TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Animal
2.3. Cell Culture and Transfection
2.4. RNA Extraction and RT-qPCR
2.5. Immunohistochemistry
2.6. Cell Viability Test
2.7. Statistical Analysis
3. Results
3.1. Effects of Different Temperatures on mRNA Levels of UPR-, TJ Protein-Related Genes, and Cell Viability
3.2. Mild Heat Treatment Increases Trpv4 mRNA Levels in HC11 Cells
3.3. TRPV4 agonist Increases β-casein and TJ Protein-Encoding mRNA Levels
3.4. Mild Heat Shock at 39 °C Increases β-casein and TJ Protein-Encoding Gene Transcript Levels via XBP1
3.5. Change in Trpv4 Expression During Mammary Gland Development
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sternlicht, M.D. Key stages in mammary gland development—The cues that regulate ductal branching morphogenesis. Breast Cancer Res. 2006, 8, 201. [Google Scholar] [CrossRef] [PubMed]
- Nagaoka, K.; Udagawa, T.; Richter, J.D. Cpeb-mediated zo-1 mrna localization is required for epithelial tight-junction assembly and cell polarity. Nat. Commun. 2012, 3, 675. [Google Scholar] [CrossRef] [PubMed]
- Furuse, M. Molecular basis of the core structure of tight junctions. Cold Spring Harb. Perspect. Biol. 2010, 2, a002907. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.A.; Neville, M.C. Tight junction regulation in the mammary gland. J. Mammary Gland Biol. Neoplasia 1998, 3, 233–246. [Google Scholar] [CrossRef] [PubMed]
- Chapman, P.M. Defining hormesis: Comments on calabrese and baldwin. Hum. Exp. Toxicol. 2002, 21, 99–101. [Google Scholar] [CrossRef]
- Park, H.G.; Han, S.I.; Oh, S.Y.; Kang, H.S. Cellular responses to mild heat stress. Cell Mol. Life Sci. 2005, 62, 10–23. [Google Scholar] [CrossRef]
- Kobayashi, K.; Tsugami, Y.; Matsunaga, K.; Suzuki, T.; Nishimura, T. Moderate high temperature condition induces the lactation capacity of mammary epithelial cells through control of stat3 and stat5 signaling. J. Mammary Gland Biol. Neoplasia 2018, 23, 75–88. [Google Scholar] [CrossRef]
- Mizusawa, M.; Sharmin, M.M.; Yonekura, S. Mild heat stress induces transcription of the beta-casein gene via unfolded protein response-activated xbp1 signaling in undifferentiated mammary epithelial cells. Anim. Sci. J. 2019, 90, 1026–1032. [Google Scholar] [CrossRef]
- Tominaga, M.; Caterina, M.J. Thermosensation and pain. J. Neurobiol. 2004, 61, 3–12. [Google Scholar] [CrossRef]
- Venkatachalam, K.; Montell, C. Trp channels. Annu. Rev. Biochem. 2007, 76, 387–417. [Google Scholar] [CrossRef]
- Ouadid-Ahidouch, H.; Dhennin-Duthille, I.; Gautier, M.; Sevestre, H.; Ahidouch, A. Trp channels: Diagnostic markers and therapeutic targets for breast cancer? Trends Mol. Med. 2013, 19, 117–124. [Google Scholar] [CrossRef]
- Reiter, B.; Kraft, R.; Gunzel, D.; Zeissig, S.; Schulzke, J.D.; Fromm, M.; Harteneck, C. Trpv4-mediated regulation of epithelial permeability. FASEB J. 2006, 20, 1802–1812. [Google Scholar] [CrossRef]
- Guler, A.D.; Lee, H.; Iida, T.; Shimizu, I.; Tominaga, M.; Caterina, M. Heat-evoked activation of the ion channel, trpv4. J. Neurosci. 2002, 22, 6408–6414. [Google Scholar] [CrossRef]
- Xu, X.; Gupta, S.; Hu, W.; McGrath, B.C.; Cavener, D.R. Hyperthermia induces the er stress pathway. PLoS ONE 2011, 6, e23740. [Google Scholar] [CrossRef]
- Kim, J.H.; Park, S.J.; Kim, T.S.; Park, H.J.; Park, J.; Kim, B.K.; Kim, G.R.; Kim, J.M.; Huang, S.M.; Chae, J.I.; et al. Testicular hyperthermia induces unfolded protein response signaling activation in spermatocyte. Biochem. Biophys. Res. Commun. 2013, 434, 861–866. [Google Scholar] [CrossRef]
- Patil, C.; Walter, P. Intracellular signaling from the endoplasmic reticulum to the nucleus: The unfolded protein response in yeast and mammals. Curr. Opin. Cell Biol. 2001, 13, 349–355. [Google Scholar] [CrossRef]
- Ron, D. Translational control in the endoplasmic reticulum stress response. J. Clin. Investig. 2002, 110, 1383–1388. [Google Scholar] [CrossRef]
- Calfon, M.; Zeng, H.; Urano, F.; Till, J.H.; Hubbard, S.R.; Harding, H.P.; Clark, S.G.; Ron, D. Ire1 couples endoplasmic reticulum load to secretory capacity by processing the xbp-1 mrna. Nature 2002, 415, 92–96. [Google Scholar] [CrossRef]
- Tsuchiya, M.; Koizumi, Y.; Hayashi, S.; Hanaoka, M.; Tokutake, Y.; Yonekura, S. The role of unfolded protein response in differentiation of mammary epithelial cells. Biochem. Biophys. Res. Commun. 2017, 484, 903–908. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, H.; Vriens, J.; Suh, S.H.; Benham, C.D.; Droogmans, G.; Nilius, B. Heat-evoked activation of trpv4 channels in a hek293 cell expression system and in native mouse aorta endothelial cells. J. Biol. Chem. 2002, 277, 47044–47051. [Google Scholar] [CrossRef] [PubMed]
- Chung, M.K.; Lee, H.; Caterina, M.J. Warm temperatures activate trpv4 in mouse 308 keratinocytes. J. Biol. Chem. 2003, 278, 32037–32046. [Google Scholar] [CrossRef]
- Akazawa, Y.; Yuki, T.; Yoshida, H.; Sugiyama, Y.; Inoue, S. Activation of trpv4 strengthens the tight-junction barrier in human epidermal keratinocytes. Ski. Pharm. Physiol. 2013, 26, 15–21. [Google Scholar] [CrossRef]
- Martinez-Rendon, J.; Sanchez-Guzman, E.; Rueda, A.; Gonzalez, J.; Gulias-Canizo, R.; Aquino-Jarquin, G.; Castro-Munozledo, F.; Garcia-Villegas, R. Trpv4 regulates tight junctions and affects differentiation in a cell culture model of the corneal epithelium. J. Cell Physiol. 2017, 232, 1794–1807. [Google Scholar] [CrossRef]
- Darby, W.G.; Grace, M.S.; Baratchi, S.; McIntyre, P. Modulation of trpv4 by diverse mechanisms. Int. J. Biochem. Cell Biol. 2016, 78, 217–228. [Google Scholar] [CrossRef]
- Thorneloe, K.S.; Sulpizio, A.C.; Lin, Z.; Figueroa, D.J.; Clouse, A.K.; McCafferty, G.P.; Chendrimada, T.P.; Lashinger, E.S.; Gordon, E.; Evans, L.; et al. N-((1s)-1-{[4-((2s)-2-{[(2,4-dichlorophenyl)sulfonyl]amino}-3-hydroxypropanoyl)-1-piperazinyl]carbonyl}-3-methylbutyl)-1-benzothiophene-2-carboxamide (gsk1016790a), a novel and potent transient receptor potential vanilloid 4 channel agonist induces urinary bladder contraction and hyperactivity: Part i. J. Pharm. Exp. 2008, 326, 432–442. [Google Scholar]
- Alexander, R.; Kerby, A.; Aubdool, A.A.; Power, A.R.; Grover, S.; Gentry, C.; Grant, A.D. 4alpha-phorbol 12,13-didecanoate activates cultured mouse dorsal root ganglia neurons independently of trpv4. Br. J. Pharm. 2013, 168, 761–772. [Google Scholar] [CrossRef]
- White, J.P.; Cibelli, M.; Urban, L.; Nilius, B.; McGeown, J.G.; Nagy, I. Trpv4: Molecular conductor of a diverse orchestra. Physiol. Rev. 2016, 96, 911–973. [Google Scholar] [CrossRef]
- Garcia-Elias, A.; Mrkonjic, S.; Jung, C.; Pardo-Pastor, C.; Vicente, R.; Valverde, M.A. The trpv4 channel. Handb. Exp. Pharm. 2014, 222, 293–319. [Google Scholar]
- Jung, C.; Fandos, C.; Lorenzo, I.M.; Plata, C.; Fernandes, J.; Gene, G.G.; Vazquez, E.; Valverde, M.A. The progesterone receptor regulates the expression of trpv4 channel. Pflügers Arch. Eur. J. Physiol. 2009, 459, 105–113. [Google Scholar] [CrossRef] [PubMed]
- Celli, A.; Mackenzie, D.S.; Crumrine, D.S.; Tu, C.L.; Hupe, M.; Bikle, D.D.; Elias, P.M.; Mauro, T.M. Endoplasmic reticulum ca2+ depletion activates xbp1 and controls terminal differentiation in keratinocytes and epidermis. Br. J. Dermatol. 2011, 164, 16–25. [Google Scholar] [CrossRef]
- Shen, J.; Tu, L.; Chen, D.; Tan, T.; Wang, Y.; Wang, S. Trpv4 channels stimulate ca(2+)-induced ca(2+) release in mouse neurons and trigger endoplasmic reticulum stress after intracerebral hemorrhage. Brain Res. Bull. 2019, 146, 143–152. [Google Scholar] [CrossRef]
- Ma, J.H.; Wang, J.J.; Li, J.; Pfeffer, B.A.; Zhong, Y.; Zhang, S.X. The role of ire-xbp1 pathway in regulation of retinal pigment epithelium tight junctions. Investig. Ophthalmol. Vis. Sci. 2016, 57, 5244–5252. [Google Scholar] [CrossRef]
- Urra, H.; Dufey, E.; Lisbona, F.; Rojas-Rivera, D.; Hetz, C. When er stress reaches a dead end. Biochim. Biophys. Acta 2013, 1833, 3507–3517. [Google Scholar] [CrossRef]
- Harding, H.P.; Novoa, I.; Zhang, Y.; Zeng, H.; Wek, R.; Schapira, M.; Ron, D. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol. Cell 2000, 6, 1099–1108. [Google Scholar] [CrossRef]
- Sakaguchi, Y.; Stephens, L.C.; Makino, M.; Kaneko, T.; Strebel, F.R.; Danhauser, L.L.; Jenkins, G.N.; Bull, J.M. Apoptosis in tumors and normal tissues induced by whole body hyperthermia in rats. Cancer Res. 1995, 55, 5459–5464. [Google Scholar]
- Berman, A.; Folman, Y.; Kaim, M.; Mamen, M.; Herz, Z.; Wolfenson, D.; Arieli, A.; Graber, Y. Upper critical temperatures and forced ventilation effects for high-yielding dairy cows in a subtropical climate. J. Dairy Sci. 1985, 68, 1488–1495. [Google Scholar] [CrossRef]
- Capuco, A.V.; Ellis, S.E.; Hale, S.A.; Long, E.; Erdman, R.A.; Zhao, X.; Paape, M.J. Lactation persistency: Insights from mammary cell proliferation studies. J. Anim. Sci. 2003, 81, 18–31. [Google Scholar] [CrossRef]
- Capuco, A.V.; Wood, D.L.; Baldwin, R.; McLeod, K.; Paape, M.J. Mammary cell number, proliferation, and apoptosis during a bovine lactation: Relation to milk production and effect of bst. J. Dairy Sci. 2001, 84, 2177–2187. [Google Scholar] [CrossRef]
- Knight, C.H.; Docherty, A.H.; Peaker, M. Milk yield in rats in relation to activity and size of the mammary secretory cell population. J. Dairy Res. 1984, 51, 29–35. [Google Scholar] [CrossRef]
- Yonekura, S.; Tsuchiya, M.; Tokutake, Y.; Mizusawa, M.; Nakano, M.; Miyaji, M.; Ishizaki, H.; Haga, S. The unfolded protein response is involved in both differentiation and apoptosis of bovine mammary epithelial cells. J. Dairy Sci. 2018, 101, 3568–3578. [Google Scholar] [CrossRef]
- Butcher, D.T.; Alliston, T.; Weaver, V.M. A tense situation: Forcing tumour progression. Nat. Rev. Cancer 2009, 9, 108–122. [Google Scholar] [CrossRef]
- Gehler, S.; Baldassarre, M.; Lad, Y.; Leight, J.L.; Wozniak, M.A.; Riching, K.M.; Eliceiri, K.W.; Weaver, V.M.; Calderwood, D.A.; Keely, P.J. Filamin a-beta1 integrin complex tunes epithelial cell response to matrix tension. Mol. Biol. Cell 2009, 20, 3224–3238. [Google Scholar] [CrossRef] [PubMed]
- Clapham, D.E. Trp channels as cellular sensors. Nature 2003, 426, 517–524. [Google Scholar] [CrossRef]
- Thodeti, C.K.; Matthews, B.; Ravi, A.; Mammoto, A.; Ghosh, K.; Bracha, A.L.; Ingber, D.E. Trpv4 channels mediate cyclic strain-induced endothelial cell reorientation through integrin-to-integrin signaling. Circ. Res. 2009, 104, 1123–1130. [Google Scholar] [CrossRef] [PubMed]
- Baumgartner, H.K.; Rudolph, M.C.; Ramanathan, P.; Burns, V.; Webb, P.; Bitler, B.G.; Stein, T.; Kobayashi, K.; Neville, M.C. Developmental expression of claudins in the mammary gland. J. Mammary Gland Biol. Neoplasia 2017, 22, 141–157. [Google Scholar] [CrossRef] [PubMed]






| Gene | Primers (5′ to 3′) |
|---|---|
| Zo-1 | Forward GGGAGGGTCAAATGAAGACA Reverse GGCATTCCTGCTGGTTACAT |
| Cldn3 | Forward AGCCAGTCTCCAAAGCCACA Reverse CTGGGAATCAACTGCCCTTC |
| Ocln | Forward CGGACCCTGACCACTATGAAA Reverse CCTGCAGACCTGCATCAAAA |
| Trpv4 | Forward ATGGCAGATCCTGGTGATGG Reverse GGAACTTCATACGCAGGTTTGG |
| β-casein | Forward GATGCCCCTCCTTAACTCTGAA Reverse TTAGCAAGACTGGCAAGGCTG |
| Xbp1s | Forward TGAGAACCAGGAGTTAAGAACACGC Reverse CCTGCACCTGCTGCGGAC |
| Ire1α | Forward ACGAAGGCCTGACGAAACTT Reverse ATCTGAACTTCGGCATGGGG |
| Atf4 | Forward GAGCTTCCTGAACAGCGAAGTG Reverse TGGCCACCTCCAGATAGTCATC |
| Chop | Forward CCTAGCTTGGCTGACAGAGG Reverse CTGCTCCTTCTCCTTCATGC |
| Atf6α | Forward CTTCCTCCAGTTGCTCCATC Reverse CAACTCCTCAGGAACGTGCT |
| Grp78 | Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG |
| Gapdh | Forward TTGTGATGGGTGTGAACCACGAG Reverse CATGAGCCCTTCCACAATGCCAA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.A.; Mizusawa, M.; Sharmin, M.M.; Hayashi, S.; Yonekura, S. TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells. Animals 2020, 10, 1174. https://doi.org/10.3390/ani10071174
Islam MA, Mizusawa M, Sharmin MM, Hayashi S, Yonekura S. TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells. Animals. 2020; 10(7):1174. https://doi.org/10.3390/ani10071174
Chicago/Turabian StyleIslam, Md Aminul, Moeko Mizusawa, Mst Mamuna Sharmin, Satoko Hayashi, and Shinichi Yonekura. 2020. "TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells" Animals 10, no. 7: 1174. https://doi.org/10.3390/ani10071174
APA StyleIslam, M. A., Mizusawa, M., Sharmin, M. M., Hayashi, S., & Yonekura, S. (2020). TRPV4 Increases the Expression of Tight Junction Protein-Encoding Genes via XBP1 in Mammary Epithelial Cells. Animals, 10(7), 1174. https://doi.org/10.3390/ani10071174
