Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Delibes-Mateos, M.; Redpath, S.M.; Angulo, E.; Ferreras, P.; Villafuerte, R. Rabbits as a keystone species in southern Europe. Biol. Conserv. 2007, 137, 149–156. [Google Scholar] [CrossRef]
- Gortazar, C.; Millán, J.; Acevedo, P.; Escudero, M.A.; Marco, J.; De Luco, D.F. A large-scale survey of brown hare Lepus europaeus and Iberian hare L. granatensis populations at the limit of their ranges. Wild. Biol. 2007, 13, 244–250. [Google Scholar] [CrossRef][Green Version]
- Ferrer, M.; Negro, J.J. The near extinction of two large European predators: Super specialists pay a price. Conserv. Biol. 2004, 18, 344–349. [Google Scholar] [CrossRef]
- Ministerio de Agricultura, Pesca y Alimentación (MAPA). Available online: https://www.mapa.gob.es/es/desarrollo-rural/estadisticas/caza_pesca.aspx (accessed on 2 November 2020).
- Wang, L.F.; Crameri, G. Emerging zoonotic viral diseases. Rev. Sci. Tech. 2014, 33. [Google Scholar] [CrossRef]
- Jiménez, M.; González, E.; Martín-Martín, I.; Hernández, S.; Molina, R. Could wild rabbits (Oryctolagus cuniculus) be reservoirs for Leishmania infantum in the focus of Madrid, Spain? Vet. Parasitol. 2014, 202, 296–300. [Google Scholar] [CrossRef]
- Fernández-Aguilar, X.; Alzaga, V.; Villanúa, D.; Cabezón, O.; García-Bocanegra, I.; Dubey, J.P.; Almería, S. Epidemiology and prevalence of Toxoplasma gondii infection in the Iberian hare (Lepus granatensis). Vet. Parasitol. 2013, 196, 194–198. [Google Scholar] [CrossRef]
- Molina, R.; Jiménez, M.I.; Cruz, I.; Iriso, A.; Martín-Martín, I.; Sevillano, O.; Melero, S.; Bernal, J. The hare (Lepus granatensis) as potential sylvatic reservoir of Leishmania infantum in Spain. Vet. Parasitol. 2012, 190, 268–271. [Google Scholar] [CrossRef]
- Snowden, K. Microsporidia in higher vertebrates. In Microsporidia: Pathogens of Opportunity; Weiss, L., Becnel, J., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2014; pp. 469–491. [Google Scholar] [CrossRef]
- Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and meta-analysis. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef]
- Santín, M.; Calero-Bernal, R.; Carmena, D.; Mateo, M.; Balseiro, A.; Barral, M.; Barbero, F.L.; Habela, M.Á. Molecular characterization of Enterocytozoon bieneusi in wild carnivores in Spain. J. Eukaryot. Microbiol. 2018, 65, 468–474. [Google Scholar] [CrossRef]
- Weiss, L. Microsporidiosis. In Hunter’s Tropical Medicine and Emerging Infectious Disease, 10th ed.; Magill, A.J., Ryan, E.T., Eds.; Elsevier: Amsterdam, The Netherlands, 2020; pp. 825–831. [Google Scholar] [CrossRef]
- Didier, E.S.; Stovall, M.E.; Green, L.C.; Brindley, P.J.; Sestak, K.; Didier, P.J. Epidemiology of microsporidiosis: Sources and modes of transmission. Vet. Parasitol. 2004, 126, 145–166. [Google Scholar] [CrossRef]
- Bártová, E.; Marková, J.; Sedlak, K. Prevalence of antibodies to Encephalitozoon cuniculi in European hares (Lepus europaeus). Ann. Agric. Environ. Med. 2015, 22, 674–676. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Zanet, S.; Palese, V.; Trisciuoglio, A.; Alonso, C.C.; Ferroglio, E. Encephalitozoon cuniculi, Toxoplasma gondii and Neospora caninum infection in invasive Eastern Cottontail Rabbits Sylvilagus floridanus in Northwestern Italy. Vet. Parasitol. 2013, 197, 682–684. [Google Scholar] [CrossRef] [PubMed]
- Künzel, F.; Joachim, A. Encephalitozoonosis in rabbits. Parasitol. Res. 2010, 106, 299–309. [Google Scholar] [CrossRef] [PubMed]
- De Bosschere, H.; Wang, Z.; Orlandi, P.A. First diagnosis of Encephalitozoon intestinalis and E. hellem in a European brown hare (Lepus europaeus) with kidney lesions. Zoonoses Public Health 2007, 54, 131–134. [Google Scholar] [CrossRef]
- Morsy, E.A.; Salem, H.M.; Khattab, M.S.; Hamza, D.A.; Abuowarda, M.M. Encephalitozoon cuniculi infection in farmed rabbits in Egypt. Acta Vet. Scand. 2020, 62, 1–11. [Google Scholar] [CrossRef]
- Wasson, K.; Peper, R.L. Mammalian microsporidiosis. Vet. Pathol. 2000, 37, 113–128. [Google Scholar] [CrossRef][Green Version]
- Hinney, B.; Sak, B.; Joachim, A.; Kváč, M. More than a rabbit’s tale–Encephalitozoon spp. in wild mammals and birds. Int. J. Parasitol. Parasites Wildl. 2016, 5, 76–87. [Google Scholar] [CrossRef][Green Version]
- Thrusfield, M. Veterinary Epidemiology, 4th ed.; Wiley Backweel: Hoboken, NJ, USA, 2018. [Google Scholar]
- Da Silva, A.J.; Schwartz, D.A.; Visvesvara, G.S.; De Moura, H.; Slemenda, S.B.; Pieniazek, N.J. Sensitive PCR diagnosis of Infections by Enterocytozoon bieneusi (microsporidia) using primers based on the region coding for small-subunit rRNA. J. Clin. Microbiol. 1996, 34, 986–987. [Google Scholar] [CrossRef][Green Version]
- Da Silva, A.J.; Slemenda, S.B.; Visvesvara, G.S.; Schwartz, D.A.; Wilcox, C.M.; Wallace, S.; Pieniazek, N.J. Detection of Septata intestinalis (Microsporidia) using polymerase chain reaction primers targeting the small subunit ribosomal RNA coding region. J. Mol. Diagn. 1997, 2, 47–52. [Google Scholar] [CrossRef]
- Visvesvara, G.S.; Leitch, G.J.; da Silva, A.J.; Croppo, G.P.; Moura, H.; Wallace, S.; Slemenda, S.B.; Schwartz, D.A.; Moss, D.; Bryan, R.T. Polyclonal and monoclonal antibody and PCR-amplified small-subunit rRNA identification of a microsporidian, Encephalitozoon hellem, isolated from an AIDS patient with disseminated infection. J. Clin. Microbiol. 1994, 32, 2760–2768. [Google Scholar] [CrossRef][Green Version]
- De Groote, M.A.; Visvesvara, G.; Wilson, M.L.; Pieniazek, N.J.; Slemenda, S.B.; da Silva, A.J.; Gordon, J.L.; Bryan, R.T.; Reves, R. Polymerase chain reaction and culture confirmation of disseminated Encephalitozoon cuniculi in a patient with AIDS: Successful therapy with albendazole. J. Infect. Dis. 1995, 171, 1375–1378. [Google Scholar] [CrossRef]
- Del Aguila, C.; Izquierdo, F.; Navajas, R.; Pieniazek, N.J.; Miro, G.; Alonso, A.I.; Da Silva, A.J.; Fenoy, S. Enterocytozoon bieneusi in animals: Rabbits and dogs as new hosts. J. Eukaryot. Microbiol. 1999, 46, 8–9. [Google Scholar]
- Askari, Z.; Mirjalali, H.; Mohebali, M.; Zarei, Z.; Shojaei, S.; Rezaeian, T.; Rezaeian, M. Molecular detection and identification of zoonotic microsporidia spore in fecal samples of some animals with close-contact to human. Iran. J. Parasitol. 2015, 10, 381. [Google Scholar] [CrossRef] [PubMed]
- Galván-Díaz, A.L.; Magnet, A.; Fenoy, S.; Henriques-Gil, N.; Haro, M.; Gordo, F.P.; Miró, G.; Del águila, C.; Izquierdo, F. Microsporidia detection and genotyping study of human pathogenic E. bieneusi in animals from Spain. PLoS ONE 2014, 9, e106017. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Lores, B.; Del Aguila, C.; Arias, C. Enterocytozoon bieneusi (microsporidia) in faecal samples from domestic animals from Galicia, Spain. Mem. Inst. Oswaldo Cruz 2002, 97, 941–945. [Google Scholar] [CrossRef][Green Version]
- Dashti, A.; Rivero-Juarez, A.; Santín, M.; López-López, P.; Caballero-Gómez, J.; Frías-Casas, M.; Köster, P.C.; Bailo, B.; Briz, V.; Carmena, D. Enterocytozoon bieneusi (Microsporidia): Identification of novel genotypes and evidence of transmission between sympatric wild boars (Sus scrofa ferus) and Iberian pigs (Sus scrofa domesticus) in Southern Spain. Transbound. Emerg. Dis. 2020. [Google Scholar] [CrossRef]
- Abreu-Acosta, N.; Lorenzo-Morales, J.; Leal-Guio, Y.; Coronado-Álvarez, N.; Foronda, P.; Alcoba-Florez, J.; Izquierdo, F.; Batista-Díaz, N.; Del águila, C.; Valladares, B. Enterocytozoon bieneusi (microsporidia) in clinical samples from immunocompetent individuals in Tenerife, Canary Islands, Spain. Trans. R. Soc. Trop. Med. Hyg. 2005, 99, 848–855. [Google Scholar] [CrossRef]
- Galván, A.L.; Sánchez, A.M.; Valentín, M.P.; Henriques-Gil, N.; Izquierdo, F.; Fenoy, S.; Del Aguila, C. First cases of microsporidiosis in transplant recipients in Spain and review of the literature. J. Clin. Microbiol. 2011, 49, 1301–1306. [Google Scholar] [CrossRef][Green Version]
- Lores, B.; López-Miragaya, I.; Arias, C.; Fenoy, S.; Torres, J.; Del Aguila, C. Intestinal Microsporidiosis Due to Enterocytozoon bieneusi in Elderly Human Immunodeficiency Virus–Negative Patients from Vigo, Spain. Clin. Infect. Dis. 2002, 34, 918–921. [Google Scholar] [CrossRef][Green Version]
- Bednarska, M.; Bajer, A.; Siñski, E.; Wolska-Kusnierz, B.; Samoliñski, B.; Graczyk, T.M. Occurrence of intestinal microsporidia in immunodeficient patients in Poland. Ann. Agric. Environ. Med. 2014, 21, 244–248. [Google Scholar] [CrossRef][Green Version]
- Talabani, H.; Sarfati, C.; Pillebout, E.; van Gool, T.; Derouin, F.; Menotti, J. Disseminated infection with a new genovar of Encephalitozoon cuniculi in a renal transplant recipient. J. Clin. Microbiol. 2010, 48, 2651–2653. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Mathis, A.; Weber, R.; Deplazes, P. Zoonotic potential of the microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Espinosa, J.; Ferreras, M.C.; Benavides, J.; Cuesta, N.; Pérez, C.; García Iglesias, M.J.; García Marín, J.F.; Pérez, V. Causes of Mortality and Disease in Rabbits and Hares: A Retrospective Study. Animals 2020, 10, 158. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Csokai, J.; Joachim, A.; Gruber, A.; Tichy, A.; Pakozdy, A.; Künzel, F. Diagnostic markers for encephalitozoonosis in pet rabbits. Vet. Parasitol. 2009, 163, 18–26. [Google Scholar] [CrossRef]
- Bálent, P.; Halanova, M.; Sedlakova, T.; Valencakova, A.; Cislaková, L. Encephalitozoon cuniculi infection in rabbits and laboratory mice in eastern Slovakia. Bull. Vet. Inst. Pulawy 2004, 48, 113–116. [Google Scholar]
- Pipia, A.P.; Giobbe, M.; Mula, P.; Varcasia, A.; Sanna, G.; Walochnik, J.; Lavazza, A.; Scala, A. Epidemiological and Biomolecular Updates on Encephalitozoon cuniculi in Lagomorpha of Sardinia (Italy). In Veterinary Science: Current Aspects in Biology, Animal Pathology, Clinic, and Food Hygien; Pugliese, A., Gaiti, A., Eds.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 47–50. [Google Scholar] [CrossRef]
- Ebani, V.V.; Poli, A.; Rocchigiani, G.; Bertelloni, F.; Nardoni, S.; Papini, R.A.; Mancianti, F. Serological survey on some pathogens in wild brown hares (Lepus europaeus) in Central Italy. Asian Pac. J. Trop. Med. 2016, 9, 465–469. [Google Scholar] [CrossRef]
- Tsukada, R.; Tsuchiyama, A.; Sasaki, M.; Park, C.H.; Fujii, Y.; Takesue, M.; Hatai, H.; Kudo, N.; Ikadai, H. Encephalitozoon infections in Rodentia and Soricomorpha in Japan. Vet. Parasitol. 2013, 198, 193–196. [Google Scholar] [CrossRef]
Microspodia Species | Primers | Forward Sequence (5′-3′) | Reverse Sequence (5′-3′) | Obtained Amplicon Size | Reference |
---|---|---|---|---|---|
E. bieneusi | EBIEF1/EBIER1 | GAAACTTGTCCACTCCTTACG | CCATGCACCACTCCTGCCATT | 607 | [22] |
E. intestinalis | SINTF/SINTR | TTTCGAGTGTAAAGGAGTCGA | TGCCATGCACTCACAGGCATC | 822 | [23] |
E. hellem | EHELF/EHELR | TGAGAAGTAAGATGTTTAGCA | GTAAAAACACTCTCACACTCA | 547 | [24] |
E. cuniculi | ECUNF/ECUNR | ATGAGAAGTGATGTGTGTGCG | TGCCATGCACTCACAGGCATC | 549 | [25] |
Variable | Categories | Prevalence (No. Positives/Overall) † | ||||
---|---|---|---|---|---|---|
Microsporidia | E. bieneusi | E. intestinalis | E. hellem | E. cuniculi | ||
Species | Iberian hare | 3.8 (3/79) | 0 (0/79) | 3.8 (3/79) | 0 (0/79) | 0 (0/79) |
Wild rabbit | 1.0 (4/383) | 0.8 (3/383) | 0.3 (1/383) | 0 (0/383) | 0 (0/383) | |
Province | Cadiz | 0 (0/56) | 0 (0/56) | 0 (0/56) | 0 (0/56) | 0 (0/56) |
Cordoba | 7.0 (3/43) | 2.3 (1/43) | 4.6 (2/43) | 0 (0/43) | 0 (0/43) | |
Jaen | 2.4 (2/82) | 1.2 (1/82) | 1.2 (1/82) | 0 (0/82) | 0 (0/82) | |
Almeria | 0 (0/52) | 0 (0/52) | 0 (0/52) | 0 (0/52) | 0 (0/52) | |
Malaga | 0 (0/67) | 0 (0/67) | 0 (0/67) | 0 (0/67) | 0 (0/67) | |
Seville | 3.7 (2/54) | 1.8 (1/54) | 1.8 (1/54) | 0 (0/54) | 0 (0/54) | |
Granada | 0 (0/49) | 0 (0/49) | 0 (0/49) | 0 (0/49) | 0 (0/49) | |
Huelva | 0 (0/59) | 0 (0/59) | 0 (0/59) | 0 (0/59) | 0 (0/59) | |
Year | 2015 | 1.2 (4/349) | 0.9 (3/349) | 0.3 (1/349) | 0 (0/349) | 0 (0/349) |
2016 | 0 (0/1) | 0 (0/1) | 0 (0/1) | 0 (0/1) | 0 (0/1) | |
2017 | 0 (0/33) | 0 (0/33) | 0 (0/33) | 0 (0/33) | 0 (0/33) | |
2018 | 3.8 (3/79) | 0 (0/79) | 3.8 (3/79) | 0 (0/79) | 0 (0/79) | |
Age | Yearling | 5.0 (1/20) | 0 (0/20) | 5.0 (1/20) | 0 (0/20) | 0 (0/20) |
Subadult | 1.6 (1/62) | 1.6 (1/62) | 0 (0/62) | 0 (0/62) | 0 (0/62) | |
Adult | 1.1 (4/366) | 0.6 (2/366) | 0.6 (2/366) | 0 (0/366) | 0 (0/366) | |
Sex | Female | 0.9 (2/235) | 0.4 (1/235) | 0.4 (1/235) | 0 (0/235) | 0 (0/235) |
Male | 1.9 (4/212) | 0.9 (2/212) | 0.9 (2/212) | 0 (0/212) | 0 (0/212) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Martínez-Padilla, A.; Caballero-Gómez, J.; Magnet, Á.; Gómez-Guillamón, F.; Izquierdo, F.; Camacho-Sillero, L.; Jiménez-Ruiz, S.; del Águila, C.; García-Bocanegra, I. Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain. Animals 2020, 10, 2218. https://doi.org/10.3390/ani10122218
Martínez-Padilla A, Caballero-Gómez J, Magnet Á, Gómez-Guillamón F, Izquierdo F, Camacho-Sillero L, Jiménez-Ruiz S, del Águila C, García-Bocanegra I. Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain. Animals. 2020; 10(12):2218. https://doi.org/10.3390/ani10122218
Chicago/Turabian StyleMartínez-Padilla, Anabel, Javier Caballero-Gómez, Ángela Magnet, Félix Gómez-Guillamón, Fernando Izquierdo, Leonor Camacho-Sillero, Saúl Jiménez-Ruiz, Carmen del Águila, and Ignacio García-Bocanegra. 2020. "Zoonotic Microsporidia in Wild Lagomorphs in Southern Spain" Animals 10, no. 12: 2218. https://doi.org/10.3390/ani10122218