Resveratrol Attenuates Aflatoxin B1-Induced ROS Formation and Increase of m6A RNA Methylation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experiment Design
2.2. Sample Collection
2.3. Analysis of Serum Aminotransferase Activities
2.4. Liver Histologic Evaluation
2.5. Detection of ROS
2.6. Analysis of Oxidative Stress Parameters
2.7. Total RNA Extraction and Real-Time RT-PCR
2.8. Measurement of Total m6A
2.9. Western Blotting
2.10. Statistical Analysis
3. Results
3.1. Growth Analysis
3.2. Activities of Serum Aspartate Aminotransferase and Alanine Aminotransferase
3.3. Liver Histological Changes
3.4. ROS Content
3.5. Hepatic Redox Status
3.6. Hepatic Antioxidant Gene Expression
3.7. Hepatic Apoptosis Gene Expression
3.8. Levels of m6A RNA Methylation
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Bennett, J.; Klich, M. Mycotoxins. Clin. Microbiol. Rev. 2003, 16, 497–516. [Google Scholar] [CrossRef] [Green Version]
- Bruce, R. Response: Risk Assessment for Aflatoxin. Risk Anal. 1994, 14, 897. [Google Scholar] [CrossRef] [PubMed]
- Bennett, R.; Essigmann, J.; Wogan, G. Excretion of an aflatoxin-guanine adduct in the urine of aflatoxin B1-treated rats. Cancer Res. 1981, 41, 650–654. [Google Scholar] [PubMed]
- Bedard, L.L.; Massey, T.E. Aflatoxin B1-induced DNA damage and its repair. Cancer Lett. 2006, 241, 174–183. [Google Scholar] [CrossRef]
- Sabbioni, G.; Skipper, P.; Büchi, G.; Tannenbaum, S. Isolation and characterization of the major serum albumin adduct formed by aflatoxin B1 in vivo in rats. Carcinogenesis 1987, 8, 819–824. [Google Scholar] [CrossRef] [PubMed]
- Chandra, J.; Samali, A.; Orrenius, S. Triggering and modulation of apoptosis by oxidative stress. Free Radic. Biol. Med. 2000, 29, 323–333. [Google Scholar] [CrossRef]
- Dai, Y.; Huang, K.; Zhang, B.; Zhu, L.; Xu, W.-T. Aflatoxin B1-induced epigenetic alterations: An overview. Food Chem. Toxicol. 2017, 109, 683–689. [Google Scholar] [CrossRef]
- Roundtree, I.A.; Evans, M.E.; Pan, T.; He, C. Dynamic RNA Modifications in Gene Expression Regulation. Cell 2017, 169, 1187–1200. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.Z.; Yue, Y.N.; Han, D.L. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat. Chem. Biol. 2014, 10, 93–95. [Google Scholar] [CrossRef] [Green Version]
- Rajecka, V.; Skalicky, T.; Vanacova, S. The role of RNA adenosine demethylases in the control of gene expression. Biochim. Biophys. Acta Gene Regul. Mech. 2019, 1862, 343–355. [Google Scholar] [CrossRef]
- Liao, S.; Sun, H.; Xu, C. YTH Domain: A Family of N6-methyladenosine (m6A) Readers. Genom. Proteom. Bioinf. 2018, 16, 99–107. [Google Scholar] [CrossRef] [PubMed]
- Roundtree, I.A.; He, C. Nuclear m6A Reader YTHDC1 Regulates mRNA Splicing. Trends Genet. 2016, 32, 320–321. [Google Scholar] [CrossRef]
- Liu, J.; Harada, B.T.; He, C. Regulation of Gene Expression by N6-methyladenosine in Cancer. Trends Cell Biol. 2019, 29, 487–499. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhao, B.S.; Roundtree, I.A.; Lu, Z.; Han, D.; Ma, H.; Weng, X.; Chen, K.; Shi, H.; He, C. N6-methyladenosine Modulates Messenger RNA Translation Efficiency. Cell 2015, 161, 1388–1399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tong, J.Y.; Flavell, R.A.; Li, H.B. RNA m6A modification and its function in diseases. Front. Med. 2018, 12, 481–489. [Google Scholar] [CrossRef] [Green Version]
- Zhong, X.; Yu, J.; Frazier, K.; Weng, X.; Li, Y.; Cham, C.M.; Dolan, K.; Zhu, X.; Hubert, N.; Tao, Y.; et al. Circadian Clock Regulation of Hepatic Lipid Metabolism by Modulation of m6A mRNA Methylation. Cell Rep. 2018, 25, 1816–1828.e1814. [Google Scholar] [CrossRef] [Green Version]
- Batista Pedro, J.; Molinie, B.; Wang, J.; Qu, K.; Zhang, J.; Li, L.; Bouley, D.M.; Lujan, E.; Haddad, B.; Daneshvar, K.; et al. m6A RNA Modification Controls Cell Fate Transition in Mammalian Embryonic Stem Cells. Cell Stem Cell 2014, 15, 707–719. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Li, Y.; Toth, J.I.; Petroski, M.D.; Zhang, Z.; Zhao, J.C. N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. Nat. Cell Biol. 2014, 16, 191–198. [Google Scholar] [CrossRef]
- Wu, J.; Frazier, K.; Zhang, J.; Gan, Z.; Wang, T.; Zhong, X. Emerging role of m6A RNA methylation in nutritional physiology and metabolism. Obes. Rev. 2019. [Google Scholar] [CrossRef]
- Soni, K.; Rajan, A.; Kuttan, R. Reversal of aflatoxin induced liver damage by turmeric and curcumin. Cancer Lett. 1992, 66, 115–121. [Google Scholar] [CrossRef]
- Ko, J.H.; Sethi, G.; Um, J.Y.; Shanmugam, M.K.; Arfuso, F.; Kumar, A.P.; Bishayee, A.; Ahn, K.S. The Role of Resveratrol in Cancer Therapy. Int. J. Mol. Sci. 2017, 18, 2589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ajmo, J.; Liang, X.; Rogers, C.; Pennock, B.; You, M. Resveratrol Alleviates Alcoholic Fatty Liver in Mice. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 295, G833–G842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okur, V.; Cetin, O.; Cetin, E.; Tepeli, E.; Bulgu, Y.; Yildirim, C. HIF1A as a major vascular endothelial growth factor regulator: Do its polymorphisms have an association with age-related macular degeneration? Clin. Exp. Ophthalmol. 2015, 43, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Lou, X.D.; Wang, H.D.; Xia, S.; Skog, S.; Sun, J. Effects of Resveratrol on the Expression and DNA Methylation of Cytokine Genes in Diabetic Rat Aortas. Arch. Immunol. Ther. Exp. 2014, 62, 329–340. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, B.; Ghosh, K.; Kanade, S.R. Resveratrol modulates epigenetic regulators of promoter histone methylation and acetylation that restores BRCA1, p53, p21CIP1 in human breast cancer cell lines. BioFactors 2019, 45, 818–829. [Google Scholar] [CrossRef] [PubMed]
- Reeves, P.G.; Nielsen, F.H.; Fahey, G.C. Ain-93 purified diets for laboratory rodents—Final report of the American institute of nutrition ad hoc writing committee on the reformulation of the ain-76A rodent diet. J. Nutr. 1993, 123, 1939–1951. [Google Scholar] [CrossRef]
- Wang, Z.P.; Hua, Y.M.; Zhang, X.; Wang, Y.B.; Shi, X.Q.; Li, M.Y. Effect of resveratrol on myocardial fibrosis in mice with chronic viral myocarditis. Chin. J. Contemp. Pediatri. 2009, 11, 291–295. [Google Scholar]
- Gordon, B.; Delgado-Diaz, D.; Kostek, M. Resveratrol decreases inflammation and increases utrophin gene expression in the mdx mouse model of Duchenne muscular dystrophy. Clin. Nutr. 2012, 32, 104–111. [Google Scholar] [CrossRef]
- Wang, Y.; Gao, J. Aflatoxin B1 poisoning preliminary studies in mouse model. Agric. Sci. J. Yanbian Univ. 2015, 3, 259–262. [Google Scholar]
- Niu, Y.; Zhao, X.; Wu, Y.S.; Li, M.M.; Wang, X.J.; Yang, Y.G. N6-methyl-adenosine (m6A) in RNA: An Old Modification with A Novel Epigenetic Function. Genom. Proteom. Bioinf. 2013, 11, 8–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siddiqui, W.A.; Ahad, A.; Ahsan, H. The mystery of BCL2 family: Bcl-2 proteins and apoptosis: An update. Arch. Toxicol. 2015, 89, 289–317. [Google Scholar] [CrossRef] [PubMed]
- Carmen, S.; Mihaela, G.; Viorel, F.; Oprisan, B.; Solcan, G. The hepatoprotective effect of sea buckthorn (Hippophae rhamnoides) berries on induced aflatoxin B1 poisoning in chickens. Poult. Sci. 2013, 92, 966–974. [Google Scholar]
- Vu, L.P.; Pickering, B.F.; Cheng, Y.; Zaccara, S.; Nguyen, D.; Minuesa, G.; Chou, T.; Chow, A.; Saletore, Y.; Mackay, M.; et al. The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat. Med. 2017, 23, 1369–1376. [Google Scholar] [CrossRef] [PubMed]
- Circu, M.; Aw, T.; Circu, M.L.; Aw, T.Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nicholson, D.W. Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ. 1999, 6, 1028–1042. [Google Scholar] [CrossRef] [Green Version]
- Song, H.; Feng, X.; Zhang, H.; Luo, Y.; Huang, J.; Lin, M.; Jin, J.; Ding, X.; Wu, S.; Huang, H.; et al. METTL3 and ALKBH5 oppositely regulate m6A modification of TFEB mRNA, which dictates the fate of hypoxia/reoxygenation-treated cardiomyocytes. Autophagy 2019, 15, 1419–1437. [Google Scholar] [CrossRef] [Green Version]
- Zhou, P.; Wu, M.; Ye, C.; Xu, Q.; Wang, L. Meclofenamic acid promotes cisplatin-induced acute kidney injury by inhibiting fat mass and obesity-associated protein-mediated m6A abrogation in RNA. J. Biol. Chem. 2019, 294, 16908–16917. [Google Scholar] [CrossRef]
- Lin, S.; Liu, J.; Jiang, W.; Wang, P.; Sun, C.; Wang, X.; Chen, Y.; Wang, H. METTL3 promotes the proliferation and mobility of gastric cancer cells. Open Med. 2019, 14, 25–31. [Google Scholar] [CrossRef] [Green Version]
- Cao, X.; Tian, S.; Fu, M.; Li, Y.; Sun, Y.; Liu, J.; Liu, Y. Resveratrol protects human bronchial epithelial cells against nickel-induced toxicity via suppressing p38 MAPK, NF-kappa B signaling, and NLRP3 inflammasome activation. Environ. Toxicol. 2020. [Google Scholar] [CrossRef]
- Abolaji, A.O.; Ajala, V.O.; Adigun, J.O.; Adedara, I.I.; Kinyi, H.W.; Farombi, E.O. Protective role of resveratrol, a natural polyphenol, in sodium fluoride-induced toxicity in Drosophila melanogaster. Exp. Biol. Med. 2019, 244, 1688–1694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sebai, H.; Sani, M.; Yacoubi, M.T.; Aouani, E.; Ghanem, B.N.; Ben, A.M. Resveratrol, a red wine polyphenol, attenuates lipopolysaccharide-induced oxidative stress in rat liver. Ecotoxicol. Environ. Saf. 2010, 73, 1078–1083. [Google Scholar] [CrossRef]
- Ashkenazi, A.; Dixit, V.M. Apoptosis control by death and decoy receptors. Curr. Opin. Cell Biol. 1999, 11, 255–260. [Google Scholar] [CrossRef]
- Aziz, M.H.; Reaganshaw, S.; Ahmad, N. Resveratrol-caused apoptosis of human prostate carcinoma LNCaP cells is mediated via modulation of PI3K/Akt pathway and Bcl-2 family proteins. Mol. Cancer Ther. 2004, 5, 1335–1341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shakibaei, M.; John, T.; Seifarth, C.; Mobasheri, A. Resveratrol inhibits IL-1 beta-induced stimulation of caspase-3 and cleavage of PARP in human articular chondrocytes in vitro. Ann. N. Y. Acad. Sci. 2007, 1095, 554–563. [Google Scholar] [CrossRef]
- Lu, N.; Li, X.; Yu, J.; Li, Y.; Wang, C.; Zhang, L.; Wang, T.; Zhong, X. Curcumin Attenuates Lipopolysaccharide-Induced Hepatic Lipid Metabolism Disorder by Modification of m6A RNA Methylation in Piglets. Lipids 2018, 53, 53–63. [Google Scholar] [CrossRef]
- Gan, Z.; Wei, W.; Wu, J.; Zhao, Y.; Zhang, L.; Wang, T.; Zhong, X. Resveratrol and Curcumin Improve Intestinal Mucosal Integrity and Decrease m6A RNA Methylation in the Intestine of Weaning Piglets. ACS Omega 2019, 4, 17438–17446. [Google Scholar] [CrossRef]
- Shen, Y.; Cao, B.; Snyder, N.R.; Woeppel, K.M.; Eles, J.R.; Cui, X.T. ROS responsive resveratrol delivery from LDLR peptide conjugated PLA-coated mesoporous silica nanoparticles across the blood-brain barrier. J. Nanobiotechnol. 2018, 16, 13. [Google Scholar] [CrossRef] [Green Version]
Primers 1 | Accession No. | Sequences (F/R, 5′-3′) |
---|---|---|
NRF2 | NM_010902 | GGTTGCCCACATTCCCAAAC |
AGTGACTGACTGATGGCAGC | ||
HO-1 | NM_010442 | GTCAGGTGTCCAGAGAAGGC |
CATCACCTGCAGCTCCTCAA | ||
KEAP1 | NM_001110307 | AAGTGTGAGATCCTGCAGGC |
CGACTAGATGCCACTCGTCC | ||
GPX1 | NM_001329528 | TGAACGATCTGCAGAAGCGT |
TAGGAGTTGCCAGACTGCTG | ||
CAT | NM_009804 | TTCGTCCCGAGTCTCTCCAT |
GAGTGTCCGGGTAGGCAAAA | ||
GCLC | NM_010295 | TACCGAGGCTACGTGTCAGA |
TCTCGTCAACCTTGGACAGC | ||
GCLM | NM_008129 | GAATGCACCATGTCCCATGC |
CGATGACCGAGTACCTCAGC | ||
SOD1 | NM_011434 | GGAACCATCCACTTCGAGCA |
CCAATCACTCCACAGGCCAA | ||
BAX | NM_007527 | GGTGGCAGCTGACATGTTTG |
TTAGTGCACAGGGCCTTGAG | ||
BCL-2 | NM_009741 | CTTCTCTCGTCGCTACCGTC |
CAATCCTCCCCCAGTTCACC | ||
CASP-3 | NM_001284409 | ACATGGGAGCAAGTCAGTGG |
CCGTACCAGAGCGAGATGAC | ||
CASP-9 | AB019600 | GTCACAGACCTTGAGACCCG |
GGCAGTCAGGTCGTTCTTCA | ||
P53 | AB020317 | TGCATGGACGATCTGTTGCT |
GTGGTATACTCAGAGCCGGC | ||
METTL3 | NM_019721 | ACCACAACAGCCAAGGAACA |
CCAATTCCATGGCCCTTCCT | ||
METTL14 | NM_201638 | TATGCTTGCGAAAGTGGGGT |
CCACCTCTCTCTCCTCGGAA | ||
FTO | NM_011936 | GATGACCTCAATGCCACCCA |
ACTAAACCGAGGCTGTGAGC | ||
ALKBH5 | NM_172943 | GTCCCGGGACAACTACAAGG |
TATTTCCGCTTGGTGGTCCC | ||
YTHDF2 | NM_145393 | CAGCTCTCAGTCCAGCAACA |
AGTAGATCCAGAACCCGCCT | ||
GAPDH | NM_008084 | TTCACCACCATGGAGAAGGC |
TGAAGTCGCAGGAGACAACC |
Antibodies | Identifier | Source | Host |
---|---|---|---|
BCL-2 | 12789-1-AP | Proteintech | Rabbit |
BAX | 50599-2-Ig | Proteintech | Rabbit |
CASPASE-3 | 19677-1-AP | Proteintech | Rabbit |
METTL3 | ab240595 | Abcam | Rabbit |
FTO | 27226-1-AP | Proteintech | Rabbit |
ALKBH5 | 16837-1-AP | Proteintech | Rabbit |
YTHDF2 | 24744-1-AP | Proteintech | Rabbit |
ACTB | 60008-1-Ig | Proteintech | Mouse |
Items | Experiment Groups | SEM | p | |||||
---|---|---|---|---|---|---|---|---|
CON | RES | AFB1 | ARE | A | R | A × R | ||
ALT (U/L) | 9.01 bc | 8.24 c | 12.43 a | 10.01 b | 1.89 | <0.01 | <0.01 | 0.034 |
AST (U/L) | 9.23 c | 11.70 c | 21.21 a | 14.83 b | 5.22 | <0.01 | 0.048 | <0.01 |
Items | Experiment Groups | SEM | p | |||||
---|---|---|---|---|---|---|---|---|
CON | RES | AFB1 | ARE | A | R | A × R | ||
MDA (nmol/mgprot) | 3.99 bc | 3.74 c | 5.04 a | 4.22 b | 0.61 | <0.01 | <0.01 | 0.036 |
CAT (U/mgprot) | 79.54 a | 76.70 ab | 67.12 c | 72.97 b | 7.175 | <0.01 | 0.46 | 0.04 |
GSH-PX (U/mgprot) | 939.02 | 936.73 | 875.81 | 921.17 | 60.584 | 0.064 | 0.3 | 0.252 |
SOD (U/mgprot) | 779.20 | 755.83 | 653.81 | 694.52 | 22.420 | <0.01 | 0.589 | 0.053 |
T-AOC (U/mgprot) | 0.67 a | 0.70 a | 0.39 c | 0.56 b | 0.086 | <0.01 | <0.01 | 0.025 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, J.; Gan, Z.; Zhuo, R.; Zhang, L.; Wang, T.; Zhong, X. Resveratrol Attenuates Aflatoxin B1-Induced ROS Formation and Increase of m6A RNA Methylation. Animals 2020, 10, 677. https://doi.org/10.3390/ani10040677
Wu J, Gan Z, Zhuo R, Zhang L, Wang T, Zhong X. Resveratrol Attenuates Aflatoxin B1-Induced ROS Formation and Increase of m6A RNA Methylation. Animals. 2020; 10(4):677. https://doi.org/10.3390/ani10040677
Chicago/Turabian StyleWu, Jiamin, Zhending Gan, Ruhao Zhuo, Lili Zhang, Tian Wang, and Xiang Zhong. 2020. "Resveratrol Attenuates Aflatoxin B1-Induced ROS Formation and Increase of m6A RNA Methylation" Animals 10, no. 4: 677. https://doi.org/10.3390/ani10040677
APA StyleWu, J., Gan, Z., Zhuo, R., Zhang, L., Wang, T., & Zhong, X. (2020). Resveratrol Attenuates Aflatoxin B1-Induced ROS Formation and Increase of m6A RNA Methylation. Animals, 10(4), 677. https://doi.org/10.3390/ani10040677