95, 1088–1095. [Google Scholar] [CrossRef] [PubMed]
  22. Rivas, A.; Romero, A.; Mariscal-Arcas, M.; Monteagudo, C.; López, G.; Ocaña-Peinado, F.; Olea-Serrano, F. Association between dietary antioxidant quality score (DAQs) and bone mineral density in Spanish women. Nutr. Hosp. 2012, 27, 1886–1893. [Google Scholar]
  23. Yonar, M.E. The effect of lycopene on oxytetracycline-induced oxidative stress and immunosuppression in rainbow trout (Oncorhynchus mykiss, W.). Fish Shellfish. Immunol. 2012, 32, 994–1001. [Google Scholar] [CrossRef] [PubMed]
  24. Sahin, K.; Yazlak, H.; Orhan, C.; Tuzcu, M.; Akdemir, F.; Sahin, N. The effect of lycopene on antioxidant status in rainbow trout (Oncorhynchus mykiss) reared under high stocking density. Aquaculture 2014, 418, 132–138. [Google Scholar] [CrossRef]
  25. Englmaierová, M.; Bubancová, I.; Vít, T.; Skrivan, M. The effect of lycopene and vitamin E on growth performance, quality and oxidative stability of chicken leg meat. Czech J. Anim. Sci. 2011, 56, 536–543. [Google Scholar] [CrossRef] [Green Version]
  26. Ševčíková, S.; Skřivan, M.; Dlouhá, G. The effect of lycopene supplementation on lipid profile and meat quality of broiler chickens. Czech J. Anim. Sci. 2008, 53, 431–440. [Google Scholar] [CrossRef] [Green Version]
  27. National Research Council. Nutrient Requirements of Poultry, 9th ed.; National Academy of Sciences Press: Washington, DC, USA, 1994. [Google Scholar]
  28. Peng, X.; Zhang, S.; Fang, J.; Cui, H.; Zuo, Z.; Deng, J. Protective roles of sodium selenite against aflatoxin B1-induced apoptosis of jejunum in broilers. Int. J. Environ. Res. Public Health 2014, 11, 13130–13143. [Google Scholar] [CrossRef] [Green Version]
  29. Liu, T.; Ma, Q.; Zhao, L.; Jia, R.; Zhang, J.; Ji, C.; Wang, X. Protective effects of sporoderm-broken spores of ganderma lucidum on growth performance, antioxidant capacity and immune function of broiler chickens exposed to low level of aflatoxin B1. Toxins 2016, 8, 278. [Google Scholar] [CrossRef] [Green Version]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  31. Camilleri, Á.; Madsen, K.; Spiller, R.; Van Meerveld, B.; Verne, G. Intestinal barrier function in health and gastrointestinal disease. Neurogastroenterol. Motil. 2012, 24, 503–512. [Google Scholar] [CrossRef] [PubMed]
  32. He, Y.; Fang, J.; Peng, X.; Cui, H.; Zuo, Z.; Deng, J.; Chen, Z.; Lai, W.; Shu, G.; Tang, L. Effects of sodium selenite on aflatoxin B 1-induced decrease of ileac T cell and the mRNA contents of IL-2, IL-6, and TNF-α in broilers. Biol. Trace Elem. Res. 2014, 159, 167–173. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, F.; Zuo, Z.; Chen, K.; Peng, X.; Fang, J.; Cui, H.; Shu, G.; He, M.; Tang, L. Selenium Rescues Aflatoxin B 1-Inhibited T Cell Subsets and Cytokine Levels in Cecal Tonsil of Chickens. Biol. Trace Elem. Res. 2019, 188, 461–467. [Google Scholar] [CrossRef] [PubMed]
  34. Solis-Cruz, B.; Hernandez-Patlan, D.; Petrone, V.M.; Pontin, K.P.; Latorre, J.D.; Beyssac, E.; Hernandez-Velasco, X.; Merino-Guzman, R.; Owens, C.; Hargis, B.M. Evaluation of cellulosic polymers and curcumin to reduce aflatoxin b1 toxic effects on performance, biochemical, and immunological parameters of broiler chickens. Toxins 2019, 11, 121. [Google Scholar] [CrossRef] [Green Version]
  35. Sarker, M.T.; Wang, Z.Y.; Yang, H.; Wan, X.; Emmanuel, A. Evaluation of the protective effect of lycopene on growth performance, intestinal morphology, and digestive enzyme activities of aflatoxinB1 challenged broilers. Anim. Sci. J. 2021, 92, e13540. [Google Scholar] [PubMed]
  36. Long, M.; Zhang, Y.; Li, P.; Yang, S.-H.; Zhang, W.-K.; Han, J.-X.; Wang, Y.; He, J.-B. Intervention of grape seed proanthocyanidin extract on the subchronic immune injury in mice induced by aflatoxin B1. Int. J. Mol. Sci. 2016, 17, 516. [Google Scholar] [CrossRef] [Green Version]
  37. Li, Y.; Ma, Q.-G.; Zhao, L.-H.; Wei, H.; Duan, G.-X.; Zhang, J.-Y.; Ji, C. Effects of lipoic acid on immune function, the antioxidant defense system, and inflammation-related genes expression of broiler chickens fed aflatoxin contaminated diets. Int. J. Mol. Sci. 2014, 15, 5649–5662. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Xavier, R.; Podolsky, D. Unravelling the pathogenesis of inflammatory bowel disease. Nature 2007, 448, 427–434. [Google Scholar] [CrossRef] [PubMed]
  39. Capaldo, C.T.; Nusrat, A. Cytokine regulation of tight junctions. Biochim. Biophys. Acta (BBA)-Biomembr. 2009, 1788, 864–871. [Google Scholar] [CrossRef] [Green Version]
  40. Madsen, K.L.; Lewis, S.A.; Tavernini, M.M.; Hibbard, J.; Fedorak, R.N. Interleukin 10 prevents cytokine-induced disruption of T84 monolayer barrier integrity and limits chloride secretion. Gastroenterology 1997, 113, 151–159. [Google Scholar] [CrossRef]
  41. Hashem, H.; Hussein, S.A. Lycopene mitigates experimental colitis in rats by inhibiting oxidative stress-mediated inflammation and apoptosis. Benha Vet. Med. J. 2020, 39, 16–21. [Google Scholar] [CrossRef]
  42. Gouranton, E.; Thabuis, C.; Riollet, C.; Malezet-Desmoulins, C.; El Yazidi, C.; Amiot, M.; Borel, P.; Landrier, J. Lycopene inhibits proinflammatory cytokine and chemokine expression in adipose tissue. J. Nutr. Biochem. 2011, 22, 642–648. [Google Scholar] [CrossRef] [PubMed]
  43. Luo, C.; Wu, X.-G. Lycopene enhances antioxidant enzyme activities and immunity function in N-Methyl-N′-nitro-N-nitrosoguanidine–induced gastric cancer rats. Int. J. Mol. Sci. 2011, 12, 3340–3351. [Google Scholar] [CrossRef] [Green Version]
  44. Moore, K.W.; O’garra, A.; Malefyt, R.D.; Vieira, P.; Mosmann, T.R. Interleukin-10. Annu. Rev. Immunol. 1993, 11, 165–190. [Google Scholar] [CrossRef]
  45. Vasconcelos, A.G.; Das Gn Amorim, A.; Dos Santos, R.C.; Souza, J.M.T.; De Souza, L.K.M.; De Sl Araújo, T.; Nicolau, L.A.D.; De Lima Carvalho, L.; De Aquino, P.E.A.; Da Silva Martins, C. Lycopene rich extract from red guava (Psidium guajava L.) displays anti-inflammatory and antioxidant profile by reducing suggestive hallmarks of acute inflammatory response in mice. Food Res. Int. 2017, 99, 959–968. [Google Scholar] [CrossRef] [PubMed]
  46. Mariathasan, S.; Monack, D.M. Inflammasome adaptors and sensors: Intracellular regulators of infection and inflammation. Nat. Rev. Immunol. 2007, 7, 31–40. [Google Scholar] [CrossRef] [PubMed]
  47. Groschwitz, K.R.; Hogan, S.P. Intestinal barrier function: Molecular regulation and disease pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  48. Gao, Y.; Li, S.; Wang, J.; Luo, C.; Zhao, S.; Zheng, N. Modulation of intestinal epithelial permeability in differentiated Caco-2 cells exposed to aflatoxin M1 and ochratoxin A individually or collectively. Toxins 2018, 10, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Li, J.-Y.; Lu, Y.; Hu, S.; Sun, D.; Yao, Y.-M. Preventive effect of glutamine on intestinal barrier dysfunction induced by severe trauma. World J. Gastroenterol. 2002, 8, 168. [Google Scholar] [CrossRef] [PubMed]
  50. Li, Y.; Zhang, H.; Chen, Y.; Yang, M.; Zhang, L.; Lu, Z.; Zhou, Y.; Wang, T. Bacillus amyloliquefaciens supplementation alleviates immunological stress and intestinal damage in lipopolysaccharide-challenged broilers. Anim. Feed. Sci. Technol. 2015, 208, 119–131. [Google Scholar] [CrossRef]
  51. Fanning, A.S.; Jameson, B.J.; Jesaitis, L.A.; Anderson, J.M. The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J. Biol. Chem. 1998, 273, 29745–29753. [Google Scholar] [PubMed] [Green Version]
  52. Choi, K.-C.; Chung, W.-T.; Kwon, J.-K.; Yu, J.-Y.; Jang, Y.-S.; Park, S.-M.; Lee, S.-Y.; Lee, J.-C. Inhibitory effects of quercetin on aflatoxin B1-induced hepatic damage in mice. Food Chem. Toxicol. 2010, 48, 2747–2753. [Google Scholar] [CrossRef] [PubMed]
  53. Banan, A.; Choudhary, S.; Zhang, Y.; Fields, J.; Keshavarzian, A. Oxidant-induced intestinal barrier disruption and its prevention by growth factors in a human colonic cell line: Role of the microtubule cytoskeleton. Free. Radic. Biol. Med. 2000, 28, 727–738. [Google Scholar] [CrossRef]
  54. Zuo, R.-Y.; Chang, J.; Yin, Q.-Q.; Wang, P.; Yang, Y.-R.; Wang, X.; Wang, G.-Q.; Zheng, Q.-H. Effect of the combined probiotics with aflatoxin B1-degrading enzyme on aflatoxin detoxification, broiler production performance and hepatic enzyme gene expression. Food Chem. Toxicol. 2013, 59, 470–475. [Google Scholar] [PubMed]
  55. Fan, Y.; Zhao, L.; Ji, C.; Li, X.; Jia, R.; Xi, L.; Zhang, J.; Ma, Q. Protective effects of Bacillus subtilis ANSB060 on serum biochemistry, histopathological changes and antioxidant enzyme activities of broilers fed moldy peanut meal naturally contaminated with aflatoxins. Toxins 2015, 7, 3330–3343. [Google Scholar] [CrossRef]
  56. Wang, F.; Shu, G.; Peng, X.; Fang, J.; Chen, K.; Cui, H.; Chen, Z.; Zuo, Z.; Deng, J.; Geng, Y. Protective effects of sodium selenite against aflatoxin B1-induced oxidative stress and apoptosis in broiler spleen. Int. J. Environ. Res. Public Health 2013, 10, 2834–2844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Ali Rajput, S.; Sun, L.; Zhang, N.; Mohamed Khalil, M.; Gao, X.; Ling, Z.; Zhu, L.; Khan, F.A.; Zhang, J.; Qi, D. Ameliorative effects of grape seed proanthocyanidin extract on growth performance, immune function, antioxidant capacity, biochemical constituents, liver histopathology and aflatoxin residues in broilers exposed to aflatoxin B1. Toxins 2017, 9, 371. [Google Scholar] [CrossRef] [Green Version]
  58. Verma, R.J.; Mathuria, N. Curcumin ameliorates aflatoxin-induced changes in caput and cauda epididymis of mice. Int. J. Fertil. Steril. 2010, 4, 17–22. [Google Scholar]
  59. Cui, Y.; Cheng, Y.; Guo, Y.; Xie, Y.; Yao, W.; Zhang, W.; Qian, H. Evaluating the hepatoprotective efficacy of Aloe vera polysaccharides against subchronic exposure of aflatoxins B1. J. Taiwan Inst. Chem. Eng. 2017, 76, 10–17. [Google Scholar] [CrossRef]
  60. Delles, R.M.; Xiong, Y.L.; True, A.D.; Ao, T.; Dawson, K.A. Dietary antioxidant supplementation enhances lipid and protein oxidative stability of chicken broiler meat through promotion of antioxidant enzyme activity. Poult. Sci. 2014, 93, 1561–1570. [Google Scholar]
  61. Liu, J.; Li, N.; Ma, L.; Duan, Y.; Wang, J.; Zhao, X.; Wang, S.; Wang, H.; Hong, F. Oxidative injury in the mouse spleen caused by lanthanides. J. Alloys Compd. 2010, 489, 708–713. [Google Scholar] [CrossRef]
  62. Liu, X.-F.; Zhang, L.-M.; Guan, H.-N.; Zhang, Z.-W.; Xu, S.-W. Effects of oxidative stress on apoptosis in manganese-induced testicular toxicity in cocks. Food Chem. Toxicol. 2013, 60, 168–176. [Google Scholar] [CrossRef] [PubMed]
  63. Taș, M.; Saruhan, B.G.; Kurt, D.; Yokuș, B.; Denli, M. Protective role of lycopene on aflatoxin B1 induced changes sperm characteristics and testicular damages in rats. Kafkas Üniversitesi Vet. Fakültesi Derg. 2010, 16, 597–604. [Google Scholar]
  64. Yılmaz, S.; Kaya, E.; Comakli, S. Vitamin E (α tocopherol) attenuates toxicity and oxidative stress induced by aflatoxin in rats. Adv. Clin. Exp. Med. Off. Organ Wroc. Med. Univ. 2017, 26, 907–917. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Hu, L.; Zhang, Y.; Miao, W.; Cheng, T. Reactive oxygen species and Nrf2: Functional and transcriptional regulators of hematopoiesis. Oxidative Med. Cell. Longev. 2019, 2019, 5153268. [Google Scholar] [CrossRef] [PubMed]
  66. Habtemariam, S. The Nrf2/HO-1 axis as targets for flavanones: Neuroprotection by pinocembrin, naringenin, and eriodictyol. Oxidative Med. Cell. Longev. 2019, 2019, 11. [Google Scholar] [CrossRef]
  67. Zhao, B.; Liu, H.; Wang, J.; Liu, P.; Tan, X.; Ren, B.; Liu, Z.; Liu, X. Lycopene supplementation attenuates oxidative stress, neuroinflammation, and cognitive impairment in aged CD-1 mice. J. Agric. Food Chem. 2018, 66, 3127–3136. [Google Scholar] [PubMed]
  68. Marcotorchino, J.; Romier, B.; Gouranton, E.; Riollet, C.; Gleize, B.; Malezet-Desmoulins, C.; Landrier, J.F. Lycopene attenuates LPS-induced TNF-α secretion in macrophages and inflammatory markers in adipocytes exposed to macrophage-conditioned media. Mol. Nutr. Food Res. 2012, 56, 725–732. [Google Scholar] [CrossRef] [PubMed]
Animals 11 03165 g001 550
Figure 1. Effects of LYC on inflammatory gene expression level in the jejunum of broiler intestine fed AFB1 contaminated diets at 21 and 42 d. The column and its bar represented the means and standard error of the means (n = 6), respectively. a, b Means with different superscript letters are significantly different (p < 0.05). IL-10, interleukin-10; IL-1β, interleukin-1beta; IL-6, interleukin-6; IL-2, interleukin-2; INF- γ, interferon-γ; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Figure 1. Effects of LYC on inflammatory gene expression level in the jejunum of broiler intestine fed AFB1 contaminated diets at 21 and 42 d. The column and its bar represented the means and standard error of the means (n = 6), respectively. a, b Means with different superscript letters are significantly different (p < 0.05). IL-10, interleukin-10; IL-1β, interleukin-1beta; IL-6, interleukin-6; IL-2, interleukin-2; INF- γ, interferon-γ; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Animals 11 03165 g001
Animals 11 03165 g002 550
Figure 2. Effects of LYC on Serum D-lactate concentration (A) and diamine oxidase activities (B) in the broiler intestine fed AFB1 contaminated diet at 21 and 42 d. (C) Effects of LYC on tight junction related gene expression in the jejunum of broiler intestine fed AFB1 contaminated diets. The column and its bar represented the means and standard error of the means (n = 6), respectively. abc Means with different superscript letters are significantly different (p < 0.05). DAO, diamine oxidase; Mucin-2, mucins-2; OCLN, occludin; CLDN-1, claudin-1; CLDN-2, claudin-2; CLDN-3, claudin-3; ZO-1, zonula occludens-1; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Figure 2. Effects of LYC on Serum D-lactate concentration (A) and diamine oxidase activities (B) in the broiler intestine fed AFB1 contaminated diet at 21 and 42 d. (C) Effects of LYC on tight junction related gene expression in the jejunum of broiler intestine fed AFB1 contaminated diets. The column and its bar represented the means and standard error of the means (n = 6), respectively. abc Means with different superscript letters are significantly different (p < 0.05). DAO, diamine oxidase; Mucin-2, mucins-2; OCLN, occludin; CLDN-1, claudin-1; CLDN-2, claudin-2; CLDN-3, claudin-3; ZO-1, zonula occludens-1; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Animals 11 03165 g002
Animals 11 03165 g003 550
Figure 3. Effects of LYC on antioxidant gene expression in the jejunum of broiler intestine fed AFB1 contaminated diet. The column and its bar represented the means and standard error of the means (n = 6), respectively. abc Means with different superscript letters are significantly different (p < 0.05). Nrf2, nuclear factor-erythroid2-related factor2; HO-1, heme oxygenase-1; Cu/ZnSOD copper and zinc superoxide dismutase; MnSOD, Manganese superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxidase; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Figure 3. Effects of LYC on antioxidant gene expression in the jejunum of broiler intestine fed AFB1 contaminated diet. The column and its bar represented the means and standard error of the means (n = 6), respectively. abc Means with different superscript letters are significantly different (p < 0.05). Nrf2, nuclear factor-erythroid2-related factor2; HO-1, heme oxygenase-1; Cu/ZnSOD copper and zinc superoxide dismutase; MnSOD, Manganese superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxidase; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Animals 11 03165 g003
Table
Table 1. Composition of feed ingredients (g/kg) and nutrient level (%) as-fed basis.
Table 1. Composition of feed ingredients (g/kg) and nutrient level (%) as-fed basis.
Items1–21 d22–42 d
Ingredients (g/kg)
Corn570.10610.00
Soybean meal310.00280.00
Corn gluten meal40.0024.0
Soybean oil30.0040.0
Dicalcium phosphate20.0016.0
Limestone10.2013.0
L-Lysine2.002.50
DL-Methionine2.001.50
Premix 13.1010.00
Sodium chloride3.003.00
Calculated nutrient levels (%)
Metabolizable energy (MJ/kg)12.6112.96
Crude protein21.3619.44
Calcium1.000.93
Available phosphorus0.460.39
Lysine1.091.05
Methionine0.560.47
Arginine1.271.16
Methionine+ cysteine0.910.80
1 The premix provided per kilogram of diet: vitamin A (retinyl acetate), 12,000 IU; vitamin D3 (cholecalciferol), 2500 IU; vitamin E (DL-α-tocopheryl acetate), 20 IU; menadione, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8.0 mg; nicotinamide, 40 mg; choline chloride, 400 mg; calcium pantothenate, 10 mg; pyridoxine HCl, 4 mg; biotin, 0.04 mg; folic acid, 1.0 mg; vitamin B12 (cobalamin), 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulphate), 8.0 mg; Mn (from manganese sulphate), 110 mg; Zn(from zinc sulfate), 60 mg; I (from calcium iodate), 1.1 mg; and Se (from sodium selenite), 0.3 mg.
Table
Table 2. Primer sequences for quantitative real time PCR analysis.
Table 2. Primer sequences for quantitative real time PCR analysis.
Gene Name 1Accession IDPrimer Sequence (5′-3′)Length bp
IL-10NM_001004414Forward (F): ACTATTTTCAATCCAGGGACGA242
Reverse (R): GCAGGTGAAGAAGCGGTGA
IL-1βNM_204524F: CCGAGGAGCAGGGACTTT133
R: AGGACTGTGAGCGGGTGTAG
IL-6NM_204628F: AATCCCTCCTCGCCAATCT102
R: TCACGGTCTTCTCCATAAACG
IL-2NM_204153F: TGATCTTTGGCTGTATTTCGG169
R: TCCTGGGTCTCAGTTGGTGT
INF-γNM_205149F: AAGAACTGGACAGAGAGAAATGAGA154
R: CGCCATCAGGAAGGTTGTT
Mucin-2NM_001318434F: AAATGTATCTGTCGCCCCTCA121
R: TGTCGCCATCCTTTATTGTTG
OCLNNM_205128F: TCATCGCCTCCATCGTCTAC189
R: CGATGAGGAACCCACAGACA
CLDN-1NM_001013611F: GGATGACCAGGTGAAGAAGATG184
R: TGCCCAGCCAATGAAGAG
CLDN-2NM_001277622F: TCAACCTGCCTCCCGACA167
R: GATGAAGACCACCCCACCC
CLDN-3NM_204202F: TTCATCGGCAACAACATCG242
R: GCCTTGGTGGTCTCGTCCT
ZO-1XM_015278975F: CGCTAATAGAAAGGTCCAAAGG238
R: CTGGAATGGTCTGAAGGCTCT
Nrf2NM_205117F: CACCAAAGAAAGACCCTCCTG201
R: CACTGAACTGCTCCTTCGACAT
HO-1NM_205344F: ACGAGCAGGCGGAGAACA170
R: CATCGGAAAATAAACAGGAGCA
GSH-PxNM_001277854F: GTTCCAGAAGTGCCAGGTGA207
R: CTGTAGCGGCGGAAAGGT
Cu/ZnSODNM_205064F: AAGGGAGGAGTGGCAGAAGT210
R: TTTCAGGTACAACGGTTAGCACT
MnSODNM_204211F: CACTCTTCCTGACCTGCCTTAC169
R: CACCTGAGCTGTAACATCACCTT
CATNM_001031215F: TCTTGAGTCTTCGCCCTGAG166
R: TGATCGGTCTTAACGTGGAAC
β-actinNM_205518F: TGATATTGCTGCGCTCGTTG183
R: ATACCTCTTTTGCTCTGGGCTT
1 IL-10, interleukin-10; IL-1β, interleukin 1beta; IL-6, interlukin-6; IL-2, interlukin-2; IFN-γ, interferon-γ; Mucin-2, mucins-2; OCLN, occludin; CLDN-1, claudin-1; CLDN-2, claudin-2; CLDN-3, claudin-3; ZO-1, zonula occludens-1; Nrf2, nuclear factor-erythroid2-related factor2; HO-1, Heme oxygenase-1; Cu/ZnSOD copper and zinc superoxide dismutase; MnSOD, manganese superoxide dismutase; CAT, catalase; GSH-Px, glutathione peroxidase; and β-actin, beta-actin.
Table
Table 3. Effects of LYC on mucosal inflammatory status in the broiler jejunum fed AFB1 contaminated diet at 21 and 42 d.
Table 3. Effects of LYC on mucosal inflammatory status in the broiler jejunum fed AFB1 contaminated diet at 21 and 42 d.
Dietary Treatments
ParametersDaysControlAFB1AFB1 + LYCSEMp-Value
IFN-γ (ng/g protein)2124.08 b27.10 a23.34 b0.5860.011
4224.46 b28.42 a27.16 a,b0.6690.036
IL-1β (ng/g protein)2125.7327.1124.980.4470.142
4226.3227.6427.490.7090.731
IL-10 (ng/g protein)2110.46 a9.28 b10.38 a0.2160.028
428.36 b8.00 b9.31 a0.1910.006
Means with different superscripts (a, b) in the same row were significantly different at p < 0.05, and 0.05 < p < 0.10 was considered to be a tendency towards significant. SEM, pooled standard error of the means (n = 6), IFN-γ, interferon-γ; IL-1β, interleukin 1beta; IL-10, interleukin-10; AFB1, AflatoxinB1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Table
Table 4. Effects of LYC on oxidative status in the broiler jejunum fed AFB1 contaminated diet at 21 and 42 d.
Table 4. Effects of LYC on oxidative status in the broiler jejunum fed AFB1 contaminated diet at 21 and 42 d.
Dietary Treatments
ParametersDaysControlAFB1AFB1 + LYCSEMp-Value
H2O2 (µmol/gprot)216.70 b8.33 a7.17 ab0.2710.030
423.03 b4.80 a3.62 b0.216<0.001
MDA (nmol/mgprot)211.41 b2.33 a1.54 b0.108<0.001
421.82 b2.35 a2.00 b0.0810.015
Means with different superscripts (a, b) in the same row were significantly different at p < 0.05, and 0.05 < p <0.10 was considered to be a tendency towards significant. SEM, pooled standard error of the means (n = 6), H2O2, hydrogen peroxide; MDA, malondialdehyde; AFB1, AflatoxinB 1; LYC, Lycopene; and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Table
Table 5. Effects of LYC on antioxidant index in the jejunum of broilers fed with AFB1 contaminated diets at 21 and 42 days.
Table 5. Effects of LYC on antioxidant index in the jejunum of broilers fed with AFB1 contaminated diets at 21 and 42 days.
Dietary Treatments
ParametersDaysControlAFB1AFB1 + LYCSEMp-Value
GSH(µmol/gprot)21187.51160.33174.836.5030.348
4295.92 a81.38 b94.57 a2.1060.004
GST(U/mgprot)2156.3643.9251.013.4120.244
4240.55 a30.66 b39.33 a1.4770.002
GSH-Px(U/gprot)215.784.455.640.4000.349
422.10 a1.40 b1.90 a,b0.1260.046
GR(U/gprot)218.296.958.180.3130.151
427.68 a5.70 b6.92 a0.2770.005
CAT(U/mgprot)216.42 a4.78 b5.67 a,b0.2740.039
425.13 a4.23 b4.60 a,b0.1500.038
Means with different superscripts (a, b) in the same row were significantly different at p < 0.05, and 0.05 < p < 0.10 was considered to be a tendency towards significant. SEM, pooled standard error of the means (n = 6), GSH, glutathione; GST, glutathione-S-transferase; GSH-Px, glutathione peroxidase; GR, glutathione reductase; CAT, catalase: AFB1, AflatoxinB1; LYC, Lycopene; AFB1, (100 µg/kg AFB1); and AFB1 + LYC, (100 µg/kg AFB1 + 200 mg/kg LYC).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sarker, M.T.; Wan, X.; Yang, H.; Wang, Z. Dietary Lycopene Supplementation Could Alleviate Aflatoxin B1 Induced Intestinal Damage through Improving Immune Function and Anti-Oxidant Capacity in Broilers. Animals 2021, 11, 3165. https://doi.org/10.3390/ani11113165

AMA Style

Sarker MT, Wan X, Yang H, Wang Z. Dietary Lycopene Supplementation Could Alleviate Aflatoxin B1 Induced Intestinal Damage through Improving Immune Function and Anti-Oxidant Capacity in Broilers. Animals. 2021; 11(11):3165. https://doi.org/10.3390/ani11113165

Chicago/Turabian Style

Sarker, Md Touhiduzzaman, Xiaoli Wan, Haiming Yang, and Zhiyue Wang. 2021. "Dietary Lycopene Supplementation Could Alleviate Aflatoxin B1 Induced Intestinal Damage through Improving Immune Function and Anti-Oxidant Capacity in Broilers" Animals 11, no. 11: 3165. https://doi.org/10.3390/ani11113165

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop