MiR-143 Regulates Milk Fat Synthesis by Targeting Smad3 in Bovine Mammary Epithelial Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Transfection
2.2. Gene Expression Assay
2.3. Oil Red O Staining and Triglyceride Assay
2.4. Luciferase Reporter Assay
2.5. Western Blot Assay
2.6. Statistical Analysis
3. Results
3.1. MiR-143 Promotes Triglyceride and Lipid Droplet Accumulation in BMECs
3.2. MiR-143 Regulates Lipid Metabolism-Related Genes in BMECs
3.3. Smad3 is a Target Gene of miR-143
3.4. siRNA-Smad3 Promotes Triglyceride Accumulation
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Jensen, R.G.; Ferris, A.M.; Lammi-Keefe, C.J. The Composition of Milk Fat1. J. Dairy Sci. 1991, 74, 3228–3243. [Google Scholar] [CrossRef]
- Li, D.; Xie, X.; Wang, J.; Bian, Y.; Li, Q.; Gao, X.; Wang, C. MiR-486 regulates lactation and targets the PTEN gene in cow mammary glands. PLoS ONE 2015, 10, e118284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gengler, N.; Soyeurt, H.; Dehareng, F.; Bastin, C.; Colinet, F.; Hammami, H.; Vanrobays, M.L.; Lainé, A.; Vanderick, S.; Grelet, C.; et al. Capitalizing on fine milk composition for breeding and management of dairy cows1. J. Dairy Sci. 2016, 99, 4071–4079. [Google Scholar] [CrossRef] [Green Version]
- Hou, X.; Lin, L.; Xing, W.; Yang, Y.; Duan, X.; Li, Q.; Gao, X.; Lin, Y. Spleen tyrosine kinase regulates mammary epithelial cell proliferation in mammary glands of dairy cows. J. Dairy Sci. 2016, 99, 3858–3868. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Guo, W.; Xu, H.; Tang, K.; Zan, L.; Yang, W. Melatonin suppresses milk fat synthesis by inhibiting the mTOR signaling pathway via the MT1 receptor in bovine mammary epithelial cells. J. Pineal Res. 2019, 67, e12593. [Google Scholar] [CrossRef]
- Shen, B.; Zhang, L.; Lian, C.; Lu, C.; Zhang, Y.; Pan, Q.; Yang, R.; Zhao, Z. Deep Sequencing and Screening of Differentially Expressed MicroRNAs Related to Milk Fat Metabolism in Bovine Primary Mammary Epithelial Cells. Int. J. Mol. Sci. 2016, 17, 200. [Google Scholar] [CrossRef] [Green Version]
- Niu, M.; Harvatine, K.J. The effects of feeding a partial mixed ration plus a top-dress before feeding on milk production and the daily rhythm of feed intake and plasma hormones and metabolites in dairy cows. J. Dairy Sci. 2018, 101, 164–171. [Google Scholar] [CrossRef]
- Wang, Y.; Guo, W.; Tang, K.; Wang, Y.; Zan, L.; Yang, W. Bta-miR-34b regulates milk fat biosynthesis by targeting mRNA decapping enzyme 1A (DCP1A) in cultured bovine mammary epithelial cells1. J. Anim. Sci. 2019, 97, 3823–3831. [Google Scholar] [CrossRef]
- Bartel, D.P. MicroRNAs: Target recognition and regulatory functions. Cell 2009, 136, 215–233. [Google Scholar] [CrossRef] [Green Version]
- Lu, T.X.; Rothenberg, M.E. MicroRNA. J. Allergy Clin. Immunol. 2018, 141, 1202–1207. [Google Scholar] [CrossRef] [Green Version]
- Lin, X.; Luo, J.; Zhang, L.; Wang, W.; Gou, D. MiR-103 controls milk fat accumulation in goat (Capra hircus) mammary gland during lactation. PLoS ONE 2013, 8, e79258. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Z.; Luo, J.; Sun, S.; Cao, D.; Shi, H.; Loor, J.J. miR-148a and miR-17-5p synergistically regulate milk TAG synthesis via PPARGC1A and PPARA in goat mammary epithelial cells. RNA Biol. 2017, 14, 326–338. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lian, S.; Guo, J.R.; Nan, X.M.; Ma, L.; Loor, J.J.; Bu, D.P. MicroRNA Bta-miR-181a regulates the biosynthesis of bovine milk fat by targeting ACSL1. J. Dairy Sci. 2016, 99, 3916–3924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGregor, R.A.; Choi, M.S. MicroRNAs in the regulation of adipogenesis and obesity. Curr. Mol. Med. 2011, 11, 304–316. [Google Scholar] [CrossRef]
- Engin, A.B. MicroRNA and Adipogenesis. In Obesity and Lipotoxicity; Engin, A.B., Engin, A., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp. 489–509. [Google Scholar]
- Esau, C.; Kang, X.; Peralta, E.; Hanson, E.; Marcusson, E.G.; Ravichandran, L.V.; Sun, Y.; Koo, S.; Perera, R.J.; Jain, R.; et al. MicroRNA-143 Regulates Adipocyte Differentiation. J. Biol. Chem. 2004, 279, 52361–52365. [Google Scholar] [CrossRef] [Green Version]
- Romao, J.M.; Jin, W.; Dodson, M.V.; Hausman, G.J.; Moore, S.S.; Guan, L.L. MicroRNA regulation in mammalian adipogenesis. Exp. Biol. Med. 2011, 236, 997–1004. [Google Scholar] [CrossRef]
- Bae, I.; Park, P.J.; Lee, J.H.; Cho, E.; Lee, T.R.; Kim, S.H. PPARγ-mediated G-protein coupled receptor 120 signaling pathway promotes transcriptional activation of miR-143 in adipocytes. Gene 2017, 626, 64–69. [Google Scholar] [CrossRef]
- Kadegowda, A.K.; Bionaz, M.; Piperova, L.S.; Erdman, R.A.; Loor, J.J. Peroxisome proliferator-activated receptor-gamma activation and long-chain fatty acids alter lipogenic gene networks in bovine mammary epithelial cells to various extents. J. Dairy Sci. 2009, 92, 4276–4289. [Google Scholar] [CrossRef] [Green Version]
- Wang, M.; Moisá, S.; Khan, M.J.; Wang, J.; Bu, D.; Loor, J.J. MicroRNA expression patterns in the bovine mammary gland are affected by stage of lactation. J. Dairy Sci. 2012, 95, 6529–6535. [Google Scholar] [CrossRef] [Green Version]
- Cash, J.L.; Hart, R.; Russ, A.; Dixon, J.P.; Colledge, W.H.; Doran, J.; Hendrick, A.G.; Carlton, M.B.; Greaves, D.R. Synthetic chemerin-derived peptides suppress inflammation through chemr23. J. Exp. Med. 2008, 205, 767–775. [Google Scholar] [CrossRef] [Green Version]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Chu, S.F.; Wang, X.L.; Sun, Y.J.; Xu, T.L.; Mao, Y.J.; Loor, J.J.; Yang, Z.P. MiR-16a Regulates Milk Fat Metabolism by Targeting Large Tumor Suppressor Kinase 1 (LATS1) in Bovine Mammary Epithelial Cells. J. Agric. Food Chem. 2019, 67, 11167–11178. [Google Scholar] [CrossRef]
- Chen, Z.; Chu, S.F.; Wang, X.L.; Fan, Y.L.; Zhan, T.Y.; Adam, A.; Arbab, I.; Li, M.X.; Zhang, H.M.; Mao, Y.J.; et al. MicroRNA-106b Regulates Milk Fat Metabolism via ATP Binding Cassette Subfamily A Member 1 (ABCA1) in Bovine Mammary Epithelial Cells. J. Agric. Food Chem. 2019, 67, 3981–3990. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.Q.; Gao, J.L.; Liao, X.D.; Huang, T.H.; Zhang, M.N.; Wang, M.Q.; Tian, Y.; Bai, J.; Zhou, C.H. miR-454 regulates triglyceride synthesis in bovine mammary epithelial cells by targeting PPAR-γ. Gene 2019, 691, 1–7. [Google Scholar] [CrossRef]
- Liu, L.; Lin, Y.; Liu, L.; Wang, L.; Bian, Y.; Gao, X.; Li, Q. Regulation of peroxisome proliferator-activated receptor gamma on milk fat synthesis in dairy cow mammary epithelial cells. In Vitro Cell. Dev. Biol. Anim. 2016, 52, 1044–1059. [Google Scholar] [CrossRef] [PubMed]
- Nan, L.; Feng, Z.; Wei, C.J.; Liang, W.Y.; Zhang, N.; Wang, C.M.; Li, Q.Z.; Gao, X.J. Function of SREBP1 in the milk fat synthesis of dairy cow mammary epithelial cells. Int. J. Mol. Sci. 2014, 15, 16998–17013. [Google Scholar]
- Duchemin, S.; Bovenhuis, H.; Stoop, W.M.; Bouwman, A.C.; van Arendonk, J.A.; Visker, M.H. Genetic correlation between composition of bovine milk fat in winter and summer, and DGAT1 and SCD1 by season interactions. J. Dairy Sci. 2013, 96, 592–604. [Google Scholar] [CrossRef] [Green Version]
- Shi, B.; Jiang, Y.; Chen, Y.; Zhao, Z.; Zhou, H.; Luo, Y.; Hu, J.; Hickford, J.G.H. Share Variation in the Fatty Acid Synthase Gene (FASN) and Its Association with Milk Traits in Gannan Yaks. Animals 2019, 9, 613. [Google Scholar] [CrossRef] [Green Version]
- Jiao, B.L.; Zhang, X.L.; Wang, S.H.; Wang, L.X.; Luo, Z.X.; Zhao, H.B.; Khatib, H.; Wang, X. MicroRNA-221 regulates proliferation of bovine mammary gland epithelial cells by targeting the STAT5a and IRS1 genes. J. Dairy Sci. 2019, 102, 426–435. [Google Scholar] [CrossRef]
- Chhabra, R.; Dubey, R.; Saini, N. Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases. Mol. Cancer 2010, 9, 232. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.; Hou, J.; Ye, L.; Chen, Y.; Cui, J.; Tian, W.; Li, C.; Liu, L. MicroRNA-143 regulates adipogenesis by modulating the MAP2K5-ERK5 signaling. Sci. Rep. 2014, 4, 3819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, Y.; Min, T.S.; Seo, K.; Kim, S.H. Expression of pref-1/dlk-1 is regulated by microRNA-143 in 3T3-L1 cells. Mol. Biol. Rep. 2015, 42, 617–624. [Google Scholar] [CrossRef]
- Zhao, Y.; Liu, X.; Lu, Y.X. MicroRNA-143 regulates the proliferation and apoptosis of cervical cancer cells by targeting HIF-1α. Eur. Rev. Med. Pharmacol. Sci. 2017, 21, 5580–5586. [Google Scholar] [PubMed]
- Nan, L.; Yong, Y.; He, K.G.; Zhang, F.Y.; Zhao, L.B.; Zhou, W.; Yuan, J.H.; Liang, W.; Fang, X.H. Single-Molecule Imaging Reveals the Activation Dynamics of Intracellular Protein Smad3 on Cell Membrane. Sci. Rep. 2016, 6, 33469. [Google Scholar]
- Yadav, H.; Quijano, C.; Kamaraju, A.K.; Gavrilova, O.; Malek, R.; Chen, W.; Zerfas, P.; Zhigang, D.; Wright, E.C.; Stuelten, C.; et al. Protection from obesity and diabetes by blockade of TGF-β/Smad3 signaling. Cell Metab. 2011, 14, 67–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Choy, L.; Derynck, R. Transforming Growth Factor-β Inhibits Adipocyte Differentiation by Smad3 Interacting with CCAAT/Enhancer-binding Protein (C/EBP) and Repressing C/EBP Transactivation Function. J. Biol. Chem. 2003, 278, 9609–9619. [Google Scholar] [CrossRef] [Green Version]
- Feng, X.H.; Derynck, R. Specificity and versatility in TGF-signaling through Smads. Annu. Rev. Cell Dev. Biol. 2005, 21, 659–693. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Q.; Chang, A.; Xu, A.; Luo, K. The regulatory protein SnoN antagonizes activin/Smad2 protein signaling and thereby promotes adipocyte differentiation and obesity in mice. J. Biol. Chem. 2018, 293, 14100–14111. [Google Scholar] [CrossRef] [Green Version]
Genes | Primer Sequence (5′-3′) | Annealing Temperature (°C) |
---|---|---|
UXT | F:TAGCCACCCTCAAGTATGTTCG | 61 °C |
R:CGAGGTAGGAGGACAGGAGT | ||
PPARγ | F:AAAGGAGAGCCTGAACTTGGAG | 61 °C |
R:TCTGAACTGTGCTGTGGCAA | ||
FASN | F:CCCTGAATGTGAGGCAGTGTG | 61 °C |
R:TTAGCTGTGGTGAGGAGCCA | ||
CEBPβ | F:TGGTGAATAGTGCTGCCCAT | 61 °C |
R:GGTGGTAGTTGTGGAAGCCC | ||
SCD1 | F:ACATTGATCCCCACCTGCAA | 61 °C |
R:AAACGTCATTCTGGAACGGC | ||
SREBP1 | F:CAA TGTGTGAGAAGGCCAGT | 61 °C |
R:ACAAGGAGCAGGTCACACAG | ||
Smad3 | F: GAGTTGAAGCGAAGTTTGGGC | 61 °C |
R: CTCTTGACTGCCTTCTCGCA | ||
U6 | F:TAGCCACCCTCAAGTATGTTCG | 61 °C |
R:CGAGGTAGGAGGACAGGAGT | ||
miR-143 | GCTCGATGTCACGAAGTAGAGT | 61 °C |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Wu, Z.-Q.; Wang, Y.-J.; Wang, M.; Yang, W.-C. MiR-143 Regulates Milk Fat Synthesis by Targeting Smad3 in Bovine Mammary Epithelial Cells. Animals 2020, 10, 1453. https://doi.org/10.3390/ani10091453
Zhang L, Wu Z-Q, Wang Y-J, Wang M, Yang W-C. MiR-143 Regulates Milk Fat Synthesis by Targeting Smad3 in Bovine Mammary Epithelial Cells. Animals. 2020; 10(9):1453. https://doi.org/10.3390/ani10091453
Chicago/Turabian StyleZhang, Li, Zhang-Qing Wu, Yu-Juan Wang, Meng Wang, and Wu-Cai Yang. 2020. "MiR-143 Regulates Milk Fat Synthesis by Targeting Smad3 in Bovine Mammary Epithelial Cells" Animals 10, no. 9: 1453. https://doi.org/10.3390/ani10091453