Insights into the Mechanism of Bovine Spermiogenesis Based on Comparative Transcriptomic Studies
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. Sequencing Analysis of Bovine Spermatids and Sperm
2.2. Principal Component Analysis (PCA) Analysis of Bovine and Mouse Transcripts of Spermatids and Sperm
2.3. Quantitative Real-Time RT PCR (RT-qPCR) Validation of the Bovine RNA-Seq Results
2.4. Differentially Expressed Genes (DEGs) Screening of the Bovine Spermatids and Sperm
2.5. Trend Analysis between DEGs of Spermatids and Sperm in Bovine and Their Homologous Genes of Transcriptome in Mouse
2.6. GO and KEGG Enrichment Analysis of DEGs in Bovine Homologous to Mouse with the Same Expression Trend
2.7. ART3 Immunohistochemical Staining Results
2.8. Bioinformatic Analysis of Bovine ART3 Protein
3. Discussion
3.1. Transcription Gradually Decreases during Spermiogenesis But Is Not Completely Suppressed
3.2. From Round to Elongated Spermatids, DEGs Are Mainly Related to Acrosome Formation and Fertilisation Ability
3.3. The Balance between Acetylation and Deacetylation Are Important to Maintain Sperm Deformation
3.4. Ubiquitination Plays a Critical Role in Promoting Histone Replacement by Protamine and Their Degradation
3.5. Members of ADP-Ribosyltransferases Can Repair DNA Strand Breaks and May Affect the Deformation of Spermatid
4. Materials and Methods
4.1. Ethical Statement
4.2. RNA-Seq Analysis of Bovine Spermatids and Sperm
4.3. Principal Component Analysis (PCA) of Transcripts among Bovine Spermatids and Sperms
4.4. Validation of RNA-Seq Data from the Bovine by RT-qPCR
4.5. Acquisition and Analysis of Mouse RNA-Seq Data
4.6. Trend Analysis of Gene Expression and Screening of Genes with the Same Trend
4.7. GO Term and KEGG Pathway Enrichment Analysis
4.8. Protein–Protein Interaction Network (PPI network) Analysis
4.9. Immunofluorescence Staining of Bovine and Mouse Sperm and Testes
4.10. Measurement of Optical Density
4.11. Bioinformatics Analysis of DEG ART3
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
DEGs | Differentially expressed genes |
GO | Gene Ontology |
KEGG | Kyoto Encyclopaedia of Genes and Genomes |
RT | Room temperature |
RT-qPCR | Quantitative real-time RT PCR |
ORA | Over-representation analysis |
MCODE | Molecular complex detection |
PPI | Protein–protein interaction |
ROS | Reactive oxygen species |
PCA | Principal component analysis |
IOD | Integrated optical density |
AOD | Average optical density |
References
- Schenk, J.L. Review: Principles of maximizing bull semen production at genetic centers. Animal 2018, 12, s142–s147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fair, S.; Lonergan, P. Review: Understanding the causes of variation in reproductive wastage among bulls. Animal 2018, 12, s53–s62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schlegel, P.N. Evaluation of male infertility. Minerva. Ginecol. 2009, 61, 261–283. [Google Scholar] [PubMed]
- Simon, L.; Emery, B.R.; Carrell, D.T. Review: Diagnosis and impact of sperm DNA alterations in assisted reproduction. Best Pract. Res. Obstet. Gynaecol. 2017, 44, 38–56. [Google Scholar] [CrossRef]
- Hamze, J.G.; Sanchez, J.M.; O’Callaghan, E.; McDonald, M.; Bermejo-Alvarez, P.; Romar, R.; Lonergan, P.; Jimenez-Movilla, M. JUNO protein coated beads: A potential tool to predict bovine sperm fertilizing ability. Theriogenology 2020, 155, 168–175. [Google Scholar] [CrossRef] [PubMed]
- Devlin, D.J.; Zaneveld, S.A.; Nozawa, K.; Han, X.; Moye, A.R.; Liang, Q.; Harnish, J.M.; Matzuk, M.M.; Chen, R. Knockout of mouse receptor accessory protein 6 leads to sperm function and morphology defects. Biol. Reprod. 2020, 102, 14. [Google Scholar] [CrossRef] [PubMed]
- Evenson, D.P.; Wixon, R. Data analysis of two in vivo fertility studies using Sperm Chromatin Structure Assay-derived DNA fragmentation index vs. pregnancy outcome. Fertil. Steril. 2008, 90, 1229–1231. [Google Scholar] [CrossRef]
- Manterola, M.; Brown, T.M.; Oh, M.Y.; Garyn, C.; Gonzalez, B.J.; Wolgemuth, D.J. BRDT is an essential epigenetic regulator for proper chromatin organization, silencing of sex chromosomes and crossover formation in male meiosis. PLoS Genet. 2018, 14, e1007209. [Google Scholar] [CrossRef] [Green Version]
- Shang, E.; Nickerson, H.D.; Wen, D.; Wang, X.; Wolgemuth, D.J. The first bromodomain of Brdt, a testis-specific member of the BET sub-family of double-bromodomain-containing proteins, is essential for male germ cell differentiation. Development 2007, 134, 3507–3515. [Google Scholar] [CrossRef] [Green Version]
- Lu, L.Y.; Wu, J.; Ye, L.; Gavrilina, G.B.; Saunders, T.L.; Yu, X. RNF8-dependent histone modifications regulate nucleosome removal during spermatogenesis. Dev. Cell 2010, 18, 371–384. [Google Scholar] [CrossRef] [Green Version]
- Cheon, Y.-P.; Kim, C.-H. Impact of glycosylation on the unimpaired functions of the sperm. Clin. Exp. Reprod. Med. 2015, 42, 77–85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, J.-J.; Miki, K.; Kim, D.; Shim, S.-H.; Shi, H.F.; Hwang, J.Y.; Xinjiang Cai, Y.I.; Zhuang, X.; Clapham, D.E. CatSperζ regulates the structural continuity of sperm Ca2+ signaling domains and is required for normal fertility. eLife 2017, 6, e23082. [Google Scholar] [CrossRef] [PubMed]
- Petitot, A.S.; Dereeper, A.; Agbessi, M.; Silva, C.D.; Guy, J.; Ardisson, M.; Fernandez, D. Dual RNA-seq reveals Meloidogyne graminicola transcriptome and candidate effectors during the interaction with rice plants. Mol. Plant. Pathol. 2016, 17, 860–874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mueller-Dieckmann, C.; Ritter, H.; Haag, F.; Koch-Nolte, F.; Schulz, G.E. Structure of the Ecto-ADP-ribosyl Transferase ART2.2 from Rat. J. Mol. Biol. 2002, 322, 687–696. [Google Scholar] [CrossRef]
- Zuo, H.; Zhang, J.; Zhang, L.; Ren, X.; Wang, D. Transcriptomic Variation during Spermiogenesis in Mouse Germ Cells. PLoS ONE 2016, 11, e0164874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.; Lu, W.; Yang, J.; Jiang, L.; Zhang, Q.; Kan, X.; Yang, X. Comparative transcriptomics in three Passerida species provides insights into the evolution of avian mitochondrial complex I. Comp. Biochem. Physiol. Part D Genom. Proteom. 2018, 28, 27–36. [Google Scholar] [CrossRef]
- D’Occhio, M.J.; Hengstberger, K.J.; Johnston, S.D. Biology of sperm chromatin structure and relationship to male fertility and embryonic survival. Anim. Reprod. Sci. 2007, 101, 1–17. [Google Scholar] [CrossRef]
- Ren, X.; Chen, X.; Wang, Z.; Wang, D. Is transcription in sperm stationary or dynamic? J. Reprod. Dev. 2017, 63, 439–443. [Google Scholar] [CrossRef] [Green Version]
- Fischer, B.E.; Wasbrough, E.; Meadows, L.A.; Randlet, O.; Dorus, S.; Karr, T.L.; Russell, S. Conserved properties of Drosophila and human spermatozoal mRNA repertoires. Proc. Biol. Sci. 2012, 279, 2636–2644. [Google Scholar] [CrossRef] [Green Version]
- Kramer, J.A.; Mccarrey, J.R.; Djakiew, D.; Krawetz, S.A. Human spermatogenesis as a model to examine gene potentiation. Mol. Reprod. Dev. 2000, 56, 254–258. [Google Scholar] [CrossRef]
- Wykes, S.M.; Krawetz, S.A. The Structural Organization of Sperm Chromatin. J. Biol. Chem. 2003, 2, 29471–29477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Welch, J.E.; Barbee, R.R.; Magyar, P.L.; Bunch, D.O.; O’Brien, D.A. Expression of the spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase (GAPDS) in rat testis. Mol. Reprod. Dev. 2006, 73, 1052–1060. [Google Scholar] [CrossRef] [Green Version]
- Barreau, C.; Benson, E.; Gudmannsdottir, E.; Newton, F.; White-Cooper, H. Post-meiotic transcription in Drosophila testes. Development 2008, 135, 1897–1902. [Google Scholar] [CrossRef] [Green Version]
- Breschi, A.; Gingeras, T.R.; Guigó, R. Comparative transcriptomics in human and mouse. Nat. Rev. Genet. 2017, 18, 425–440. [Google Scholar] [CrossRef] [PubMed]
- Ghandhi, S.A.; Sinha, A.; Markatou, M.; Amundson, S.A. Time-series clustering of gene expression in irradiated and bystander fibroblasts: An application of FBPA clustering. BMC Genom. 2011, 12, 1–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zheng, Y.; Li, X.; Huang, Y.; Jia, L.; Li, W. Time series clustering of mRNA and lncRNA expression during osteogenic differentiation of periodontal ligament stem cells. Peerj 2018, 6, e5214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, F.; Jiang, L.; Yang, H.; Yang, X.; Wu, J.; Huang, X.; Ni, W. Association of polymorphisms in ART3 gene with male infertility in the Chinese population. Int. J. Clin. Exp. Med. 2015, 8, 7944–7950. [Google Scholar]
- Friedrich, M.; Grahnert, A.; Paasch, U.; Tannapfel, A.; Koch-Nolte, F.; Hauschildt, S. Expression of toxin-related human mono-ADP-ribosyltransferase 3 in human testes. Asian J. Androl. 2006, 8, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Inoue, N.; Ikawa, M.; Isotani, A.; Okabe, M. The immunoglobulin superfamily protein Izumo is required for sperm to fuse with eggs. Nature 2005, 434, 234–238. [Google Scholar] [CrossRef]
- Ito, C.; Toshimori, K. Acrosome markers of human sperm. Anat. Sci. Int. 2016, 91, 128–142. [Google Scholar] [CrossRef]
- Saindon, A.; Leclerc, P. SPAM1 and PH-20 are two gene products expressed in bovine testis and present in sperm. Reproduction 2018, 156, 487–500. [Google Scholar] [CrossRef] [PubMed]
- Kishida, K.; Harayama, H.; Kimura, F.; Murakami, T. Individual differences in the distribution of sperm acrosome-associated 1 proteins among male patients of infertile couples; their possible impact on outcomes of conventional in vitro fertilization. Zygote 2016, 24, 654–661. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, H.; Gupta, S.; Myles, D.G.; Primakoff, P. Characterization of mouse sperm TMEM190, a small transmembrane protein with the trefoil domain: Evidence for co-localization with IZUMO1 and complex formation with other sperm proteins. Reproduction 2011, 141, 437–451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thomas, T.; Loveland, K.L.; Voss, A.K. The genes coding for the MYST family histone acetyltransferases, Tip60 and Mof, are expressed at high levels during sperm development. Gene Exp. Patterns 2007, 7, 657–665. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Isono, K.I.; Ohbo, K.; Endo, T.A.; Ohara, O.; Maekawa, M.; Toyama, Y.; Ito, C.; Toshimori, K.; Helin, K. EPC1/TIP60-mediated histone acetylation facilitates spermiogenesis in mice. Mol. Cell Biol. 2017, 37. [Google Scholar] [CrossRef] [Green Version]
- Sonnack, V.; Failing, K.; Bergmann, M.; Steger, K. Expression of hyperacetylated histone H4 during normal and impaired human spermatogenesis. Andrologia 2002, 34, 384–390. [Google Scholar] [CrossRef]
- Steger, K. Haploid spermatids exhibit translationally repressed mRNAs. Anat. Embryol. 2001, 203, 323–334. [Google Scholar] [CrossRef]
- Kim, J.; Kim, J.-H.; Jee, B.-C.; Suh, C.-S.; Kim, S.-H. Is There a Link Between Expression Levels of Histone Deacetylase/Acetyltransferase in Mouse Sperm and Subsequent Blastocyst Development? Reprod. Sci. 2015, 22, 1387–1392. [Google Scholar] [CrossRef]
- Almabhouh, F.A.; Singh, H.J. Adverse effects of leptin on histone-to-protamine transition during spermatogenesis are prevented by melatonin in Sprague-Dawley rats. Andrologia 2018, 50, e12814. [Google Scholar] [CrossRef]
- Hazzouri, M.; Pivot-Pajot, C.; Faure, A.K.; Usson, Y.; Pelletier, R.; Sele, B.; Khochbin, S.; Rousseaux, S. Regulated hyperacetylation of core histones during mouse spermatogenesis: Involvement of histone deacetylases. Eur. J. Cell Biol. 2000, 79, 950–960. [Google Scholar] [CrossRef]
- Min, Y.; Mi-Jeong, K.; Sena, L.; Eunyoung, C.; Ki-Young, L. Inhibition of TRAF6 ubiquitin-ligase activity by PRDX1 leads to inhibition of NFKB activation and autophagy activation. Autophagy 2018, 14, 1347–1358. [Google Scholar] [CrossRef] [PubMed]
- Kim, R.N.; Kim, D.-W.; Choi, S.-H.; Chae, S.-H.; Nam, S.-H.; Kim, D.-W.; Aeri Kim, A.K.; Park, K.-H.; Lee, Y.S.; Hirai, M.; et al. Major chimpanzee-specific structural changes in sperm development-associated genes. Funct. Integr. Genom. 2011, 11, 507–517. [Google Scholar] [CrossRef] [PubMed]
- González, B.; Pantoja, C.R.G.; Sosa, M.H.; Vitullo, A.D.; Bisagno, V.; González, C.R. Cocaine alters the mouse testicular epigenome with direct impact on histone acetylation and DNA methylation marks. Reprod. Biomed. Online 2018, 37, 269–278. [Google Scholar] [CrossRef] [PubMed]
- Gill-Sharma, M.K.; Choudhuri, J.; Ansari, M.A.; D’Souza, S. Putative molecular mechanism underlying sperm chromatin remodelling is regulated by reproductive hormones. Clin. Epigenetics 2012, 4, 23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanpude, P.; Bhattacharya, S.; Dey, A.K.; Maiti, T.K. Deubiquitinating enzymes in cellular signaling and disease regulation. IUBMB Life 2015, 67, 544–555. [Google Scholar] [CrossRef]
- Sutovsky, P. Review: Sperm–oocyte interactions and their implications for bull fertility, with emphasis on the ubiquitin–proteasome system. Animal 2018, 12, s121–s132. [Google Scholar] [CrossRef]
- Muratori, M.; Marchiani, S.; Criscuoli, L.; Fuzzi, B.; Tamburino, L.; Dabizzi, S.; Pucci, C.; Evangelisti, P.; Forti, G.; Noci, I. Biological meaning of ubiquitination and DNA fragmentation in human spermatozoa. Soc. Reprod. Fertil. Suppl. 2007, 63, 153–158. [Google Scholar]
- Bao, J.; Bedford, M.T. Epigenetic regulation of the histone-to-protamine transition during Spermiogenesis. Reproduction 2016, 151, R55–R70. [Google Scholar] [CrossRef] [Green Version]
- Agarwal, A.; Mahfouz, R.Z.; Sharma, R.K.; Sarkar, O.; Mangrola, D.; Mathur, P.P. Potential biological role of poly (ADP-ribose) polymerase (PARP) in male gametes. Reprod. Biol. Endocrinol. 2009, 7, 143. [Google Scholar] [CrossRef] [Green Version]
- Meyer-Ficca, M.L.; Lonchar, J.D.; Ihara, M.; Meistrich, M.L.; Austin, C.A.; Meyer, R.G. Poly(ADP-Ribose) Polymerases PARP1 and PARP2 Modulate Topoisomerase II Beta (TOP2B) Function during Chromatin Condensation in Mouse Spermiogenesis. Biol. Reprod. 2011, 84, 900–909. [Google Scholar] [CrossRef]
- Leutert, M.; Menzel, S.; Braren, R.; Rissiek, B.; Hopp, A.K.; Nowak, K.; Bisceglie, L.; Gehrig, P.; Li, H.; Zolkiewska, A.; et al. Proteomic Characterization of the Heart and Skeletal Muscle Reveals Widespread Arginine ADP-Ribosylation by the ARTC1 Ectoenzyme. Cell Rep. 2018, 24, 1916–1929.e5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menzel, S.; Rissiek, B.; Bannas, P.; Jakoby, T.; Miksiewicz, M.; Schwarz, N.; Nissen, M.; Haag, F.; Tholey, A.; Koch-Nolte, F. Nucleotide-Induced Membrane-Proximal Proteolysis Controls the Substrate Specificity of T Cell Ecto-ADP-Ribosyltransferase ARTC2.2. J. Immunol. 2015, 195, 2057–2066. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tan, L.; Song, X.; Sun, X.; Wang, N.; Sun, Z. ART3 regulates triple-negative breast cancer cell function via activation of Akt and ERK pathways. Oncotarget 2016, 7, 46589–46602. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, J.; Li, Y.; Wang, Y.; Zhang, H.; Ge, S.; Fan, X. Targeted silencing of the ADP-ribosyltransferase 3 gene inhibits the migration ability of melanoma cells. Oncol. Lett. 2018, 15, 7053–7059. [Google Scholar] [CrossRef]
- Mistry, B.V.; Zhao, Y.; Chang, T.C.; Hiroshi, Y.; Mitsuru, C.; Jon, O.; Francisco, D.; Liu, W.S.; John, C.A. Differential Expression of PRAMEL1, a Cancer/Testis Antigen, during Spermatogenesis in the Mouse. PLoS ONE 2013, 8, e60611. [Google Scholar] [CrossRef] [Green Version]
- Tebbs, R.S.; Thompson, L.H.; Cleaver, J.E. Rescue of Xrcc1 knockout mouse embryo lethality by transgene-complementation. DNA Repair. 2003, 2, 1405–1417. [Google Scholar] [CrossRef]
- Van der Weyden, L.; Arends, M.J.; Chausiaux, O.E.; Ellis, P.J.; Lange, U.C.; Surani, M.A.; Affara, N.; Murakami, Y.; Adams, D.J.; Bradley, A. Loss of TSLC1 causes male infertility due to a defect at the spermatid stage of spermatogenesis. Mol. Cell Biol. 2006, 26, 3595–3609. [Google Scholar] [CrossRef] [Green Version]
- Ernst, J.; Bar-Joseph, Z. STEM: A tool for the analysis of short time series gene expression data. BMC Bioinform. 2006, 7, 191. [Google Scholar] [CrossRef] [Green Version]
- Ernst, J.; Nau, G.J.; Bar-Joseph, Z. Clustering short time series gene expression data. Bioinformatics 2005, 21 (Suppl. 1), i159–i168. [Google Scholar] [CrossRef] [Green Version]
- Stark, C.; Breitkreutz, B.J.; Reguly, T.; Boucher, L.; Breitkreutz, A.; Tyers, M. BioGRID: A general repository for interaction datasets. Nucleic Acids Res. 2006, 34, D535–D539. [Google Scholar] [CrossRef] [Green Version]
- Bandettini, W.P.; Kellman, P.; Mancini, C.; Booker, O.J.; Vasu, S.; Leung, S.W.; Wilson, J.R.; Shanbhag, S.M.; Chen, M.Y.; Arai, A.E. MultiContrast Delayed Enhancement (MCODE) improves detection of subendocardial myocardial infarction by late gadolinium enhancement cardiovascular magnetic resonance: A clinical validation study. J. Cardiovasc. Magn. Reson. 2012, 14, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Samples | R1 | R2 | R3 | E1 | E2 | E3 | M1 | M2 | M3 |
---|---|---|---|---|---|---|---|---|---|
Raw reads 1 (million) | 76.983 | 94.627 | 78.303 | 78.018 | 77.196 | 78.670 | 77.515 | 76.957 | 88.457 |
Clean reads 2 (million) | 72.947 | 72.556 | 71.185 | 73.697 | 71.376 | 71.570 | 66.614 | 71.147 | 79.564 |
Clean reads rate 3 (%) | 94.8 | 76.7 | 90.9 | 94.5 | 92.5 | 91.0 | 85.9 | 92.5 | 90.0 |
Clean Q30 bases rate 4 (%) | 94.0 | 93.1 | 93.2 | 94.3 | 94.0 | 93.8 | 91.0 | 92.6 | 92.6 |
Mapped reads 5 (million) | 64.529 | 63.465 | 61.395 | 65.593 | 63.068 | 61.930 | 59.316 | 63.354 | 71.666 |
Mapping rate 6 (%) | 88.4 | 87.5 | 86.2 | 89.0 | 88.4 | 86.5 | 89.0 | 89.0 | 90.0 |
Gene Name | Primer Sequence (5′-3′) | Size (bp) |
---|---|---|
ACTIN | Forward Primer: ATCCTGCGGCATTCACGAA | 150 |
Reverse Primer: TGCCAGGGCAGTGATCTCTT | ||
MIGA2 | Forward Primer: CACGTTAGCCCTGTCCTAGC | 120 |
Reverse Primer: TCGAACATGTCGGTCAGGTA | ||
CREM | Forward Primer: AGGAAGAGGGAACACCACCT | 104 |
Reverse Primer: GATTGTTCCACCTTGGGCTA | ||
YBX2 | Forward Primer: AGGAATGACACCAAGGAGGA | 111 |
Reverse Primer: GACATCGAACTCCACGGTCT | ||
SDHA | Forward Primer: TAAACCAAATGCTGGGGAAG | 109 |
Reverse Primer: CTGCATCGACTTCTGCATGT | ||
ART3 | Forward Primer: CCGGATGAAAAACCTGAAGA | 116 |
Reverse Primer: AGGAGCATTTTGCCAGAAGA | ||
DNAL1 | Forward Primer: TCAAAGAAGCCCTAGCCAGA | 125 |
Reverse Primer: AGAAAGCGTGGACAAGGATG | ||
PRKAR1A | Forward Primer: CGGTTTCCTTTATTGCTGGA | 110 |
Reverse Primer: TGCCCATTCATTGTTGACAT | ||
TEKT2 | Forward Primer: ACGAGACCAACAACCAGACC | 112 |
Reverse Primer: TCCGTCAGACACTTGTCCAG | ||
OAZ3 | Forward Primer: AGAAGATGCTGCCTTGCTGT | 98 |
Reverse Primer: AGGGACTCAGGAGCACTGAA | ||
HIP1 | Forward Primer: GATCGAGGACACAGACAGCA | 128 |
Reverse Primer: CCAGTTTCTGACGCTCCTTC | ||
LMTK2 | Forward Primer: CTGCTGGCTGTCACCAGATA | 107 |
Reverse Primer: GCTGCTCAAAGTCCACTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.; Duan, C.; Li, R.; Wang, D. Insights into the Mechanism of Bovine Spermiogenesis Based on Comparative Transcriptomic Studies. Animals 2021, 11, 80. https://doi.org/10.3390/ani11010080
Li X, Duan C, Li R, Wang D. Insights into the Mechanism of Bovine Spermiogenesis Based on Comparative Transcriptomic Studies. Animals. 2021; 11(1):80. https://doi.org/10.3390/ani11010080
Chicago/Turabian StyleLi, Xin, Chenying Duan, Ruyi Li, and Dong Wang. 2021. "Insights into the Mechanism of Bovine Spermiogenesis Based on Comparative Transcriptomic Studies" Animals 11, no. 1: 80. https://doi.org/10.3390/ani11010080