Green Tea Powder Decreased Egg Weight Through Increased Liver Lipoprotein Lipase and Decreased Plasma Total Cholesterol in an Indigenous Chicken Breed
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Birds and Experimental Design
2.2. Blood Plasma Orexin A and Lipid Content Determination
2.3. Determination of mRNA Expression Level by Real-time Reverse Transcription
2.4. Statistical Analysis
3. Results
3.1. Laying Hens Performance
3.2. Effect of Green Tea Powder on Orexin A and Plasma Lipid Content of Huainan Partridge Chicken
3.3. Effect of Green Tea Powder on Lipid Metabolize Related Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Onakpoya, I.; Spencer, E.; Heneghan, C.; Thompson, M. The effect of green tea on blood pressure and lipid profile: A systematic review and meta-analysis of randomized clinical trials. Nutr. Metab. Cardiovasc. Dis. 2014, 24, 823–836. [Google Scholar] [CrossRef]
- Khalesi, S.; Sun, J.; Buys, N.; Jamshidi, A.; Nikbakht-Nasrabadi, E.; Khosravi-Boroujeni, H. Green tea catechins and blood pressure: A systematic review and meta-analysis of randomised controlled trials. Eur. J. Nutr. 2014, 53, 1299–1311. [Google Scholar] [CrossRef]
- Wang, X.C.; Wang, X.H.; Wang, J.; Wang, H.; Zhang, H.J.; Wu, S.G.; Qi, G.H. Dietary tea polyphenol supplementation improved egg production performance, albumen quality, and magnum morphology of Hy-line brown hens during the late laying period. J. Anim. Sci. 2018, 96, 225–235. [Google Scholar] [CrossRef]
- Koo, M.W.L.; Cho, C.H. Pharmacological effects of green tea on the gastrointestinal system. Eur. J. Pharmacol. 2004, 500, 177–185. [Google Scholar] [CrossRef] [PubMed]
- Koo, S.I.; Noh, S.K. Green tea as inhibitor of the intestinal absorption of lipids: Potential mechanism for its lipid-lowering effect. J. Nutr. Biochem. 2007, 18, 179–183. [Google Scholar] [CrossRef]
- Kara, K.; Şentürk, M.; Guclu, B.K.; Sariözkan, S.; Eren, M. Effect of catechins on fattening performance, meat quality, some antioxidant and blood parameters and fattening costs in Japanese quail (Coturnix coturnix japonica). Br. Poult. Sci. 2016, 57, 522–530. [Google Scholar] [CrossRef] [PubMed]
- Bologa, M.; Pop, I.M.; Albu, A. Research on chemical composition of chicken egg from different systems of production (Conventional and organic). Lucrări. Ştiinţifice-Seria. Zootehnie. 2013, 59, 80–85. [Google Scholar]
- Lordelo, M.; Fernandes, E.; Bessa, R.J.B.; Alves, S.P. Quality of eggs from different laying hen production systems, from indigenous breeds and specialty eggs. Poult. Sci. 2017, 96, 1485–1491. [Google Scholar] [CrossRef]
- Elkin, R.G.; Bauer, R.; Schneider, W.J. The restricted ovulator chicken strain: An oviparous vertebrate model of reproductive dysfunction caused by a gene defect affecting an oocyte-specific receptor. Anim. Reprod. Sci. 2012, 136, 1–13. [Google Scholar] [CrossRef]
- Hara, A.; Hiramatsu, N.; Fujita, T. Vitellogenesis and choriogenesis in fishes. Fish. Sci. 2016, 82, 187–202. [Google Scholar] [CrossRef]
- Jones, P.J.H. Dietary cholesterol and the risk of cardiovascular disease in patients: A review of the Harvard Egg Study and other data. Int. J. Clin. Pract. 2009, 63, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Pang, L.; Sivaram, P.; Goldberg, I.J. Cell-surface expression of an amino-terminal fragment of apolipoprotein B increases lipoprotein lipase binding to cells. J. Biol. Chem. 1996, 271, 19518–19523. [Google Scholar] [CrossRef] [PubMed]
- Xia, B.; Liu, Y.; Sun, D.; Liu, J.; Zhu, Y.; Lu, L. Effects of green tea powder supplementation on egg production and egg quality in laying hens. J. Appl. Anim. Res. 2018, 46, 927–931. [Google Scholar] [CrossRef]
- Chen, X.; Zhu, W.; Liu, X.; Li, T.; Geng, Z.; Wan, X. The growth performance, meat quality, and gut bacteria of broilers raised with or without antibiotics and green tea powder. J. Appl. Poult. Res. 2019, 28, 712–721. [Google Scholar] [CrossRef]
- Biswas, M.A.H.; Miyazaki, Y.; Nomura, K.; Wakita, M. Influences of long-term feeding of Japanese green tea powder on laying performance and egg quality in hens. Asian Australas. J. Anim. Sci. 2000, 13, 980–985. [Google Scholar] [CrossRef]
- Chen, X.; Niu, J.; Geng, Z. Gene expression and plasma lipid content in relation to intramuscular fat content in Chinese indigenous Wuhua chicken. J. Appl. Poult. Res. 2017, 26, 391–400. [Google Scholar] [CrossRef]
- Soori, R.; Safei, A.; Pournemati, P.; Ghram, A. Green tea consumption reduces apelin and orexin-A in overweight and obese women with different training modalities. Sport Sci. Health 2018, 14, 421–431. [Google Scholar] [CrossRef]
- Princen, H.M.G.; van Duyvenvoorde, W.; Buytenhek, R.; Blonk, C.; Tijburg, L.B.; Lanqius, J.A.E.; Meinders, A.E.; Pijl, H. No effect of consumption of green and black tea on plasma lipid and antioxidant levels and on LDL oxidation in smokers. Arterioscler. Thromb. Vasc. Biol. 1998, 18, 833–841. [Google Scholar] [CrossRef]
- Coimbra, S.; Santos-Silva, A.; Rocha-Pereira, P.; Rocha, S.; Castro, E. Green tea consumption improves plasma lipid profiles in adults. Nutr. Res. 2006, 26, 604–607. [Google Scholar] [CrossRef]
- Shimizu, M.; Kobayashi, Y.; Suzuki, M.; Satsu, H.; Miyamoto, Y. Regulation of intestinal glucose transport by tea catechins. BioFactors 2000, 13, 61–65. [Google Scholar] [CrossRef]
- Erba, D.; Riso, P.; Bordoni, A.; Foti, P.; Biagi, P.L.; Testolin, G. Effectiveness of moderate green tea consumption on antioxidative status and plasma lipid profile in humans. J. Nutr. Biochem. 2005, 16, 144–149. [Google Scholar] [CrossRef] [PubMed]
- Hashimoto, R.; Yaita, M.; Tanaka, K.; Hara, Y.; Kojo, S. Inhibition of radical reaction of apolipoprotein B-100 and α-tocopherol in human plasma by green tea catechins. J. Agric. Food Chem. 2000, 48, 6380–6383. [Google Scholar] [CrossRef] [PubMed]
- Yee, W.L.; Wang, Q.; Agdinaoay, T.; Dang, K.; Chang, H.; Grandinetti, A.; Franke, A.A.; Theriault, A. Green tea catechins decrease apolipoprotein B-100 secretion from HepG2 cells. Mol. Cell. Biochem. 2002, 229, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Yen, C.F.; Lin, E.C.; Wang, Y.H.; Wang, P.H.; Lin, H.W.; Hsu, J.C.; Wu, L.S.; Jiang, Y.N.; Ding, S.T. Abundantly expressed hepatic genes and their differential expression in liver of prelaying and laying geese. Poult. Sci. 2009, 88, 1955–1962. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhu, W.; Du, Y.; Liu, X.; Geng, Z. Genetic parameters for yolk cholesterol and transcriptional evidence indicate a role of lipoprotein lipase in the cholesterol metabolism of the Chinese Wenchang chicken. Front. Genet. 2019, 10, 902. [Google Scholar] [CrossRef] [PubMed]
- Walzem, R.L.; Hansen, R.J.; Williams, D.L.; Hamilton, R.L. Estrogen induction of VLDLy assembly in egg-laying hens. J. Nutr. 1999, 129, 467S–472S. [Google Scholar] [CrossRef]
- Hermann, M.; Seif, F.; Schneider, W.J.; Ivessa, N.E. Estrogen dependence of synthesis and secretion of apolipoprotein B-containing lipoproteins in the chicken hepatoma cell line, LMH-2A. J. Lipid Res. 1997, 38, 1308–1317. [Google Scholar]
- Schaap, F.G.; Rensen, P.C.N.; Voshol, P.J.; Vrins, C.; van der Vliet, H.N.; Chamuleau, R.A.F.M.; Havekes, L.M.; Groen, A.K.; van Dijk, K.W. ApoAV reduces plasma triglycerides by inhibiting very low density lipoprotein-triglyceride (VLDL-TG) production and stimulating lipoprotein lipase-mediated VLDL-TG hydrolysis. J. Biol. Chem. 2004, 279, 27941–27947. [Google Scholar] [CrossRef]
| Composition % | Group 2 | |
|---|---|---|
| CON | GTP | |
| Soybean | 22.40 | 22.40 |
| Corn | 66.00 | 66.00 |
| Wheat bran | 4.50 | 3.50 |
| Lime powder | 2.00 | 2.00 |
| Premix 1 | 5.00 | 5.00 |
| Green tea powder | 0.00 | 1.00 |
| Nutritional level | ||
| Crude fat % | 4.67 | 4.96 |
| Total energy MJ/kg | 13.07 | 12.99 |
| Crude protein % | 16.49 | 16.48 |
| Ca % 3 | 2.00—3.20 | 2.00—3.20 |
| Gene | Primer Sequences (5’—3’) | Annealing Temperature ℃ | Product Size (bp) |
|---|---|---|---|
| ApoB | CACCATCTAAAGCGTAAACCGAAC | 60 | 196 |
| AAATGGGTGATTTTCAGGGTTTTT | |||
| HMGR | CGTGGAATGGCAATTTTAGGTC | 60 | 116 |
| CCAAAGCAGCACATGATTTCAAG | |||
| LPL | GGAACAGCCAAGAAATGGAACA | 60 | 174 |
| GCAGTGGTCTTGAAGAATGAGC | |||
| β-actin | CTGTGCCCATCTATGAAGGCTA | 60 | 152 |
| ATTTCTCTCTCGGCT-GTGGTG |
| Item | Treatment | Weeks of Age | SEM | p-Value | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 20 | 22 | 24 | 26 | 28 | 30 | 32 | Age | Treatment | Interaction | |||
| EP, % | ||||||||||||
| CON | 1.91 | 3.10 | 6.85 | 28.99 | 50.43 | 56.62 | 56.49 | 0.98 | <0.01 | 0.15 | 0.37 | |
| GTP | 1.48 | 3.70 | 9.94 | 29.68 | 51.63 | 55.84 | 55.68 | |||||
| EW, g | ||||||||||||
| CON | 32.33 d | 33.93 d | 37.94 c | 42.71 b | 44.94 ab | 46.21 a | 47.58 a | 2.30 | <0.01 | 0.27 | <0.01 | |
| GTP | 32.82 d | 36.76 cd | 36.41 cd | 42.62 b | 44.89 ab | 43.84 b | 43.64 b | |||||
| FI, g/d | ||||||||||||
| CON | - | 77.99 | 93.74 | 92.65 | 103.93 | 122.09 | 124.18 | 1.43 | <0.01 | 0.06 | 0.14 | |
| GTP | - | 73.37 | 89.32 | 92.69 | 103.51 | 124.37 | 124.96 | |||||
| FCR | ||||||||||||
| CON | - | 74.15 a | 36.07 c | 7.48 e | 4.58 g | 4.66 g | 4.62 g | 1.07 | <0.01 | 0.023 | <0.01 | |
| GTP | - | 53.94 b | 24.68 d | 7.33 e | 4.47 g | 5.08 f | 5.14 f | |||||
| Treatment | Items | Week of Age | |||
|---|---|---|---|---|---|
| 20 | 24 | 28 | 32 | ||
| CON | Orexin A, pg/mL | 223.3 ± 37.6 | 274.18 ± 50.99B | 296.47 ± 48.68 b | 269.31 ± 52.57 B |
| Glu, mmol/L | 6.86 ± 0.98 | 6.24 ± 0.67A | 6.47 ± 0.79 A | 6.54 ± 0.93 A | |
| FFA, μmol/L | 566.1 ± 83.0 | 562.49 ± 56.44 A | 513.52 ± 76.11 A | 579.64 ± 74.18 A | |
| Apo-B, μg/ml | 782.9 ± 89.5 | 781.55 ± 116.96 a | 908.17 ± 91.34 A | 925.62 ± 112.73 A | |
| Apo-A, μg/mL | 1238.9 ± 245.3 | 1370.5 ± 252.12 B | 1197.8 ± 203.53 B | 1239.5 ± 139.10 B | |
| HDL, mg/dL | 101.8 ± 20.5 | 112.42 ± 17.49 B | 106.35 ± 20.48 B | 105.97 ± 18.30 B | |
| LDL, mmol/L | 3.54 ± 0.70 | 4.88 ± 0.83 | 4.77 ± 0.80 a | 5.39 ± 0.88 A | |
| TG, nmol/L | 6.35 ± 1.08 | 5.70 ± 0.81 A | 6.38 ± 0.95 A | 6.19 ± 0.78 A | |
| TC, mmol/L | 6.76 ± 0.87 | 6.62 ± 1.01 A | 6.42 ± 1.08 A | 7.00 ± 1.20 A | |
| VHDL, mmol/L | 3.15 ± 0.45 | 2.63 ± 0.44 | 2.62 ± 0.49 B | 2.63 ± 0.42 B | |
| GTP | Orexin A, pg/mL | 232.1 ± 46.1 | 321.85 ± 53.15 A | 328.41 ± 35.08 a | 375.98 ± 54.35 A |
| Glu, mmol/L | 6.76 ± 0.89 | 5.03 ± 0.75 B | 5.13 ± 0.93 B | 4.29 ± 0.84 B | |
| FFA, μmol/L | 559.2 ± 81.5 | 453.36 ± 93.85 B | 339.57 ± 111.24 B | 356.92 ± 72.63 B | |
| Apo-B, μg/ml | 735.7 ± 110.0 | 663.50 ± 103.76 b | 641.74 ± 108.14 B | 644.12 ± 95.95 B | |
| Apo-A, μg/mL | 1205.6 ± 290.5 | 1596.8 ± 295.46 A | 1605.2 ± 192.89 A | 1851.6 ± 226.76 A | |
| HDL, mg/dL | 103.7 ± 13.0 | 132.43 ± 17.77 A | 150.68 ± 16.66 A | 153.40 ± 12.39 A | |
| LDL/mmol/L | 388 ± 0.67 | 4.85 ± 0.89 | 4.11 ± 0.87 b | 3.86 ± 0.70 B | |
| TG/nmol/L | 6.53 ± 1.02 | 4.6 ± 0.92 B | 4.32 ± 0.72 B | 3.98 ± 0.90 B | |
| TC/mmol/L | 6.39 ± 0.79 | 5.59 ± 0.82 B | 4.05 ± 0.94 B | 4.32 ± 0.97 B | |
| VHDL/mmol/L | 3.45 ± 0.56 | 2.78 ± 0.42 | 3.24 ± 0.44 A | 3.25 ± 0.3 A | |
| Treatment | Week of Age | Apo-B | HMGR | LPL | |||
|---|---|---|---|---|---|---|---|
| Liver | Follicular Membrane | Liver | Follicular Membrane | Liver | Follicular Membrane | ||
| CON | 20 | 1.64 | 5.06 | 3.24 | 1.22 | 1.14 | 1.05 |
| 24 | 1.80 | 5.24 | 3.67 | 1.19 | 1.08 | 0.88 | |
| 28 | 1.18 | 1.56 | 1.02 | 1.00 | 0.43 | 0.56 | |
| 32 | 1.84 | 1.32 | 1.34 | 0.83 | 0.50 | 0.64 | |
| GTP | 20 | 1.23 | 4.85 | 3.06 | 1.08 | 0.89 | 1.01 |
| 24 | 3.61 | 1.71 | 1.48 | 1.19 | 1.34 | 1.17 | |
| 28 | 2.07 | 1.85 | 1.28 | 0.85 | 2.18 | 2.20 | |
| 32 | 1.00 | 1.01 | 1.00 | 1.01 | 2.04 | 2.28 | |
| SEM | 0.195 | 0.147 | 0.298 | 0.355 | 0.315 | 0.182 | |
| p-value | |||||||
| treatment | 0.504 | 0.291 | 0.197 | 0.346 | 0.037 | 0.490 | |
| age | 0.047 | 0.021 | 0.079 | 0.506 | 0.754 | 0.611 | |
| treatment × age | 0.493 | 0.328 | 0.208 | 0.582 | 0.192 | 0.557 | |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, X.; He, K.; Wei, C.; Yang, W.; Geng, Z. Green Tea Powder Decreased Egg Weight Through Increased Liver Lipoprotein Lipase and Decreased Plasma Total Cholesterol in an Indigenous Chicken Breed. Animals 2020, 10, 370. https://doi.org/10.3390/ani10030370
Chen X, He K, Wei C, Yang W, Geng Z. Green Tea Powder Decreased Egg Weight Through Increased Liver Lipoprotein Lipase and Decreased Plasma Total Cholesterol in an Indigenous Chicken Breed. Animals. 2020; 10(3):370. https://doi.org/10.3390/ani10030370
Chicago/Turabian StyleChen, Xingyong, Kaiqin He, Congcong Wei, Wanli Yang, and Zhaoyu Geng. 2020. "Green Tea Powder Decreased Egg Weight Through Increased Liver Lipoprotein Lipase and Decreased Plasma Total Cholesterol in an Indigenous Chicken Breed" Animals 10, no. 3: 370. https://doi.org/10.3390/ani10030370
APA StyleChen, X., He, K., Wei, C., Yang, W., & Geng, Z. (2020). Green Tea Powder Decreased Egg Weight Through Increased Liver Lipoprotein Lipase and Decreased Plasma Total Cholesterol in an Indigenous Chicken Breed. Animals, 10(3), 370. https://doi.org/10.3390/ani10030370
