Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Rabbit Sampling
2.3. PCR Amplification and DNA Sequencing
2.4. Statistical Analysis
3. Results
3.1. SNPs of Five Gene Fragments in Four Rabbit Breeds
3.2. Genotype Frequencies of Five Gene Fragments in Four Rabbit Breeds
3.3. Relationship between Coat Color and MC1R, MITF, TYR, TYRP1, and MLPH Gene Polymorphisms
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, X.; Li, W.; Liu, C.; Peng, X.; Lin, J.; He, S.; Li, X.; Han, B.; Zhang, N.; Wu, Y.; et al. Alteration of sheep coat color pattern by disruption of ASIP gene via CRISPR Cas9. Sci. Rep. 2017, 7, 8149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, S.; Zhai, P.; Chen, Y.; Zhao, B.; Yang, N.; Wang, M.; Xiao, Y.; Bao, G.; Wu, X. Morphological Characterization and Gene Expression Patterns for Melanin Pigmentation in Rex Rabbit. Biochem. Genet. 2019, 57, 734–744. [Google Scholar] [CrossRef] [Scilit]
- Dreger, D.L.; Hooser, B.N.; Hughes, A.M.; Ganesan, B.; Donner, J.; Anderson, H.; Holtvoigt, L.; Ekenstedt, K.J. True Colors: Commercially-acquired morphological genotypes reveal hidden allele variation among dog breeds, informing both trait ancestry and breed potential. PLoS ONE 2019, 14, 0223995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bhat, B.; Singh, A.; Iqbal, Z.; Kaushik, J.K.; Rao, A.R.; Ahmad, S.M.; Bhat, H.; Ayaz, A.; Sheikh, F.D.; Kalra, S.; et al. Comparative transcriptome analysis reveals the genetic basis of coat color variation in Pashmina goat. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alshanbari, F.; Castaneda, C.; Juras, R.; Hillhouse, A.; Mendoza, M.N.; Gutierrez, G.A.; de Leon, F.A.P.; Raudsepp, T. Comparative FISH-Mapping of MC1R, ASIP, and TYRP1 in New and Old World Camelids and Association Analysis With Coat Color Phenotypes in the Dromedary (Camelus dromedarius). Front. Genet. 2019, 10, 340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fontanesi, L.; Scotti, E.; Colombo, M.; Beretti, F.; Forestier, L.; Dall’Olio, S.; Deretz, S.; Russo, V.; Allain, D.; Oulmouden, A. A composite six bp in-frame deletion in the melanocortin 1 receptor (MC1R) gene is associated with the Japanese brindling coat colour in rabbits (Oryctolagus cuniculus). BMC Genet. 2010, 11, 59. [Google Scholar] [CrossRef] [Scilit]
- Fontanesi, L.; Tazzoli, M.; Beretti, F.; Russo, V. Mutations in the melanocortin 1 receptor (MC1R) gene are associated with coat colours in the domestic rabbit (Oryctolagus cuniculus). Anim. Genet. 2006, 37, 489–493. [Google Scholar] [CrossRef] [Scilit]
- Khaled, M.; Levy, C.; Fisher, D.E. Control of melanocyte differentiation by a MITF-PDE4D3 homeostatic circuit. Genes Dev. 2010, 24, 2276–2281. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Cheng, J.; Lu, Y.; Zhou, J.; Wang, L.; Yang, C.L.; Yang, G.; Yang, H.; Cao, J.Y.; Zhang, Z.; et al. The clinical and genetic research of Waardenburg syndrome type I and II in Chinese families. Int. J. Pediatr. Otorhinolaryngol. 2020, 130, 109806. [Google Scholar] [CrossRef] [Scilit]
- Reissmann, M.; Ludwig, A. Pleiotropic effects of coat colour-associated mutations in humans, mice and other mammals. Semin. Cell Dev. Biol. 2013, 24, 576–586. [Google Scholar] [CrossRef] [Scilit]
- Lai, X.L.; Wichers, H.J.; Soler-Lopez, M.; Dijkstra, B.W. Structure and Function of Human Tyrosinase and Tyrosinase-Related Proteins. Chem. Eur. J. 2018, 24, 47–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, F.F.; Qu, B.L.; Lin, D.D.; Deng, Y.W.; Huang, R.L.; Zhong, Z.M. Pax3 Gene Regulated Melanin Synthesis by Tyrosinase Pathway in Pteria penguin. Int. J. Mol. Sci. 2018, 19, 3700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.N.; Zhang, Y.X.; Chen, M.; Deng, J.C.; Sui, T.T.; Lai, L.X.; Li, Z.J. Functional validation of the albinism-associated tyrosinase T373K SNP by CRISPR/Cas9-mediated homology-directed repair (HDR) in rabbits. Ebiomedicine 2018, 36, 517–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Utzeri, V.J.; Ribani, A.; Fontanesi, L. A premature stop codon in the TYRP1 gene is associated with brown coat colour in the European rabbit (Oryctolagus cuniculus). Anim. Genet. 2014, 45, 600–603. [Google Scholar] [CrossRef] [Scilit]
- Lehner, S.; Gahle, M.; Dierks, C.; Stelter, R.; Gerber, J.; Brehm, R.; Distl, O. Two-Exon Skipping within MLPH Is Associated with Coat Color Dilution in Rabbits. PLoS ONE 2013, 8, 84525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, J.R.; Qiu, X.P.; Zeng, F.T.; Tang, L.M.; Zhang, Y.P. Origin of rabbit (Oryctolagus cuniculus) in China: Evidence from mitochondrial DNA control region sequence analysis. Anim. Genet. 2003, 34, 82–87. [Google Scholar] [CrossRef] [Scilit]
- Ren, A.; Du, K.; Jia, X.; Yang, R.; Wang, J.; Chen, S.Y.; Lai, S.J. Genetic diversity and population structure of four Chinese rabbit breeds. PLoS ONE 2019, 14, 0222503. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.N.; Xu, Y.X.; Deng, J.C.; Chen, M.; Lu, Y.; Wang, Y.; Yao, H.B.; Zhou, L.; Liu, Z.Q.; Lai, L.X.; et al. CRISPR/Cas9-mediated mutation of tyrosinase (Tyr) 3 ‘ UTR induce graying in rabbit. Sci. Rep. 2017, 7, 1–8. [Google Scholar] [CrossRef] [Scilit]
- Nei, M.; Roychoudhury, A.K. Sampling variances of heterozygosity and genetic distance. Genetics 1974, 76, 379–390. [Google Scholar]
- Mazouzi-Hadid, F.; Abdelli-Larbi, O.; Lebas, F.; Berchiche, M.; Bolet, G. Influence of coat colour, season and physiological status on reproduction of rabbit does in an Algerian local population. Anim. Reprod. Sci. 2014, 150, 30–34. [Google Scholar] [CrossRef] [Scilit]
- Herraiz, C.; Garcia-Borron, J.C.; Jimenez-Cervantes, C.; Olivares, C. MC1R signaling. Intracellular partners and pathophysiological implications. BBA Mol. Basis Dis. 2017, 1863, 2448–2461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, D.H.; Wang, X.L.; Fu, Y.W.; Zhang, C.X.; Cao, Y.F.; Wang, J.; Zhang, Y.H.; Li, Y.F.; Chen, Y.; Li, Z.J.; et al. Transcriptome Analysis of the Breast Muscle of Xichuan Black-Bone Chickens Under Tyrosine Supplementation Revealed the Mechanism of Tyrosine-Induced Melanin Deposition. Front. Genet. 2019, 10, 457. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, T.; Qu, J.Z.; Wang, Y.H.; Chang, L.G.; He, K.H.; Guo, D.W.; Zhang, X.H.; Xu, S.T.; Xue, J.Q. Genetic characterization of inbred lines from Shaan A and B groups for identifying loci associated with maize grain yield. BMC Genet. 2018, 19, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benned-Jensen, T.; Mokrosinski, J.; Rosenkilde, M.M. The E92K Melanocortin 1 Receptor Mutant Induces cAMP Production and Arrestin Recruitment but Not ERK Activity Indicating Biased Constitutive Signaling. PLoS ONE 2011, 6, 24644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shang, S.Y.; Yu, Y.; Zhao, Y.X.; Dang, W.Y.; Zhang, J.P.; Qin, X.; Irwin, D.M.; Wang, Q.; Liu, F.; Wang, Z.S.; et al. Synergy between MC1R and ASIP for coat color in horses (Equus caballus). J. Anim. Sci. 2019, 97, 1578–1585. [Google Scholar] [CrossRef] [Scilit]
- Dorshorst, B.; Henegar, C.; Liao, X.P.; Almen, M.S.; Rubin, C.J.; Ito, S.; Wakamatsu, K.; Stothard, P.; Van Doormaal, B.; Plastow, G.; et al. Dominant Red Coat Color in Holstein Cattle Is Associated with a Missense Mutation in the Coatomer Protein Complex, Subunit Alpha (COPA) Gene. PLoS ONE 2015, 10, 0128969. [Google Scholar] [CrossRef] [Scilit]
- Vidal, O. Deleterious mutations of MC1R in guinea pig. Anim. Genet. 2018, 49, 498–499. [Google Scholar] [CrossRef] [Scilit]
- Li, J.P.; Chen, W.; Wu, S.F.; Ma, T.; Jiang, H.Z.; Zhang, Q.L. Differential expression of MC1R gene in Liaoning Cashmere goats with different coat colors. Anim. Biotechnol. 2019, 30, 273–278. [Google Scholar] [CrossRef] [Scilit]
- Zhang, G.W.; Liao, Y.L.; Zhang, W.X.; Wu, Y.H.; Liu, A.F. A new dominant haplotype of MC1R gene in Chinese black plumage chicken. Anim. Genet. 2017, 48, 624. [Google Scholar] [CrossRef] [Scilit]
- Xiao, N.; Li, H.L.; Shafique, L.; Zhao, S.S.; Su, X.P.; Zhang, Y.; Cui, K.Q.; Liu, Q.Y.; Shi, D.S. A Novel Pale-Yellow Coat Color of Rabbits Generated via MC1R Mutation With CRISPR/Cas9 System. Front. Genet. 2019, 10, 875. [Google Scholar] [CrossRef] [Scilit]
- Chen, T.; Zhao, B.; Liu, Y.; Wang, R.; Yang, Y.; Yang, L.; Dong, C. MITF-M regulates melanogenesis in mouse melanocytes. J. Derm. Sci. 2018, 90, 253–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, Y.; Ren, L.L.; Jiang, Q.Q.; Liu, X.J.; Ji, F.; Zhang, Y.; Yuan, S.L.; Wu, Z.M.; Guo, W.W.; Yang, S.M. Degeneration of saccular hair cells caused by MITF gene mutation. Neural Dev. 2019, 14, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hofstetter, S.; Seefried, F.; Hafliger, I.M.; Jagannathan, V.; Leeb, T.; Drogemuller, C. A non-coding regulatory variant in the 5 ‘-region of the MITF gene is associated with white-spotted coat in Brown Swiss cattle. Anim. Genet. 2019, 50, 27–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henkel, J.; Lafayette, C.; Brooks, S.A.; Martin, K.; Patterson-Rosa, L.; Cook, D.; Jagannathan, V.; Leeb, T. Whole-genome sequencing reveals a large deletion in the MITF gene in horses with white spotted coat colour and increased risk of deafness. Anim. Genet. 2019, 50, 172–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, G.; Liao, J.; Tang, M.; Yu, S. Genetic variation in the MITF promoter affects skin colour and transcriptional activity in black-boned chickens. Br. Poult. Sci. 2018, 59, 21–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, L.; Mo, C.; Shen, W.; Du, X.; Bhuiyan, A.A.; Li, L.; Li, N.; Gong, Y.; Li, S. The recessive C locus in the MITF gene plays a key regulatory role in the plumage colour pattern of duck (Anas platyrhynchos). Br. Poult. Sci. 2019, 60, 105–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anello, M.; Daverio, M.S.; Silbestro, M.B.; Vidal-Rioja, L.; Di Rocco, F. Characterization and expression analysis of KIT and MITF-M genes in llamas and their relation to white coat color. Anim. Genet. 2019, 50, 143–149. [Google Scholar] [CrossRef] [Scilit]
- Sun, W.; Shen, Y.J.; Shan, S.; Han, L.Y.; Li, Y.; Zhou, Z.; Zhong, Z.L.; Chen, J.J. Identification of TYR mutations in patients with oculocutaneous albinism. Mol. Med. Rep. 2018, 17, 8409–8413. [Google Scholar] [CrossRef] [Scilit]
- Norman, C.S.; O’Gorman, L.; Gibson, J.; Pengelly, R.J.; Baralle, D.; Ratnayaka, J.A.; Griffiths, H.; Rose-Zerilli, M.; Ranger, M.; Bunyan, D.; et al. Identification of a functionally significant tri-allelic genotype in the Tyrosinase gene (TYR) causing hypomorphic oculocutaneous albinism (OCA1B). Sci. Rep. 2017, 7, 4415. [Google Scholar] [CrossRef] [Scilit]
- Yao, L.D.; Bao, A.; Hong, W.J.; Hou, C.X.; Zhang, Z.L.; Liang, X.P.; Aniwashi, J. Transcriptome profiling analysis reveals key genes of different coat color in sheep skin. PeerJ 2019, 7, 8077. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.Y.; Wang, H.; Dong, B.; Dong, Z.D.; Zhou, F.N.; Fu, Y.; Zeng, Y.Q. Molecular cloning and expression analysis of tyrosinase gene in the skin of Jining gray goat (Capra hircus). Mol. Cell. Biochem. 2012, 366, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, S.J.; Wang, C.; Yu, W.H.; Zhao, S.H.; Gong, Y.Z. Identification of Genes Related to White and Black Plumage Formation by RNA-Seq from White and Black Feather Bulbs in Ducks. PLoS ONE 2012, 7, 36592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, S.; Wang, G.; Liao, J.; Tang, M. Five alternative splicing variants of the TYR gene and their different roles in melanogenesis in the Muchuan black-boned chicken. Br. Poult. Sci. 2019, 60, 8–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Honda, A.; Hirose, M.; Sankai, T.; Yasmin, L.; Yuzawa, K.; Honsho, K.; Izu, H.; Iguchi, A.; Ikawa, M.; Ogura, A. Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR/Cas9. Exp. Anim. 2015, 64, 31–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Y.N.; Yuan, L.; Wang, Y.; Chen, M.; Deng, J.C.; Lv, Q.Y.; Sui, T.T.; Li, Z.J.; Lai, L.X. Efficient dual sgRNA-directed large gene deletion in rabbit with CRISPR/Cas9 system. Cell. Mol. Life Sci. 2016, 73, 2959–2968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.Q.; Zhang, Y.; Shen, L.Y.; Du, J.J.; Luo, J.; Liu, C.D.; Pu, Q.; Yang, R.L.; Li, X.W.; Bai, L.; et al. A 6-bp deletion in exon 8 and two mutations in introns of TYRP1 are associated with blond coat color in Liangshan pigs. Gene 2016, 578, 132–136. [Google Scholar] [CrossRef] [Scilit]
- Mohanty, T.R.; Seo, K.S.; Park, K.M.; Choi, T.J.; Choe, H.S.; Baik, D.H.; Hwang, I.H. Molecular variation in pigmentation genes contributing to coat colour in native Korean Hanwoo cattle. Anim. Genet. 2008, 39, 550–553. [Google Scholar] [CrossRef] [Scilit]
- Paris, J.M.; Letko, A.; Hafliger, I.M.; Ammann, P.; Flury, C.; Drogemuller, C. Identification of two TYRP1 loss-of-function alleles in Valais Red sheep. Anim. Genet. 2019, 50, 778–782. [Google Scholar] [CrossRef] [Scilit]
- Becker, D.; Otto, M.; Ammann, P.; Keller, I.; Drogemuller, C.; Leeb, T. The brown coat colour of Coppernecked goats is associated with a non-synonymous variant at the TYRP1 locus on chromosome 8. Anim. Genet. 2015, 46, 50–54. [Google Scholar] [CrossRef] [Scilit]
- Cirera, S.; Markakis, M.N.; Kristiansen, T.; Vissenberg, K.; Fredholm, M.; Christensen, K.; Anistoroaei, R. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink. Mamm. Genome 2016, 27, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Ishida, Y.; David, V.A.; Eizirik, E.; Schaffer, A.A.; Neelam, B.A.; Roelke, M.E.; Hannah, S.S.; O’Brien, S.J.; Menotti-Raymond, M. A homozygous single-base deletion in MLPH causes the dilute coat color phenotype in the domestic cat. Genomics 2006, 88, 698–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bauer, A.; Kehl, A.; Jagannathan, V.; Leeb, T. A novel MLPH variant in dogs with coat colour dilution. Anim. Genet. 2018, 49, 94–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.B.; Sartelet, A.; Tamma, N.; Coppieters, W.; Georges, M.; Charlier, C. Reverse genetic screen for loss-of-function mutations uncovers a frameshifting deletion in the melanophilin gene accountable for a distinctive coat color in Belgian Blue cattle. Anim. Genet. 2016, 47, 110–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.G.; Xie, M.G.; Zou, S.Y.; Liu, X.F.; Li, X.H.; Xie, J.F.; Zhang, X.Q. Interactions of allele E of the MC1R gene with FM and mutations in the MLPH gene cause the five-gray phenotype in the Anyi tile-like gray chicken. Genet. Mol. Res. 2016, 15. [Google Scholar] [CrossRef] [Scilit]
- Posbergh, C.; Staiger, E.; Huson, H. A Stop-Gain Mutation within MLPH Is Responsible for the Lilac Dilution Observed in Jacob Sheep. Genes 2020, 11, 1. [Google Scholar] [CrossRef] [Scilit]
- Cirera, S.; Markakis, M.N.; Christensen, K.; Anistoroaei, R. New insights into the melanophilin (MLPH) gene controlling coat color phenotypes in American mink. Gene 2013, 527, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Demars, J.; Iannuccelli, N.; Utzeri, V.J.; Auvinet, G.; Riquet, J.; Fontanesi, L.; Allain, D. New Insights into the Melanophilin (MLPH) Gene Affecting Coat Color Dilution in Rabbits. Genes 2018, 9, 430. [Google Scholar] [CrossRef] [Scilit]
- Fontanesi, L.; Scotti, E.; Allain, D.; Dall’Olio, S. A frameshift mutation in the melanophilin gene causes the dilute coat colour in rabbit (Oryctolagus cuniculus) breeds. Anim. Genet. 2014, 45, 248–255. [Google Scholar] [CrossRef] [Scilit]
| Primer Names | Primer Sequence (5′→3′) | Fragment Size (bp) | Tm (°C) |
|---|---|---|---|
| MC1R | F: GCTCCCTCATGCCACC R: GAACATGCGGACGTACAAAA | 606 | 58 °C |
| MITF | F: TGTTACTAATAGCCCTTTCC R: GGACACTTCTTTACCCTAG | 729 | 56 °C |
| TYR | F: GTGAACCAGAGGGAACAT R: AAAGTGAGGTAGGCAAGG | 741 | 58 °C |
| TYRP1 | F: TGCCATACCAGACCAAG R: CAATGACAAACTGAGGG | 682 | 56 °C |
| MLPH | F: CCTCCCTCAGTGCCACCTCT R: GGTCCCTAACTCCCACTTGG | 498 | 56 °C |
| Breed | Locus | Genotype Frequency | PIC | p Value | |
|---|---|---|---|---|---|
| Normal | Indel | ||||
| TB | c.284-285del | 12(0.5000) | 12(0.5000) | 0.3750 | 0.1351 |
| SW | 18(0.7500) | 6(0.2500) | 0.3046 | ||
| TB | c.292-295del | 15(0.6250) | 9(0.3750) | 0.3589 | 0.03633 |
| SW | 22(0.9167) | 2(0.0833) | 0.1411 | ||
| Breed | Locus | Genotype Frequency | Allele Frequency | PIC | p Value | |||
|---|---|---|---|---|---|---|---|---|
| g.232587 A < G | AA | AG | GG | A | G | |||
| TB | 7(0.2917) | 10(0.4167) | 7(0.2917) | 0.5000 | 0.5000 | 0.3750 | 0.00349 | |
| SG | 18(0.7500) | 2(0.0833) | 4(0.1667) | 0.7917 | 0.2083 | 0.2755 | ||
| g.232650C < G | CC | CG | GG | C | G | |||
| TB | 8(0.3333) | 8(0.3333) | 8(0.3333) | 0.5000 | 0.5000 | 0.3750 | ||
| g.232766A < T | AA | AT | TT | A | T | |||
| SW | 3(0.1250) | 4(0.1667) | 17(0.7083) | 0.2083 | 0.7917 | 0.2755 | ||
| Breed | Locus | Genotype Frequency | Allele Frequency | PIC | p Value | |||
|---|---|---|---|---|---|---|---|---|
| c.185G < A | GG | GA | AA | G | A | |||
| TB | 2(0.0833) | 18(0.7500) | 4(0.1667) | 0.4583 | 0.5417 | 0.3733 | 0.003862 | |
| SG | 0(0.000) | 10(0.4167) | 14(0.5833) | 0.2083 | 0.7917 | 0.2755 | ||
| c.465C < T | CC | CT | TT | C | T | |||
| TB | 2(0.0833) | 18(0.7500) | 4(0.1667) | 0.4583 | 0.5417 | 0.3733 | ||
| c.498T < C | TT | TC | CC | T | C | |||
| TB | 2(0.0435) | 18(0.7826) | 4(0.1739) | 0.4583 | 0.5417 | 0.3733 | ||
| c.669C < T | CC | CT | TT | C | T | |||
| TB | 4(0.1667) | 16(0.6667) | 4(0.1667) | 0.5000 | 0.5000 | 0.3750 | ||
| c.624C < T | GG | GA | AA | G | A | |||
| TB | 2(0.0833) | 2(0.0833) | 20(0.8333) | 0.1250 | 0.8750 | 0.1948 | 9.57 × 10−9 | |
| SW | 2(0.0833) | 7(0.2917) | 15(0.6250) | 0.2292 | 0.7708 | 0.2909 | ||
| SG | 19(0.7917) | 1(0.0417) | 4(0.1667) | 0.8125 | 0.1875 | 0.2583 | ||
| Breed | Locus | Genotype Frequency | Allele Frequency | PIC | p Value | |||
|---|---|---|---|---|---|---|---|---|
| g.4137286G < A | GG | GA | AA | G | A | |||
| TB | 6(0.2500) | 10(0.4167) | 8(0.3333) | 0.4583 | 0.5417 | 0.3733 | 0.008868 | |
| SW | 0(0.0000) | 8(0.3333) | 16(0.6667) | 0.1667 | 0.8333 | 0.2392 | ||
| SG | 4(0.1667) | 11(0.4583) | 9(0.3750) | 0.3958 | 0.6042 | 0.3639 | ||
| FY | 0(0.0000) | 15(0.6250) | 9(0.3750) | 0.3125 | 0.6875 | 0.3374 | ||
| Breed | Locus | Genotype Frequency | Allele Frequency | PIC | p Value | |||
|---|---|---|---|---|---|---|---|---|
| c.693C < G | CC | CG | GG | C | G | |||
| TB | 8(0.3333) | 1(0.0417) | 15(0.6250) | 0.3542 | 0.6458 | 0.3528 | 6.29 × 10−5 | |
| SW | 6(0.2500) | 14(0.5833) | 4(0.1677) | 0.5417 | 0.4583 | 0.3733 | ||
| c.851A < G | AA | AG | GG | A | G | |||
| TB | 8(0.3333) | 1(0.0417) | 15(0.6250) | 0.3542 | 0.6458 | 0.3528 | 0.02236 | |
| SW | 8(0.3333) | 8(0.3333) | 8(0.3333) | 0.5000 | 0.5000 | 0.3750 | ||
| c.911G < A | GG | GA | AA | A | G | |||
| TB | 11(0.4533) | 0(0.0000) | 13(0.5417) | 0.4583 | 0.5417 | 0.3733 | 0.000962 | |
| SW | 8(0.3333) | 10(0.4167) | 6(0.2500) | 0.5417 | 0.4583 | 0.3733 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jia, X.; Ding, P.; Chen, S.; Zhao, S.; Wang, J.; Lai, S. Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors. Animals 2021, 11, 81. https://doi.org/10.3390/ani11010081
Jia X, Ding P, Chen S, Zhao S, Wang J, Lai S. Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors. Animals. 2021; 11(1):81. https://doi.org/10.3390/ani11010081
Chicago/Turabian StyleJia, Xianbo, Peng Ding, Shiyi Chen, Shaokang Zhao, Jie Wang, and Songjia Lai. 2021. "Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors" Animals 11, no. 1: 81. https://doi.org/10.3390/ani11010081
APA StyleJia, X., Ding, P., Chen, S., Zhao, S., Wang, J., & Lai, S. (2021). Analysis of MC1R, MITF, TYR, TYRP1, and MLPH Genes Polymorphism in Four Rabbit Breeds with Different Coat Colors. Animals, 11(1), 81. https://doi.org/10.3390/ani11010081

