Next Article in Journal
Organic Dairy Cattle: Do European Union Regulations Promote Animal Welfare?
Next Article in Special Issue
Phenylalanine and Tyrosine as Feed Additives for Reducing Stress and Enhancing Welfare in Gilthead Seabream and Meagre
Previous Article in Journal
The Differential Composition of Whey Proteomes in Hu Sheep Colostrum and Milk during Different Lactation Periods
Previous Article in Special Issue
Evaluation of an Acute Osmotic Stress in European Sea Bass via Skin Mucus Biomarkers
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus)

Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Harbin 150070, China
*
Author to whom correspondence should be addressed.
Animals 2020, 10(10), 1785; https://doi.org/10.3390/ani10101785
Submission received: 25 August 2020 / Revised: 12 September 2020 / Accepted: 19 September 2020 / Published: 1 October 2020
(This article belongs to the Collection New Approaches to Fish Welfare)

Simple Summary

Goldfish (Carassius auratus) is a well-known fish as food and as a pet, which is also frequently used as experimental animal. A unique mtDNA sequence was detected in a sample from our experimental station, which motivated us to study genetic constitution of goldfish in Northeast Asia. Three divergent mtDNA lineages were confirmed to coexist in this region. Two of which corresponded to the known lineages (C2 and C6), which was consistent with the zoogeographical records that there were two sympatric subspecies in Amur river basin. However, the third one (lineage C7) was largely neglected in the previous studies. Our results suggested lineage C7 had a wide distribution from Central Asia to Northeast Asia.

Abstract

Goldfish (Carassius aurautus), which is a middle size cyprinid, widely distribute throughout Eurasia. Phylogeographic studies using mtDNA markers have revealed several divergent lineages within goldfish. In this study, mtDNA variations were determined to elucidate the phylogeographical pattern and genetic structure of goldfish in Northeast Asia. A total of 1054 individuals from Amur river basin were analyzed, which including five newly collected populations and four previously reported populations. Three distinct mtDNA lineages were identified in those samples, two of which corresponded to two known lineages C2 and C6, respectively. The third lineage referred to as C7, following six known lineages of goldfish in mainland Eurasia. AMOVA results suggested that most of the genetic variations were among lineages, rather than among populations or twice samplings. We noted that the control region (CR) and cytochrome b (cytb) sequences of lineage C7 have been reported in previous studies, respectively. However, the evolutionary position and distribution pattern of this lineage was not discussed in the context of the species. Our results showed that “odd” CR and “hidden” cytb sequences from Central Asia represent the same mtDNA lineage of goldfish. The known samples of C7 lineage were collected from Central Asia (Eastern Kazakhstan and Western Mongolia) to East Asia (Northeast China and Far East Russia), which suggested that it had a wider distribution, rather than limit in Central Asia.

1. Introduction

Fishes of genus Carassius populate a wide variety of habitats throughout Eurasia, especially in East Asia. Nowadays, three species are generally considered to be valid in this genus: C. carassius, C. auratus and C. cuvieri [1,2,3,4]. Crucian carp (C. carassius), which is native to parts of Europe and Central Asia, can be diagnosed from its congeners with the free edge of the dorsal and tail fins were convex [1,3]. Goldfish (C. auratus) could be found from Asia to Europe, which usually further deiminated into a few subspecies [1,2,3,4]. However, it is difficult to classify goldfish into further lower taxonomic categories, because of their highly variable morphology, wide distribution, variable ploidy levels and complex reproduction modes [1,2,3,4,5,6,7]. Japanese white crucian carp (C. cuvieri) was previously regarded as a subspecies of C. aurautus [8]. A growing number of literatures treated it as a valid species, due to its genetic independence and limited distribution [9,10,11].
Wild goldfish are distributed in many regions of Eurasia, including Japanese archipelago and other East Asia affiliated islands. Ichthyologists have recognized that the goldfish in the Eurasia continent are divergent from that in Japanese archipelago for a long time [1,2]. Goldfish in Eurasia—excluding Japan—and, in particular, China are usually divided into two subspecies (C. auratus auratus and C. auratus gibelio) [1]. Goldfish in the Japanese archipelago can be classified into several other subspecies [2].
Mitochondrial DNA (mtDNA) is marker of choice in phylogeography and population genetics of animals [12,13], which has been proved to be a powerful tool in genetic studies of goldfish [4,9,10,11,14,15,16,17,18]. Molecular evidences supported that goldfish in Japanese archipelago and mainland Eurasia were clustered into two distinct clades, hereafter referred to as the Japanese clade (B) and Continental clade (C) [14,15]. It was suggested that the disappearance of land bridges in the Tsushima Strait around 3.0 Ma may be responsible for the separation of Japanese clade and Continental clade of C. auratus [15]. Furthermore, there were several lineages identified within the two major clades, respectively [14,15].
As mentioned by Takada et al. [14], an “odd” sequence of control region (CR) identified from Kazakhstan by Sakai et al. [16], would change the tree topologies of goldfish during phylogenetic analysis. This “odd” CR sequence was excluded from their study since its phylogenetic position was thought to be extremely unstable. The CR sequence of a sample from experimental station of Heilongjiang Fisheries Research Institute, was closely related to the “odd” CR sequence from Kazakhstan. Though, control region and cytochrome b (cytb) gene were the two most frequently used mitochondrial markers in phylogeographic and genetic studies of goldfish, however, most studies were only based on one or the other, which made data of these studies hard to be compared or reanalyzed together. We also sequenced the cytb gene of the sample in our experimental station. It was unexpected that its cytb sequence was related to “hidden” cytb sequences (“C. gibelio II”) identified by Kalous et al. [17]. Thus, mtDNA of this sample suggested that subspecies “M” by Sakai et al. [16] and “C. gibelio II” by Kalous et al. [17] seem to represent the same lineage of goldfish. It is hard for us to come to this conclusion based on only a single sample. Unfortunately, both Sakai et al. [16] and Kalous et al. [17] only analyzed a limited portion of known goldfish lineages (see Table S1). After the seven lineages reported by Takada et al. [14], a few additional lineages have been identified in goldfish [15]. Additionally, the “odd” CR and “hidden” cytb sequences were collected from Central Asia. However, our sample was unlikely to be from Central Asia, as it was more than 3000 km away from our experimental station.
The hypothesis for the study was that the unique sample in our experimental station was unintentionally collected from Northeast Asia, where our experimental station located. By reanalysis of CR sequences of another previous study [18], we found that one of three lineages were close to the “odd” CR sequence described above. Thus, we further collected samples from the similar region followed Jiang et al [18]. The first goal of the present study was to elucidate genetic structure in Northeast Asia and find more samples of each lineages. The second goal was to test if the “odd” CR sequence of Sakai et al. [16] and “hidden” cytb sequences of Kalous et al. [17] represent the same lineage of goldfish. The results of our study will provide new insights into the biogeography and evolution of goldfish. We found a relatively small but not negligible amount of C. auratus samples in this region hold CR sequences that are close to the “odd” CR sequence from Kazakhstan. All available cytb sequences of these samples cluster with “hidden” cytb sequences of Kalous et al. [17]. Thus, an additional mitochondrial lineage, which was not included in six continental lineages (C1-C6) in mainland Eurasia, was confirmed, and thought to be widely distributed from Central Asia to Northeast Asia.

2. Materials and Methods

2.1. Sample Collection

We collected fin clips of 668 goldfish from 5 localities of the middle reaches of the Amur river basin and surrounding areas. Control region sequences of mtDNA of Jiang et al. [18] were retrieved, because these samples were collected from a similar region and provided background information. Thus, a total of 1054 individuals from 9 populations collected from this region were analyzed in this study. Geographical distribution and lineage constitution of 9 populations were indicated in Figure 1. Fin clips were preserved in 95% ethanol. All animal procedures in this study were conducted according to the guidelines for the care and use of laboratory animals of Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences (CAFS). The studies in animals were reviewed and approved by the Committee for the Welfare and Ethics of Laboratory Animals of Heilongjiang River Fisheries Research Institute, CAFS.

2.2. Molecular Methods

Genomic DNA was extracted by the standard phenol-chloroform method from ethanol-fixed fin clips. PCR and sequencing primers were listed in Table 1. Control region was amplified with the primer pair L15923 [19] and Hl6500 [20] followed the previous studies. Cytochrome b gene was sequenced in a represented subset of samples in our laboratory with primer pair L14724 [21] and H15915 [21]. PCR were performed in a 30 μL volumes with 1x final concentrations of PCR mixture (Cowin bioscience, Beijing, China), 0.3 μM of each primer and ~30 ng genomic DNA. Amplifications were performed on the GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA, USA) with the following PCR profile: An initial denaturation 94 °C for 2 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s and extension at 72 °C for 1 min, followed by a final extension at 72 °C for 7 min. Primers 16500F and 15372F were designed for the sequencing control region and cytochrome b gene, respectively. After being purified, PCR products were sequenced using the ABI 3730xl sequencing system. Then, raw trace files were revised using the software Finch TV (Geospiza, Inc.).

2.3. Population Genetic Analyses

DNA sequences were aligned using the MUSCLE program with default parameters [22]. DNAsp v6 [23] was used to identify unique CR haplotypes. Obtained sequence data were deposited in the GenBank database under Accession Numbers MT199236-MT199260. Number of segregating sites (S), mean number of nucleotide differences (K), Haplotype diversity (Hd) and Nucleotide diversity (π) and pairwise differentiation (ΦST) between populations were calculated using Arlequin v3.5 [24]. Analysis of molecular variance (AMOVA), implemented in Arlequin, was used to estimated hierarchical structuring genetic variations. Two different partitions of datasets were applied into AMOVA. First, we determined the variation partitioned between geographical regions according to the sampling site. Since the time interval of twice samplings was about 10 years, we took them as two independent groups, which allowed us to test whether there was a significant temporal difference. Phylogenetic analysis based on mtDNA revealed that there were three distinct mtDNA lineages in this region. The second partition investigated variation between and within the three lineages.

2.4. Phylogenetic Analyses

To clarify haplotype phylogenetic relationship in the context of genus Carassius, DNA sequences identified by a couple of the previous studies were involved in phylogenetic analyses. Detailed information about DNA sequences used in the phylogenetic analysis can be found in Supplementary Materials Table S1. Three different datasets were subjected to phylogenetic analysis: (1) control region (CR) sequences; (2) cytb sequences; and (3) concatenated CR and cytb sequences. Each dataset was analyzed using neighbor-joining (NJ), maximum likelihood (ML) and Bayesian inference (BI) method, respectively. The neighbor-joining method was implemented in the MEGA-X package [25], using the distances corrected based on the maximum composite likelihood model. Branch supports for NJ trees were measured by bootstrap analysis with 1000 random replicates. We inferred the maximum-likelihood tree by combining ModelFinder, tree search, SH-aLRT test and ultrafast bootstrap with 1000 replicates in IQ-TREE [26]. Bayesian inference was performed using MrBayes [27] under the optimized model determined by the mrModelTest [28] program according to Akaike information criterion for each dataset. Monte Carlo Markov chains run for 10,000,000 generations starting from a random tree. Trees and parameters were sampled every 100 generations. The first 25% of the trees were discarded as burn-in and the remaining trees were used to generate a consensus tree. Branch support for BI trees was based on posterior probabilities (PP). Median-joining algorithm implemented in Network 5.0 was used to reconstruct evolutionary relationships of CR haplotypes.

3. Results

3.1. Genetic Diversity

Out of the 357bp aligned sequences, 56 nucleotide positions were variable. Indels were observed in 24 sites, and a 18bp-indel was observed in the 5′ end of two haplotypes. Transitions and transversions occurred in 37 and 2 sites, respectively. The pattern of polymorphism indicating that different types of variation reoccurred in some loci and there was a strong transitional bias. A total of 58 unique haplotypes were identified from 1054 CR sequences. Thirty-nine of 58 haplotypes were detected from our newly collected samples and 35 were reported by Jiang et al. [18]. Thus, 16 haplotypes were shared between our samples and Jiang et al. [18]. Details of genetic diversity were summarized in Table 2. The average haplotype diversity of nine populations was 0.676 ± 0.016, with values ranged from 0.208 ± 0.054 to 0.878 ± 0.013. The average nucleotide diversity (π) of total populations was 1.798 ± 0.942(%), with values ranged from 0.396 ± 0.271(%) to 2.197 ± 1.142(%).

3.2. Genetic Structure

Population distribution of CR haplotypes was presented in Table 3. As shown, the most common haplotype (JN790649) was found in 55.9% samples, and the haplotype was dominant in twice samplings by us and Jiang et al. [18]. CR haplotype network showed three divergent haplotype clusters, consistent with results of phylogenetic analysis (Figure 2). The dominant haplotype (JN790649) was core of lineage C2 in this region, which was surrounded by a star-like pattern. As shown in Figure 1 and Table 3, lineages C2 and C6 account for almost half of samples in populations MS and XI, while population SII mainly consists of lineages C2 and C7. With the above three exceptions, the other populations were mainly composed of lineage C2. Population structure and geographical subdivision of goldfish in the Northeast Asia were estimated based on ΦST (Table 4). Pairwise ΦST were ranged from 0.024 (between FY and XII) to 0.656 (between FY and XI), and most populations showed significant differentiation.
AMOVA results (Table 5), indicated that the differentiations of three lineages could explained majority of the total genetic variance (88.7%). There was no significant difference between the twice samplings (ΦCT = -0.025, p = 0.423 ± 0.015). This can be verified by dominant haplotype (JN790649) in twice samplings was the same (Table 3). The AMOVA results also found that a substantial proportion of molecular variance was attributable to differences among populations (ΦST = 0.326).

3.3. Phylogeny of Carassius Auratus Complex

The trees generated from NJ, ML and BI analyses are highly congruent with each other for the same dataset. For concatenated dataset, all trees revealed four major clades, which corresponding to C. carassius, C. cuvieri (Clade A in Gao et al. [15]), Japanese C. auratus (clade B) and continental C. auratus (clade C). As shown in Figure 3, C. carassius deepest split from others clades, and C. cuvieri was a sister taxon to the two major clades (B and C) of C. auratus. Clade B, mainly including samples from the main islands of Japan and northern Ryukyus. Clade C, containing specimens from Eurasian continent, Taiwan and the south-central Ryukyus islands, which further subdivide into seven lineages. Four lineages (C2, C3, C4, C6) were identified by Takada et al. [14], and two additional lineages (C1 and C5) were reported by Gao et al. [15] The remaining lineage (C7) was defined by this study and followed the known six lineages. A total of 12 haplotypes of lineage C7 were identified in this study, including 8 haplotypes from Jiang et al. [18] and 4 haplotypes from ours. However, there was no haplotype shared between the twice samplings (Table 3). In SII population, 52 out of 90 individuals were from lineage C7, but there were only 7 individuals belonged to lineage C7 in our collection (a total of 668 individuals). All CR sequences of these 7 samples were closely related to “odd” CR of Sakai et al. [16], and their cytb sequences were like that of "C. gibelio II" [17]. One of the seven samples had identical CR and cytb haplotypes to those of the unique sample in our experimental station. Our results supported that “odd” CR of Sakai et al. and “hidden” cytb sequences of Kalous et al. represent the same lineage [16,17], which were neglected by Takada et al. [14] and further studies [15,18,29].
Trees based on the sequences of cytb gene corroborated the existence of distinct lineages in goldfish as revealed by the concatenated dataset. For cytb dataset, a remarkable difference between NJ tree and the two other trees (ML and BI) was the position of clade A (corresponding to C. cuvieri). In NJ tree based on cytb sequences, clade A is closer to the Japanese clade (B) than to the Continental clade (C), rather than a sister clade to the whole C. auratus as shown in NJ tree based on concatenate sequences (see Figure S1). In trees based on the CR sequences, all lineage could be retrieved, but the relationship among lineages within C. auratus could not be clearly resolved (see Figure S2). This discrepancy probably due to saturation which has been mentioned in previous studies [14].

4. Discussion

In this study, we elucidated mtDNA variations of goldfish in Northeast Asia, then revised the phylogeny of genus Carassius. Crucian carp (C. carassius) formed a deep divergent clade, which supported crucian carp is the most distinct species within this genus [1,3,4]. For all three datasets, Japanese white crucian carp (C. cuvieri) formed another major clade, but the phylogenetic position of this taxon is not stable. In most trees, C. cuvieri was a sister taxon to the whole C. auratus, including Japanese clade (B) and continental clade (C). In NJ tree based on cytb sequences (Figure S1), C. cuvieri is closer to the Japanese clade than the continent clade. Japanese crucian carp used to be a subspecies of C. auratus [8], but was regarded as a valid species now [9,10,11]. Almost all phylogenic and population studies indicated Japanese white crucian carp was a distinct taxon, but many studies based on cytb sequences also suggested C. cuvieri are genetically closer to Japanese C. auratus than non-Japanese ones [17,30,31]. We tend to regard Japanese white crucian carp as a valid species, but its taxonomy may need further confirm, since its differences from other groups of Carassius auratus are relatively small [2,8].
The samples of C. auratus native to Japan’s islands and North Ryukyu islands formed the clade B, which were divergent from goldfish in mainland Eurasia. In Japan, fishes of C. auratus have been classified into several subspecies [2,8] based on morphological and genetical criteria, such as ginbuna (C. a. langsdorfii), kinbuna (C. a. subsp), nagabuna (C. a. burgeri) and nigorobuna (C. a. grandoculis). Though distinct lineages can be further detected in Japanese clade, no exact match between the above subspecies and lineage was confirmed in Japanese clade [9,10,11,14]. The classification criteria among these subspecies are very vague. For example, Japanese ichthyologists tend to take gynogenetic reproduction and polyploidy as diagnostic characteristics of C. a. langsdorfii [2]. However, previous studies have revealed that gynogenetic polyploids in all three known lineages within Japanese clade, and a sizable chunk of haplotypes were shared between polyploids and diploids [14,15,29].
In Continent clade, multiple mitochondrial lineages, which were associated to geographical distribution, have also been identified. Ichthyologists traditionally divided C. auratus in Eurasia into two subspecies: C. auratus auratus and C. auratus gibelio [1,3]. Among continental clade, lineages C2 and C6 are the most widely distributed ones, and thought to be associated with above two subspecies, respectively [14,15,16,17,32]. Subspecies C. auratus auratus is naturally distributed in all parts of China outside the Qinghai Tibet Plateau [1]. Besides lineage C6, there were a couple of cryptic lineages have been found within the native range of C. auratus auratus. Gao et al. have identified lineage C5 distributed in the middle and lower reaches of the Yangtze River, and lineage C1 distributed in Fujian, Vietnam [15]. Meanwhile. The majority of C. auratus from south Ryukyu Islands (lineage C4) and Taiwan island (lineage C3) also belong to the continental superclade [15]. Subspecies C. auratus gibelio, thought to be widespread, at least from central Europe to East Asia, but exact limits are not clear [3,33]. The native distribution of C. auratus gibelio in China is limited to the Amur river basin and the Irtysh river basin [1]. Consistent with Jiang et al. [18], three distinct mitochondrial lineages were also detected in newly sampled individuals in this study. According to zoogeographical records, the Northeast Asia is an overlapping range of the C. auratus auratus and C. auratus gibelio [1]. Among three mitochondrial lineages we identified, two lineages just corresponded to C. auratus auratus (lineage C6) and C. auratus gibelio (lineage C2), respectively. However, the third lineage was clustered with the “odd” CR detected by Saikai et al. [16]. We sequenced the cytochrome B gene of the corresponding samples and found that they exclusively belonged to “C. gibelio II” reported by Kalous et al. [17]. These results suggested that subspecies “M” of Saikai et al. [16] and “C. gibelio II” of Kalous et al. [17] represent the same mtDNA lineage. We referred to this new lineage as C7 followed the order of Gao et al, which was not included in the phylogenetic trees constructed by Gao et al. [15]
As mentioned above, our samples were collected from Northeast Asia (Amur river basin), but samples of lineage C7 were also found in Central Asia (Kazakhstan, Mongolia) [16,17]. The localities of the samples suggested that lineage C7 seems to be widely distribute across mid-latitude Asia from central to northeast. Thus, the distribution of lineage C7 is high overlapped with that of lineage C2. The first description of C. auratus gibelio by Bloch (1782) was based on samples collected from “Churmark, Pommern, Schlesien und Preussen” (historical areas of eastern and central Europe) [17]. However, it has also been proposed that C. auratus gibelio was introduced from East Asian, rather than native to Europe [16,33]. Sakai et al. suggested that subspecies “M” (lineage C7) seem to be a native form, probably the same fish that was recorded as C. auratus gibelio by Bloch (1782) [16]. Unfortunately, the type specimens C. auratus gibelio has been lost, and the original syntype has been replaced by a specimen of C. carassius during former investigations [17]. A specimen ZMB 33979 was designate as neotype of C. auratus gibelio, because the neotype comes from part of the type locality and corresponds in all investigated morphologic characters to the description given by Bloch (1782). However, mtDNA of the neotype belong to “Europe-China clade of C. gibelio” (lineage C2) rather than the “Mongolian clade” (lineage C7) [17]. One hypothesis is that lineage C2 originated from the east side of the Mongolian Plateau and C7 originated from west side, then range expansion or artificial introductions of lineages C2 and C7 led to the present pattern. The above scenario or other assumptions may be true, but the currently available data is not enough to draw a conclusion.

5. Conclusions

A unique mtDNA from a sample of our experimental station promoted us to investigated the genetic diversity and phylogeny of goldfish in Northeast Asia. Our results confirmed that there were three divergent mitochondrial lineages in this region. Two of which correspond to the known lineages C2 and C6, respectively. The remaining third lineage posed CR sequences close to that of Sakai et al. Our results suggested the “odd” CR sequences by Sakai et al. [17] and “hidden” cytb sequences by Kalous et al. [18] were from the same lineage of goldfish. This lineage was referred to as C7 followed six known lineages in mainland Eurasia. Considering the distribution of sampling sites, the C7 lineage is likely to widely distribute from Central Asia to Northeast Asia.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2615/10/10/1785/s1, Table S1: DNA sequences of control region and cytochrome b gene used in phylogenetic analysis in this study, Figure S1: Phylogeny of the genus Carassius based on sequences of cytb gene, Figure S2: Phylogeny of the genus Carassius based on sequences of control region.

Author Contributions

Conceptualization, L.C.; methodology, L.C., L.W. and X.Y.; resources, C.L. (Cuiyun Lu) and C.L. (Chao Li); writing-original draft preparation, L.C.; funding acquisition, L.C.. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Central-Level Non-profit Scientific Research Institutes Special Funds (grant number HSY201703M); National Natural Science Foundation of China (grant number 31601853) and Special Fund from Chinese Ministry of Agriculture and Rural Affairs (Survey of fishery resources and environment in key waters of Northeast China).

Acknowledgments

We would like to thank Tangbing Huo for assistant during sample collection and Yuan Yu for technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Luo, Y.L.; Yue, P.Q. Cyprininae in Fauna Sinica, Osteichthyes, Cypriniformes; Yue, P.Q., Ed.; Science Press: Beijing, China, 2000; pp. 427–434. (In Chinese) [Google Scholar]
  2. Hosoya, K. Cyprinidae in Fishes of Japan with Pictorial Keys to the Species; Nakabo, T., Ed.; Tokai University Press: Tokyo, Japan, 2002; pp. 253–254. (In Japanese) [Google Scholar]
  3. Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Kottelat, Cornol and Freyhof: Berlin, German, 2007; pp. 142–147. [Google Scholar]
  4. Cheng, L.; Chang, Y.M.; Lu, C.Y.; Cao, D.C.; Sun, X.W. DNA barcoding and species and subspecies classification within genus Carassius. Zool. Res. 2012, 33, 463–472. (In Chinese) [Google Scholar] [CrossRef]
  5. Golovinskaya, K.A.; Romashov, D.D.; Cherfas, N.B. Unisexual and Bisexual Forms of Silver Crucian Carp (Carassius auratus gibelio Bloch). Vopr. Ikhtiol. 1965, 5, 614–629. [Google Scholar]
  6. Kobayasi, H.; Kawashima, Y.; Takeuchi, N. Comparative chromosome studies in the genus Carassius, especially with a finding of polyploidy in the ginbuna (C. auratus langsdorfii). Jpn. J. Ichthyol. 1970, 17, 153–160. [Google Scholar]
  7. Xiao, J.; Zou, T.M.; Chen, Y.B.; Chen, L.; Liu, S.J.; Tao, M.; Zhang, C.; Zhao, R.R.; Zhou, Y.; Long, Y.; et al. Coexistence of diploid, triploid and tetraploid crucian carp (Carassius auratus) in natural waters. BMC Genet. 2011, 12, e20. [Google Scholar] [CrossRef] [PubMed]
  8. Nakamura, M. Keys to the Freshwater Fishes of Japan Fully Illustrated in Colors; Hokuryukan: Tokyo, Japan, 1982; pp. 140–142. (In Japanese) [Google Scholar]
  9. Murakami, M.; Matsuba, C.; Fujitani, H. The maternal origins of the triploid ginbuna (Carassius auratus langsdorfi): Phylogenetic relationships within the C. auratus taxa by partial mitochondrial D-loop sequencing. Gen. Genet. Syst. 2001, 76, 25–32. [Google Scholar] [CrossRef] [PubMed]
  10. Iguchi, K.; Yamamoto, G.; Matsubara, N.; Nishida, M. Morphological and genetic analysis of fish of a Carassius complex (Cyprinidae) in Lake Kasumigaura with reference to the taxonomic status of two all-female triploid morphs. Biol. J. Linn. Soc. 2003, 79, 351–357. [Google Scholar] [CrossRef]
  11. Yamamoto, G.; Takada, M.; Iguchi, K.; Nishida, M. Genetic constitution and phylogenetic relationships among Japanese crucian carps (Carassius). Ichthyol. Res. 2010, 57, 215–222. [Google Scholar] [CrossRef]
  12. Galtier, N.; Nabholz, B.; Glémin, S.; Hurst, G.D. Mitochondrial DNA as a marker of molecular diversity: A reappraisal. Mol. Ecol. 2009, 18, 4541–4550. [Google Scholar] [CrossRef]
  13. Borzée, A.; Fong, J.J.; Nguyen, H.Q.; Jang, Y. Large-Scale Hybridisation as an Extinction Threat to the Suweon Treefrog (Hylidae: Dryophytes suweonensis). Animals 2020, 10, 764. [Google Scholar] [CrossRef]
  14. Takada, M.; Tachihara, K.; Kon, T.; Yamamoto, G.; Iguchi, K.; Miya, M.; Nishida, M. Biogeography and evolution of the Carassius auratus-complex in East Asia. BMC Evol. Biol. 2010, 10, e7. [Google Scholar] [CrossRef]
  15. Gao, Y.; Wang, S.Y.; Luo, J.; Murphy, R.W.; Du, R.; Wu, S.F.; Zhu, C.L.; Li, Y.; Poyarkov, A.D.; Nguyen, S.N.; et al. Quaternary palaeoenvironmental oscillations drove the evolution of the Eurasian Carassius auratus complex (Cypriniformes, Cyprinidae). J. Biogeogr. 2012, 39, 2264–2278. [Google Scholar] [CrossRef]
  16. Sakai, H.; Iguchi, K.; Yamazaki, Y.; Sideleva, V.G.; Goto, A. Morphological and mtDNA sequence studies on three crucian carps (Carassius: Cyprinidae) including a new stock from the Ob River system, Kazakhstan. J. Fish Biol. 2009, 74, 1756–1773. [Google Scholar] [CrossRef] [PubMed]
  17. Kalous, L.; Bohlen, J.; Rylková, K.; Petrtýl, M. Hidden diversity within the Prussian carp and designation of a neotype for Carassius gibelio (Teleostei: Cyprinidae). Ichthyol. Explor. Fres. 2012, 23, 11–18. [Google Scholar]
  18. Jiang, F.F.; Wang, Z.W.; Zhou, L.; Jiang, L.; Zhang, X.J.; Apalikova, O.V.; Brykov, V.A.; Gui, J.F. High male incidence and evolutionary implications of triploid form in northeast Asia Carassius auratus complex. Mol. Phylogenet. Evol. 2013, 66, 350–359. [Google Scholar] [CrossRef] [PubMed]
  19. Iguchi, K.; Tanimura, Y.; Nishida, M. Sequence divergence in the mtDNA control region of amphidromous and landlocked forms of ayu. Fish Sci. 1997, 63, 901–905. [Google Scholar] [CrossRef][Green Version]
  20. Nishida, M.; Ohkawa, T.; Iwata, H. Methods of Analysis of genetic population structure with mitochondrial DNA markers. Fish Genet. Breed Sci. 1998, 26, 81–100. [Google Scholar]
  21. Xiao, W.; Zhang, Y.; Liu, H. Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): Taxonomy, biogeography, and coevolution of a special group restricted in East Asia. Mol. Phylogenet. Evol. 2001, 18, 163–173. [Google Scholar] [CrossRef]
  22. Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
  23. Julio, R.; Albert, F.M.; Juan, C.S.; Sara, G.R.; Pablo, L.; Sebastián, E.R.; Alejandro, S. DnaSP v6: DNA Sequence Polymorphism Analysis of Large Datasets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar]
  24. Excoffier, L.; Laval, G.; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinform. 2005, 1, 47–50. [Google Scholar] [CrossRef]
  25. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  26. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
  27. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, L.D.; Darling, A.; Hohna, S.; Larget, B.; Liu, L.; Suchard, A.M.; Huelsenbeck, P.J. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  28. Nylander, J.A.A. MrModeltest v2. Program Distributed by the Author; Evolutionary Biology Centre, Uppsala University: Uppsala, Sweden, 2004. [Google Scholar]
  29. Liu, X.L.; Li, X.Y.; Jiang, F.F.; Wang, Z.W.; Li, Z.; Zhang, X.J.; Zhou, L.; Gui, J.F. Numerous mitochondrial DNA haplotypes reveal multiple independent polyploidy origins of hexaploids in Carassius species complex. Ecol. Evol. 2017, 7, 10604–10615. [Google Scholar] [CrossRef] [PubMed]
  30. Rylkova, K.; Kalous, L.; Bohlen, J.; Lamatsch, D.K.; Petrtýl, M. Phylogeny and biogeographic history of the cyprinid fish genus Carassius (Teleostei: Cyprinidae) with focus on natural and anthropogenic arrivals in Europe. Aquaculture 2013, 380–383, 13–20. [Google Scholar] [CrossRef]
  31. Ribeiro, F.; Rylkova, K.; Morenovalcarcel, R.; Carrapato, C.; Kalous, L. Prussian carp Carassius gibelio: A silent invader arriving to the Iberian Peninsula. Aquat. Ecol. 2015, 49, 99–104. [Google Scholar] [CrossRef]
  32. Wang, S.Y.; Luo, J.; Murphy, R.W.; Wu, S.F.; Zhu, C.L.; Gao, Y.; Zhang, Y.P. Origin of Chinese goldfish and sequential loss of genetic diversity accompanies new breeds. PLoS ONE 2013, 8, e59571. [Google Scholar] [CrossRef] [PubMed]
  33. Kottelat, M. Fishes of Mongolia. A Check-List of the Fishes Known to Occur in Mongolia with Comments on Systematics and Nomenclature; World Bank: Washington, DC, USA, 2006; pp. 27–28. [Google Scholar]
Figure 1. Geographical distribution and lineage constitution of each Carassius auratus population in this study. Codes for sampling localities are as follows: Fuyuan (FY); Fujin (FJ); Raohe (RH); Mishan (MS); Xingkaihu (XI); Suifenhe (SI); Huifahe (HFH); Xingkaihu in Russia (XII); Suifenhe in Russia (SII). Each lineage is uniquely colored as shown in the figure.
Figure 1. Geographical distribution and lineage constitution of each Carassius auratus population in this study. Codes for sampling localities are as follows: Fuyuan (FY); Fujin (FJ); Raohe (RH); Mishan (MS); Xingkaihu (XI); Suifenhe (SI); Huifahe (HFH); Xingkaihu in Russia (XII); Suifenhe in Russia (SII). Each lineage is uniquely colored as shown in the figure.
Animals 10 01785 g001
Figure 2. (A) median-joining network of 58 CR haplotypes of goldfish (Carassius aurautus) in Northeast Asia based on CR sequences. Each line-segment represents a single base pair change. There was a 18 bp indel in two haplotypes of lineage C2. (B) neighbor-joining (NJ) phylogeny of 58 CR haplotypes of goldfish (Carassius aurautus).
Figure 2. (A) median-joining network of 58 CR haplotypes of goldfish (Carassius aurautus) in Northeast Asia based on CR sequences. Each line-segment represents a single base pair change. There was a 18 bp indel in two haplotypes of lineage C2. (B) neighbor-joining (NJ) phylogeny of 58 CR haplotypes of goldfish (Carassius aurautus).
Animals 10 01785 g002
Figure 3. NJ phylogeny of the genus Carassius based on concatenated sequences of cytb gene and control region. As maximum likelihood (ML) method and Bayesian inference (BI) showed the same topology, only the NJ tree is presented here. Numbers near the branches represent branch support for neighbor-joining, maximum likelihood method and Bayesian inferences, respectively.
Figure 3. NJ phylogeny of the genus Carassius based on concatenated sequences of cytb gene and control region. As maximum likelihood (ML) method and Bayesian inference (BI) showed the same topology, only the NJ tree is presented here. Numbers near the branches represent branch support for neighbor-joining, maximum likelihood method and Bayesian inferences, respectively.
Animals 10 01785 g003
Table 1. PCR and sequencing primers used in the present study.
Table 1. PCR and sequencing primers used in the present study.
TargetPrimerSequence (5′-3′)References
control regionL15923TTAAAGCATCGGTCTTGTAA[19]
Hl6500GCCCTGAAATAGGAACCAGA[20]
16500FAGCGCCCAGAAAAGAGAGATThis study
cytochrome b geneL14724GACTTGAAAAACCACCGTTG[21]
H15915CTCCGATCTCCGGATTACAAGAC[21]
15372FGACCTACCCACACCATCCAAThis study
Table 2. Sampling information and basic genetic diversity indices of each population or lineage of Carassius auratus.
Table 2. Sampling information and basic genetic diversity indices of each population or lineage of Carassius auratus.
PopulationCodenhSKHdπ (%)
Fujin, ChinaFJ13515384.191 ± 2.0950.673 ± 0.0421.174 ± 0.650
Fuyuan, ChinaFY18815311.430 ± 0.8760.466 ± 0.0440.399 ± 0.271
Mishan, ChinaMS1198227.263 ± 3.4260.591 ± 0.0242.035 ± 1.063
Raohe, ChinaRH12716434.065 ± 2.0410.602 ± 0.0501.139 ± 0.633
Huifahe, ChinaHFH9914466.908 ± 3.2770.689 ± 0.0471.935 ± 1.017
Suifenhe, ChinaSI1007211.942 ± 1.1120.208 ± 0.0540.544 ± 0.345
Suifenhe, RussiaSII9011247.512 ± 3.5410.780 ± 0.0232.104 ± 1.099
Xingkaihu, ChinaXI10015247.842 ± 3.6800.878 ± 0.0132.197 ± 1.142
Xingkaihu, RussiaXII9613281.418 ± 0.8750.563 ± 0.0570.396 ± 0.271
LineageC282230381.564 ± 0.9340.479 ± 0.0220.439 ± 0.290
C617316182.327 ± 1.2790.756 ± 0.0290.657 ± 0.400
C7591281.193 ± 0.7750.679 ± 0.0560.336 ± 0.242
Total 105458576.417 ± 3.0420.676 ± 0.0161.798 ± 0.942
n: Number of individuals; h: Number of Haplotypes; S: Number of segregating sites; K: Mean number of nucleotide differences; Hd: Haplotype diversity; and π: Nucleotide diversity.
Table 3. The population and lineage distributions of control region (CR) haplotypes in 9 populations of goldfish (Carassius auratus).
Table 3. The population and lineage distributions of control region (CR) haplotypes in 9 populations of goldfish (Carassius auratus).
LineageGenBank NO.FJFYMSRHHFHSISIIXIXII
C2JN79064855 7 13
JN7906497413656795389221862
JN79065051814 2 4
JN790651 1
JN79065269367 11
JN790653 2 1 1
JN790655 4 7 1511
JN790663 1
JN790664 6
JN790665 6 2
JN790666204 3 1 22
JN790667 1
JN7906682 1
JN790679 5
JN790682 1 2
MT1992362 1
MT1992375
MT1992391 92
MT1992402
MT199241 2
MT199243 2 2
MT199245 1
MT199246 1
MT199247 1
MT199248 1
MT199249 1
MT199250 1
MT199251 2
MT199253 1
MT199254 7
C6JN7906566 52212313
JN7906702 16
JN790671 1 17
JN790672 17
JN790673 8
JN790674314 2 1
JN790675 6
JN7906761 1 1
JN790677 1
JN790678 2 3
JN790680 1
JN790681 2
MT1992381
MT199256 1
MT199257 1
MT199260 1
C7JN790654 31
JN790657 3
JN790658 13
JN790659 1
JN790660 1
JN790661 1
JN790662 1
JN790669 1
MT199242 1
MT199244 1 1
MT199252 2
MT199258 2
Total 135188119127991009010096
Table 4. Pairwise ΦST (below diagonal) and associated p values (above diagonal) between populations of goldfish (Carassius auratus).
Table 4. Pairwise ΦST (below diagonal) and associated p values (above diagonal) between populations of goldfish (Carassius auratus).
Population CodeFJFYMSRHHFHSISIIXIXII
FJ 0.000 ± 0.0000.000 ± 0.0000.001 ±0.0010.004 ± 0.0020.014 ± 0.0030.000 ± 0.0000.000 ± 0.0000.000 ± 0.000
FY0.060 0.000 ± 0.0000.000 ± 0.0000.000 ± 0.0000.005 ± 0.0030.000 ± 0.0000.000 ± 0.0000.002 ± 0.001
MS0.2450.442 0.000 ± 0.0000.000 ± 0.0000.000 ± 0.0000.000 ± 0.0000.000 ± 0.0000.000 ± 0.000
RH0.0340.0320.335 0.000 ± 0.0000.002 ± 0.0010.000 ± 0.0000.000 ± 0.0000.007 ± 0.003
HFH0.0280.1500.1100.092 0.000 ± 0.0000.000 ± 0.0000.000 ± 0.0000.000 ± 0.000
SI0.0260.0270.3380.0290.089 0.000 ± 0.0000.000 ± 0.0000.003 ± 0.002
SII0.4050.5580.3460.4340.2960.484 0.000 ± 0.0000.000 ± 0.000
XI0.4750.6560.1390.5400.3260.5630.436 0.000 ± 0.000
XII0.0590.0240.3980.0290.1380.0290.5100.605
Table 5. Analysis of molecular variance (AMOVA) among nine populations of goldfish (Carassius auratus).
Table 5. Analysis of molecular variance (AMOVA) among nine populations of goldfish (Carassius auratus).
PartitionsSource of Variationd.f.Sum of SquaresVariance ComponentsPercentage of VariationFixation Indicesp-Value
I
Among groups192.32−0.083−2.51ΦCT = −0.0250.423 ± 0.015
Among populations within groups7962.801.15935.13ΦSC = 0.3430.000 ± 0.000
Within populations10452323.582.22467.38ΦST = 0.3260.000 ± 0.000
Total10533378.703.300
II
Among lineages22502.106.55988.72ΦST = 0.8870.000 ± 0.000
Within lineages1051876.600.83411.28
Total10533378.707.393

Share and Cite

MDPI and ACS Style

Cheng, L.; Lu, C.; Wang, L.; Li, C.; Yu, X. Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus). Animals 2020, 10, 1785. https://doi.org/10.3390/ani10101785

AMA Style

Cheng L, Lu C, Wang L, Li C, Yu X. Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus). Animals. 2020; 10(10):1785. https://doi.org/10.3390/ani10101785

Chicago/Turabian Style

Cheng, Lei, Cuiyun Lu, Le Wang, Chao Li, and Xiaoli Yu. 2020. "Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus)" Animals 10, no. 10: 1785. https://doi.org/10.3390/ani10101785

APA Style

Cheng, L., Lu, C., Wang, L., Li, C., & Yu, X. (2020). Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus). Animals, 10(10), 1785. https://doi.org/10.3390/ani10101785

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop