The Effect of Stocking Density and Carbon Sources on the Oxidative Status, and Nonspecific Immunity of Nile tilapia (Oreochromis niloticus) Reared under Biofloc Conditions
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Biofloc Initiation
2.3. Hematology and Non-Specific Immune Responses
2.3.1. Hematological Analysis of Whole Blood
2.3.2. Immunological and Biochemical Analysis of Serum
Assay of Serum Superoxide Dismutase (SOD) Activity, Glutathione Reductase (GR), Catalase (CAT) Activity and Nitric Oxide (NO) Activity
2.4. Gene Expression Analysis
2.4.1. Isolation of RNA and cDNA Synthesis
2.4.2. Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
2.5. Statistical Analysis
3. Results
3.1. Hematology and Immune Response of Fish
3.1.1. Fish Hematological Parameters
3.1.2. Serum Biochemical Analyses
3.1.3. Antioxidant in Serum
3.2. Gene Expression
3.2.1. Low Stocking Density (140 Fish in m−3)
3.2.2. High Stocking Density (280 Fish in m−3)
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bahramsoltani, R.; Rostamiasrabadi, P.; Shahpiri, Z.; Marques, A.M.; Rahimi, R.; Farzaei, M.H. Aloysia citrodora paláu (lemon verbena): A review of phytochemistry and pharmacology. J. Ethnopharmacol. 2018, 222, 34–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karimanzira, D.; Keesman, K.; Kloas, W.; Baganz, D.; Rauschenbach, T. Efficient and economical way of operating a recirculation aquaculture system in an aquaponics farm. Aquac. Econ. Manag. 2017, 21, 470–486. [Google Scholar] [CrossRef] [Scilit]
- Bossier, P.; Ekasari, J. Biofloc technology application in aquaculture to support sustainable development goals. Microb. Biotechnol. 2017, 10, 1012–1016. [Google Scholar] [PubMed]
- Wei, G.; Shan, D.; Li, G.; Li, X.; Tian, R.; He, J.; Shao, Z. Prokaryotic communities vary with floc size in a biofloc-technology based aquaculture system. Aquaculture 2020, 529, 735632. [Google Scholar] [CrossRef] [Scilit]
- Legarda, E.C.; Poli, M.A.; Martins, M.A.; Pereira, S.A.; Martins, M.L.; Machado, C.; de Lorenzo, M.A.; do Nascimento Vieira, F. Integrated recirculating aquaculture system for mullet and shrimp using biofloc technology. Aquaculture 2019, 512, 734308. [Google Scholar] [CrossRef] [Scilit]
- El-Sayed, A.-F.M. Tilapia Culture; Academic Press: Dordrecht, The Netherlands, 2019. [Google Scholar]
- Caldini, N.N.; Cavalcante, D.d.H.; Rocha Filho, P.R.N. Feeding nile tilapia with artificial diets and dried bioflocs biomass. Acta Scientiarum. Anim. Sci. 2015, 37, 335–341. [Google Scholar] [CrossRef] [Scilit]
- De Sousa, A.A.; Pinho, S.M.; Rombenso, A.N.; de Mello, G.L.; Emerenciano, M.G.C. Pizzeria by-product: A complementary feed source for Nile tilapia (Oreochromis niloticus) raised in biofloc technology? Aquaculture 2019, 501, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Khanjani, M.H.; Alizadeh, M.; Sharifinia, M. Rearing of the pacific white shrimp, Litopenaeus vannamei in a biofloc system: The effects of different food sources and salinity levels. Aquac. Nutr. 2020, 26, 328–337. [Google Scholar]
- Crab, R.; Defoirdt, T.; Bossier, P.; Verstraete, W. Biofloc technology in aquaculture: Beneficial effects and future challenges. Aquaculture 2012, 356–357, 351–356. [Google Scholar] [CrossRef] [Scilit]
- Deng, M.; Chen, J.; Gou, J.; Hou, J.; Li, D.; He, X. The effect of different carbon sources on water quality, microbial community and structure of biofloc systems. Aquaculture 2018, 482, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Mirzakhani, N.; Ebrahimi, E.; Jalali, S.A.H.; Ekasari, J. Growth performance, intestinal morphology and nonspecific immunity response of Nile tilapia (Oreochromis niloticus) fry cultured in biofloc systems with different carbon sources and input c:N ratios. Aquaculture 2019, 512, 734235. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Liu, G.; Li, C.; Deng, Y.; Tadda, M.A.; Lan, L.; Zhu, S.; Liu, D. Effects of different solid carbon sources on water quality, biofloc quality and gut microbiota of Nile tilapia (Oreochromis niloticus) larvae. Aquaculture 2018, 495, 919–931. [Google Scholar] [CrossRef] [Scilit]
- Zaki, M.A.A.; Alabssawy, A.N.; Nour, A.E.A.M.; El Basuini, M.F.; Dawood, M.A.O.; Alkahtani, S.; Abdel-Daim, M.M. The impact of stocking density and dietary carbon sources on the growth, oxidative status and stress markers of Nile tilapia (Oreochromis niloticus) reared under biofloc conditions. Aquac. Rep. 2020, 16, 100282. [Google Scholar] [CrossRef] [Scilit]
- Dawood, M.A.O.; Metwally, A.E.S.; El-Sharawy, M.E.; Atta, A.M.; Elbialy, Z.I.; Abdel-Latif, H.M.R.; Paray, B.A. The role of β-glucan in the growth, intestinal morphometry, and immune-related gene and heat shock protein expressions of Nile tilapia (Oreochromis niloticus) under different stocking densities. Aquaculture 2020, 523, 735205. [Google Scholar] [CrossRef] [Scilit]
- Ran, C.; Huang, L.; Hu, J.; Tacon, P.; He, S.; Li, Z.; Wang, Y.; Liu, Z.; Xu, L.; Yang, Y.; et al. Effects of dietary live and heat-inactive baker’s yeast on growth, gut health, and disease resistance of Nile tilapia under high rearing density. Fish Shellfish Immunol. 2016, 56, 263–271. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Avnimelech, Y. Carbon/nitrogen ratio as a control element in aquaculture systems. Aquaculture 1999, 176, 227–235. [Google Scholar] [CrossRef] [Scilit]
- Avnimelech, Y.; Kochba, M. Evaluation of nitrogen uptake and excretion by tilapia in bio floc tanks, using 15n tracing. Aquaculture 2009, 287, 163–168. [Google Scholar] [CrossRef] [Scilit]
- Val, A.L.; de Menezes, G.C.; Wood, C.M. Red blood cell adrenergic responses in amazonian teleosts. J. Fish Biol. 1998, 52, 83–93. [Google Scholar] [CrossRef]
- Blaxhall, P.C.; Daisley, K.W. Routine haematological methods for use with fish blood. J. Fish Biol. 1973, 5, 771–781. [Google Scholar] [CrossRef] [Scilit]
- Maxine, M.; Benjamine, B. Outline of Veterinary Clinical Pathology; Colorado State University: New Delhi, India, 1985. [Google Scholar]
- Van Kampen, E.J.; Zijlstra, W.G. Standardization of hemoglobinometry ii. The hemiglobincyanide method. Clin. Chim. Acta 1961, 6, 538–544. [Google Scholar] [CrossRef] [Scilit]
- Lucky, Z. Methods for the Diagnosis of Fish Diseases; Amerind Publishing Co. PV T. Ltd.: New Delhi, India, 1977. [Google Scholar]
- Schalm, O. Hematology of Birds. Schalm’s Veterinary Hematology, 4th ed.; Jain, N.C., Ed.; Lea & Febiger: Philadelphia, PA, USA, 1986; p. 257. [Google Scholar]
- Gornall, A.G.; Bardawill, C.J.; David, M.M. Determination of serum proteins by means of the biuret reaction. J. Biol. Chem. 1949, 177, 751–766. [Google Scholar] [CrossRef] [Scilit]
- Dumas, B.T.; Biggs, H.G. Standard Methods of Clinical Chemistry; Academic Press: New York, NY, USA, 1972. [Google Scholar]
- Trinder, P. Determination of blood glucose using 4-amino phenazone as oxygen acceptor. J. Clin. Pathol. 1969, 22, 246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiu, S.K.; Collier, C.P.; Clark, A.F.; Wynn-Edwards, K.E. Salivary cortisol on roche elecsys immunoassay system: Pilot biological variation studies11abbreviations: Cv = coefficient of variation; biological variation statistics (table 1). Clin. Biochem. 2003, 36, 211–214. [Google Scholar] [CrossRef] [Scilit]
- Montgomery, H.; Dymock, J. Determination of nitric oxide. Analyst 1961, 86, 41–43. [Google Scholar]
- Nishikimi, M.; Appaji Rao, N.; Yagi, K. The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochem. Biophys. Res. Commun. 1972, 46, 849–854. [Google Scholar] [CrossRef] [Scilit]
- Goldberg, D.; Spooner, R.J. Glutathione Reductase Irl Methods of Erizutcitic Atciss, 3rd ed.; DOL: Washington, DC, USA, 1983; Volume 3, pp. 258–265.
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar] [PubMed]
- Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2ˆ(-delta delta ct) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
- Diaz, R.J.; Breitburg, D.L. Chapter 1 the hypoxic environment. In Fish Physiology; Richards, J.G., Farrell, A.P., Brauner, C.J., Eds.; Academic Press: Dordrecht, The Netherlands, 2009; Volume 27, pp. 1–23. [Google Scholar]
- Nakharuthai, C.; Areechon, N.; Srisapoome, P. Molecular Characterization and Expression Analysis of a cDNA Encoding CC Chemokine Gene in Nile tilapia (Oreochromis niloticus). In Proceedings of the 49th Kasetsart University Annual Conference, Bangkok, Thailand, 1–4 February 2011; Subject: Fisheries. Kasetsart University: Bangkok, Thailand, 2011; Volume 3, pp. 189–199. [Google Scholar]
- Abo-Al-Ela, H.G.; El-Nahas, A.F.; Mahmoud, S.; Ibrahim, E.M. The extent to which immunity, apoptosis and detoxification gene expression interact with 17 alpha-methyltestosterone. Fish Shellfish Immunol. 2017, 60, 289–298. [Google Scholar] [CrossRef] [Scilit]
- Abo-Al-Ela, H.G.; El-Nahas, A.F.; Mahmoud, S.; Ibrahim, E.M. Vitamin c modulates the immunotoxic effect of 17α-methyltestosterone in Nile tilapia. Biochemistry 2017, 56, 2042–2050. [Google Scholar] [CrossRef] [Scilit]
- Pang, J.-C.; Gao, F.-Y.; Lu, M.-X.; Ye, X.; Zhu, H.-P.; Ke, X.-L. Major histocompatibility complex class iia and iib genes of Nile tilapia Oreochromis niloticus: Genomic structure, molecular polymorphism and expression patterns. Fish Shellfish Immunol. 2013, 34, 486–496. [Google Scholar] [CrossRef] [Scilit]
- Ebeling, J.M.; Timmons, M.B.; Bisogni, J.J. Engineering analysis of the stoichiometry of photoautotrophic, autotrophic, and heterotrophic removal of ammonia–nitrogen in aquaculture systems. Aquaculture 2006, 257, 346–358. [Google Scholar] [CrossRef] [Scilit]
- Dawood, M.A.O. Nutritional immunity of fish intestines: Important insights for sustainable aquaculture. Rev. Aquac. 2020, 13, 642–663. [Google Scholar] [CrossRef] [Scilit]
- Crab, R.; Chielens, B.; Wille, M.; Bossier, P.; Verstraete, W. The effect of different carbon sources on the nutritional value of bioflocs, a feed for Macrobrachium rosenbergii postlarvae. Aquac. Res. 2010, 41, 559–567. [Google Scholar] [CrossRef] [Scilit]
- Bakhshi, F.; H Najdegerami, E.; Manaffar, R.; Tokmechi, A.; Rahmani Farah, K.; Shalizar Jalali, A. Growth performance, haematology, antioxidant status, immune response and histology of common carp (Cyprinus carpio L.) fed biofloc grown on different carbon sources. Aquac. Res. 2018, 49, 393–403. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, H.I.; Verma, A.K.; Babitha Rani, A.M.; Rathore, G.; Saharan, N.; Gora, A.H. Growth, non-specific immunity and disease resistance of Labeo rohita against Aeromonas hydrophila in biofloc systems using different carbon sources. Aquaculture 2016, 457, 61–67. [Google Scholar] [CrossRef] [Scilit]
- Ekasari, J.; Angela, D.; Waluyo, S.H.; Bachtiar, T.; Surawidjaja, E.H.; Bossier, P.; De Schryver, P. The size of biofloc determines the nutritional composition and the nitrogen recovery by aquaculture animals. Aquaculture 2014, 426–427, 105–111. [Google Scholar] [CrossRef] [Scilit]
- Gültepe, N.; Bilen, S.; Yılmaz, S.; Güroy, D.; Aydın, S. Effects of herbs and spice on health status of tilapia (Oreochromis mossambicus) challenged with Streptococcus iniae. Acta Vet. Brno 2014, 83, 125–131. [Google Scholar] [CrossRef] [Scilit]
- Dawood, M.A.O.; Abo-Al-Ela, H.G.; Hasan, M.T. Modulation of transcriptomic profile in aquatic animals: Probiotics, prebiotics and synbiotics scenarios. Fish Shellfish Immunol. 2020, 97, 268–282. [Google Scholar] [CrossRef] [Scilit]
- Azim, M.E.; Little, D.C. The biofloc technology (bft) in indoor tanks: Water quality, biofloc composition, and growth and welfare of Nile tilapia (Oreochromis niloticus). Aquaculture 2008, 283, 29–35. [Google Scholar] [CrossRef] [Scilit]
- Long, L.; Yang, J.; Li, Y.; Guan, C.; Wu, F. Effect of biofloc technology on growth, digestive enzyme activity, hematology, and immune response of genetically improved farmed tilapia (Oreochromis niloticus). Aquaculture 2015, 448, 135–141. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.-J.; Pan, L.-Q. Evaluation of dietary protein level on selected parameters of immune and antioxidant systems, and growth performance of juvenile Litopenaeus vannamei reared in zero-water exchange biofloc-based culture tanks. Aquaculture 2014, 426–427, 181–188. [Google Scholar] [CrossRef] [Scilit]
- Barreto, R.E.; Volpato, G.L. Stress responses of the fish nile tilapia subjected to electroshock and social stressors. Braz. J. Med. Biol. Res. 2006, 39, 1605–1612. [Google Scholar] [CrossRef] [Scilit]
- El-Khaldi, A.T.F. Effect of different stress factors on some physiological parameters of Nile tilapia (Oreochromis niloticus). Saudi J. Biol. Sci. 2010, 17, 241–246. [Google Scholar] [CrossRef] [Scilit]
- Haridas, H.; Verma, A.K.; Rathore, G.; Prakash, C.; Sawant, P.B.; Babitha Rani, A.M. Enhanced growth and immuno-physiological response of genetically improved farmed tilapia in indoor biofloc units at different stocking densities. Aquac. Res. 2017, 48, 4346–4355. [Google Scholar] [CrossRef] [Scilit]
- Saeij, J.P.J.; Stet, R.J.M.; Groeneveld, A.; Verburg-van Kemenade, L.B.M.; van Muiswinkel, W.B.; Wiegertjes, G.F. Molecular and functional characterization of a fish inducible-type nitric oxide synthase. Immunogenetics 2000, 51, 339–346. [Google Scholar] [CrossRef] [Scilit]
- Severin, V.I.C.; Soliman, H.; El-Matbouli, M. Expression of immune-regulatory genes, arginase-2 and inducible nitric oxide synthase (inos), in two rainbow trout (Oncorhynchus mykiss) strains following exposure to Myxobolus cerebralis. Parasitol. Res. 2009, 106, 325. [Google Scholar] [CrossRef] [Scilit]
- Shiloh, M.U.; Nathan, C.F. Reactive nitrogen intermediates and the pathogenesis of salmonella and mycobacteria. Curr. Opin. Microbiol. 2000, 3, 35–42. [Google Scholar] [CrossRef] [Scilit]
- Ju, Z.Y.; Forster, I.; Conquest, L.; Dominy, W.; Kuo, W.C.; David Horgen, F. Determination of microbial community structures of shrimp floc cultures by biomarkers and analysis of floc amino acid profiles. Aquac. Res. 2008, 39, 118–133. [Google Scholar] [CrossRef] [Scilit]
- Emerenciano, M.; Cuzon, G.; Paredes, A.; Gaxiola, G. Evaluation of biofloc technology in pink shrimp farfantepenaeus duorarum culture: Growth performance, water quality, microorganisms profile and proximate analysis of biofloc. Aquac. Int. 2013, 21, 1381–1394. [Google Scholar] [CrossRef] [Scilit]
- El-Hawarry, W.N.; Mohamed, R.A.; Ibrahim, S.A. Collaborating effects of rearing density and oregano oil supplementation on growth, behavioral and stress response of Nile tilapia (Oreochromis niloticus). Egypt. J. Aquat. Res. 2018, 44, 173–178. [Google Scholar] [CrossRef] [Scilit]
- Liu, C.-H.; Chen, J.-C. Effect of ammonia on the immune response of white shrimp Litopenaeus vannamei and its susceptibility to Vibrio alginolyticus. Fish Shellfish Immunol. 2004, 16, 321–334. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.-J.; Pan, L.-Q. Enhancement of immune response and antioxidant status of Litopenaeus vannamei juvenile in biofloc-based culture tanks manipulating high c/n ratio of feed input. Aquaculture 2013, 412–413, 117–124. [Google Scholar] [CrossRef] [Scilit]
- Tao, Y.; Pan, L.; Zhang, H.; Tian, S. Assessment of the toxicity of organochlorine pesticide endosulfan in clams Ruditapes philippinarum. Ecotoxicol. Environ. Saf. 2013, 93, 22–30. [Google Scholar] [CrossRef] [Scilit]
- Luo, G.; Li, L.; Liu, Q.; Xu, G.; Tan, H. Effect of dissolved oxygen on heterotrophic denitrification using poly(Butylene succinate) as the carbon source and biofilm carrier. Bioresour. Technol. 2014, 171, 152–158. [Google Scholar] [CrossRef] [Scilit]
- Gao, A.; Li, L.; Yan, F.; Lei, Y.; Chen, J.; Wu, L.; Ye, J. Nile tilapia cxcr4, the receptor of chemokine cxcl12, is involved in host defense against bacterial infection and chemotactic activity. Dev. Comp. Immunol. 2021, 114, 103836. [Google Scholar] [CrossRef] [Scilit]
- El-Leithy, A.A.A.; Hemeda, S.A.; El Naby, W.S.H.A.; El Nahas, A.F.; Hassan, S.A.H.; Awad, S.T.; El-Deeb, S.I.; Helmy, Z.A. Optimum salinity for Nile tilapia (Oreochromis niloticus) growth and mrna transcripts of ion-regulation, inflammatory, stress- and immune-related genes. Fish Physiol. Biochem. 2019, 45, 1217–1232. [Google Scholar] [CrossRef] [Scilit]
- Qian, T.; Wang, K.; Mu, Y.; Ao, J.; Chen, X. Molecular characterization and expression analysis of tlr 7 and tlr 8 homologs in large yellow croaker (Pseudosciaena crocea). Fish Shellfish Immunol. 2013, 35, 671–679. [Google Scholar] [CrossRef] [Scilit]
- Ming, C.; Rui, W.; Liping, L.; Huang, T.; Weiyi, H.; Jian, L.; Chao, L.; Aiying, L.; Honglin, L.; Wanwen, L. Sequence and evolution differences of Oreochromis niloticus cxc contribute to the diversification of cellular immune responses in tilapias with treatment of Streptococcus iniae. J. Anim. Vet. Adv. 2013, 12, 303–311. [Google Scholar]
- Yu, Z.; Li, L.; Zhu, R.; Li, M.; Duan, J.; Wang, J.-Y.; Liu, Y.-H.; Wu, L.-F. Monitoring of growth, digestive enzyme activity, immune response and water quality parameters of golden crucian carp (Carassius auratus) in zero-water exchange tanks of biofloc systems. Aquac. Rep. 2020, 16, 100283. [Google Scholar] [CrossRef] [Scilit]
- Menaga, M.; Felix, S.; Charulatha, M.; Gopalakannan, A.; Panigrahi, A. Effect of in-situ and ex-situ biofloc on immune response of genetically improved farmed tilapia. Fish Shellfish Immunol. 2019, 92, 698–705. [Google Scholar] [CrossRef] [Scilit]
- Duan, F.F.; Liu, J.H.; March, J.C. Engineered commensal bacteria reprogram intestinal cells into glucose-responsive insulin-secreting cells for the treatment of diabetes. Diabetes 2015, 64, 1794–1803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biller, J.D.; Takahashi, L.S. Oxidative stress and fish immune system: Phagocytosis and leukocyte respiratory burst activity. An. Acad. Bras. Cienc. 2018, 90, 3403–3414. [Google Scholar] [PubMed]


| Genes | Primer Sequence (5′–3′) | Annealing Temp. (°C) | Amplicon (Size pb) | Acc. Number | Reference |
|---|---|---|---|---|---|
| IL-8 | F: GCACTGCCGCTGCATTAAG | 60 °C | 128 or 85 | DQ061114.1 | [34] |
| R: GCAGTGGGAGTTGGGAAGAA | |||||
| CC-chemokine | F: ACAGAGCCGATCTTGGGTTACTTG | 60 °C | 228 | FF279635.1 | [35] |
| R: TGAAGGAGAGGCGGTGGATGTTAT | |||||
| CXC-chemokine | F: CTATCCATGGAGCCTCAGGT | 60 °C | 146 | XM_00345220 | [36] |
| R: CTTCTTGAGCGTGGCAATAA | |||||
| TLR-7 | F: TCAGCAGGGTGAGAGCATAC | 63 °C | 143 | XM_00547 7981.1 | [37] |
| R: ACATATCCCAGCCGTAGAGG | |||||
| β-actin | F: CGAAAGCATTTGCCAAGAAT | 60 °C | 136 | XM_003455949.2 | [38] |
| R: GGCATCGTTTATGGTCGG | |||||
| Stocking Density | Carbon Source | RBCs (×106/μL) | Hemoglobin (mg/dL) | PCV (%) | WBCs (μL−1) | Monocyte (%) | Lympho-Cyte (%) | Eosinophil (%) |
|---|---|---|---|---|---|---|---|---|
| Low (140 fish/m3) | Control | 2.74 ± 0.38 c | 8.76 ± 1.78 c | 27.8 ± 2.68 c | 126,520 ± 18,122.14 a | 24.00 ± 7.0 b | 5.0 ± 2.24 b | 1.6 ± 1.67 |
| Glycerol | 4.19 ± 0.32 a | 12.04 ± 0.81 a | 46.4 ± 6.80 a | 51,200 ± 15,546.70 e | 33.4 ± 3.65 a | 2.2 ± 0.84 bc | 1.0 + 0.71 | |
| Molasses | 4.41 ± 0.41 a | 12.00 ± 0.79 a | 43.4 ± 4.04 ab | 78,200 ± 9038.81 cd | 34.4 ± 4.98 a | 3.0 ± 1.41 bc | 0.4 ± 0.55 | |
| Starch | 4.03 ± 0.37 a | 12.10 ± 0.8 a | 40.0 ± 4.95 b | 96,840 ± 15,891.13 bc | 34.0 ± 3.81 a | 2.0 ± 1.22 c | 1.0 ± 0.71 | |
| High (280 fish/m3) | Control | 2.50 ± 0.32 c | 8.78 ± 0.95 c | 25.8 ± 3.63 c | 107,200 ± 21,545.30 ab | 22.8 ± 1.92 b | 9.4 ± 4.39 a | 1.0 ± 0.71 |
| Glycerol | 3.42 ± 0.21 b | 10.42 ± 0.56 b | 41.6 ± 2.79 ab | 74,200 ± 13,007.69 cde | 35.4 ± 4.04 a | 2.8 ± 1.10 bc | 1.4 ± 0.89 | |
| Molasses | 4.46 ± 0.32 a | 12.66 ± 0.8 a | 43.8 ± 4.21 b | 67,580 ± 4934.78 e | 35.2 ± 3.11 a | 2.6 ± 0.89 bc | 1.2 ± 0.84 | |
| Starch | 3.53 ± 0.37 b | 11.02 ± 0.56 b | 38.8 ± 2.39 ab | 95,000 ± 33,600.60 bc | 33.2 ± 6.57 a | 3.0 ± 1.41 bc | 0.6 ± 0.55 |
| Stocking Density | Carbon Source | Protein (g/dL) | Albumin (g/dL) | Globulin (g/dL) | A/G Ratio | Glucose (mg/dL) | Cortisol (ng/dL) |
|---|---|---|---|---|---|---|---|
| Low (140 fish/m3) | Control | 4.16 ± 0.47 cd | 1.37 ± 0.30 bc | 2.79 ± 0.30 cd | 0.50 ± 0.10 | 144.4 ± 19.68 a | 41.00 ± 5.57 a |
| Glycerol | 4.94 ± 0.59 b | 1.41 ± 0.10 bc | 3.53 ± 0.58 ab | 0.41 ± 0.07 | 75.0 ± 17.32 cd | 6.00 ± 0.85 e | |
| Molasses | 4.97 ± 0.27 b | 1.39 ± 0.03 bc | 3.59 + 0.26 ab | 0.39 ± 0.03 | 73.6 ± 7.13 cd | 12.04 ± 2.74 de | |
| Starch | 4.87 ± 0.47 bc | 1.56 ± 0.15 ab | 3.31 ± 0.42 abcd | 0.478 ± 0.07 | 94.6 ± 14.31 bc | 27.16 ± 3.82 c | |
| High (280 fish/m3) | Control | 3.82 ± 0.74 d | 1.19 ± 0.30 c | 2.63 ± 0.78 d | 0.48 ± 0.18 | 139.8 ± 13.97 a | 37.6 ± 10.53 a |
| Glycerol | 4.36 ± 0.32 bcd | 1.38 ± 0.14 bc | 3.12 ± 0.26 bcd | 0.4 ± 0.05 | 67.20 ± 8.20 d | 8.36 ± 4.58 e | |
| Molasses | 4.91 ± 0.81 bc | 1.47 ± 0.07 bc | 3.45 ± 0.77 abc | 0.44 ± 0.07 | 78.0 ± 10.68 bcd | 17.52 ± 2.05 d | |
| Starch | 5.73 ± 0.42 a | 1.79 ± 0.28 a | 3.94 ± 0.25 a | 0.45 ± 0.07 | 97.8 ± 27.46 b | 32.40 ± 6.39 bc |
| Stocking Density | Carbon Source | Superoxide Dismutase (U/L) | Nitric Oxide (U/L) | Glutathione Reductase (U/L) | Catalase (U/L) |
|---|---|---|---|---|---|
| Low (140 fish/m3) | Control | 33.8 ± 7.26 cd | 23.52 ± 6.36 a | 27.2 ± 2.77 cd | 27.6 ± 3.44 de |
| Glycerol | 62.4 ± 9.79 a | 7.72 ± 1.29 d | 43.4 ± 7.40 a | 44.6 ± 4.28 a | |
| Molasses | 34.8 ± 7.79 cd | 15.24 ± 2.31 bc | 31.4 ± 6.80 bcd | 31.4 ± 2.41 cde | |
| Starch | 31.6 ± 5.77 cd | 17.12 ± 4.16 b | 33.2 ± 4.66 bc | 33.4 ± 3.91 bcd | |
| High (280 fish/m3) | Control | 26.0 ± 3.39 d | 24.40 ± 7.84 a | 24.2 ± 6.61 d | 19.4 ± 5.22 f |
| Glycerol | 48.4 ± 10.11 b | 10.28 ± 1.64 cd | 36.2 ± 5.40 b | 38.2 ± 3.56 b | |
| Molasses | 39.8 ± 3.70 bc | 16.06 ± 2.58 b | 34.8 ± 4.44 bc | 35.2 ± 4.02 bc | |
| Starch | 33.6 ± 5.13 cd | 17.52 ± 2.23 b | 31.0 ± 3.81 bcd | 26.6 ± 7.20 e |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shourbela, R.M.; Khatab, S.A.; Hassan, M.M.; Van Doan, H.; Dawood, M.A.O. The Effect of Stocking Density and Carbon Sources on the Oxidative Status, and Nonspecific Immunity of Nile tilapia (Oreochromis niloticus) Reared under Biofloc Conditions. Animals 2021, 11, 184. https://doi.org/10.3390/ani11010184
Shourbela RM, Khatab SA, Hassan MM, Van Doan H, Dawood MAO. The Effect of Stocking Density and Carbon Sources on the Oxidative Status, and Nonspecific Immunity of Nile tilapia (Oreochromis niloticus) Reared under Biofloc Conditions. Animals. 2021; 11(1):184. https://doi.org/10.3390/ani11010184
Chicago/Turabian StyleShourbela, Ramy M., Shymaa A. Khatab, Mohamed M. Hassan, Hien Van Doan, and Mahmoud A. O. Dawood. 2021. "The Effect of Stocking Density and Carbon Sources on the Oxidative Status, and Nonspecific Immunity of Nile tilapia (Oreochromis niloticus) Reared under Biofloc Conditions" Animals 11, no. 1: 184. https://doi.org/10.3390/ani11010184
APA StyleShourbela, R. M., Khatab, S. A., Hassan, M. M., Van Doan, H., & Dawood, M. A. O. (2021). The Effect of Stocking Density and Carbon Sources on the Oxidative Status, and Nonspecific Immunity of Nile tilapia (Oreochromis niloticus) Reared under Biofloc Conditions. Animals, 11(1), 184. https://doi.org/10.3390/ani11010184

