Expression Changes of MHC and Other Immune Genes in Frog Skin during Ontogeny
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Rana ornativentris Samples
2.2. Primer Design and Generation of Standards for Quantitative PCR (qPCR)
2.3. MHC Expression in R. ornativentris Using Quantitative PCR (qPCR)
2.4. Statistical Analyses of qPCR Expression Data
2.5. Transcriptome Analyses of Immune Expression in R. ornativentris Tadpoles
2.6. MHC and Immune Gene Expression in Xenopus Tadpoles
3. Results and Discussion
3.1. MHC Expression in R. ornativentris Using qPCR Analyses
3.2. MHC Expression in R. ornativentris and X. tropicalis Using Transcriptome Analyses
3.3. Differential Expression of Immune-Related Genes in R. ornativentris and X. tropicalis Tadpoles
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Robert, J.; Ohta, Y. Comparative and developmental study of the immune system in Xenopus. Dev. Dyn. 2009, 238, 1249–1270. [Google Scholar] [CrossRef] [Green Version]
- Du Pasquier, L.; Schwager, J.; Flajnik, M.F. The immune system of Xenopus. Annu. Rev. Immunol. 1989, 7, 251–275. [Google Scholar] [CrossRef] [PubMed]
- De Jesús Andino, F.; Chen, G.; Li, Z.; Grayfer, L.; Robert, J. Susceptibility of Xenopus laevis tadpoles to infection by the ranavirus Frog-Virus 3 correlates with a reduced and delayed innate immune response in comparison with adult frogs. Virology 2012, 432, 435–443. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wendel, E.S.; Yaparla, A.; Melnyk, M.L.S.; Koubourli, D.V.; Grayfer, L. Amphibian (Xenopus laevis) tadpoles and adult frogs differ in their use of expanded repertoires of type I and type III interferon cytokines. Viruses 2018, 10, 372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rollins-Smith, L.A. Metamorphosis and the amphibian immune system. Immunol. Rev. 1998, 166, 221–230. [Google Scholar] [CrossRef] [PubMed]
- Chambouvet, A.; Gower, D.J.; Jirků, M.; Yabsley, M.J.; Davis, A.K.; Leonard, G.; Maguire, F.; Doherty-Bone, T.M.; Bittencourt-Silva, G.B.; Wilkinson, M.; et al. Cryptic infection of a broad taxonomic and geographic diversity of tadpoles by Perkinsea protists. Proc. Natl. Acad. Sci. USA 2015, 112, E4743–E4751. [Google Scholar] [CrossRef] [Green Version]
- Haislip, N.A.; Gray, M.J.; Hoverman, J.T.; Miller, D.L. Development and disease: How susceptibility to an emerging pathogen changes through anuran development. PLoS ONE 2011, 6, e22307. [Google Scholar] [CrossRef]
- Goren, L.; Routtu, J.; Ben-Ami, F. Trematode-associated morbidity and mortality of tadpoles in Israel. Parasitol. Res. 2014, 113, 3833–3841. [Google Scholar] [CrossRef]
- Blaustein, A.R.; Romansic, J.M.; Scheessele, E.A.; Han, B.A.; Pessier, A.P.; Longcore, J.E. Interspecific variation in susceptibility of frog tadpoles to the pathogenic fungus Batrachochytrium dendrobatidis. Conserv. Biol. 2005, 19, 1460–1468. [Google Scholar] [CrossRef]
- Du Pasquier, L.; Flajnik, M.F. Expression of MHC class II antigens during Xenopus development. Dev. Immunol. 1990, 1, 85–95. [Google Scholar] [CrossRef] [Green Version]
- Flajnik, M.F.; Kaufman, J.F.; Hsu, E.; Manes, M.; Parisot, R.; Du Pasquier, L. Major histocompatibility complex-encoded class I molecules are absent in immunologically competent Xenopus before metamorphosis. J. Immunol. 1986, 137, 3891–3899. [Google Scholar] [PubMed]
- Salter-Cid, L.; Nonaka, M.; Flajnik, M.F. Expression of MHC class Ia and class Ib during ontogeny: High expression in epithelia and coregulation of class Ia and lmp7 genes. J. Immunol. 1998, 160, 2853–2861. [Google Scholar] [PubMed]
- Rollins-Smith, L.A.; Flajnik, M.F.; Blair, P.J.; Davis, A.T.; Green, W.F. Involvement of thyroid hormones in the expression of MHC class I antigens during ontogeny in Xenopus. Dev. Immunol. 1997, 5, 133–144. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- AmphibiaWeb. Available online: https://amphibiaweb.org (accessed on 2 February 2019).
- Feng, Y.-J.; Blackburn, D.C.; Liang, D.; Hillis, D.M.; Wake, D.B.; Cannatella, D.C.; Zhang, P. Phylogenomics reveals rapid, simultaneous diversification of three major clades of Gondwanan frogs at the Cretaceous–Paleogene boundary. Proc. Natl. Acad. Sci. USA 2017, 114, E5864–E5870. [Google Scholar] [CrossRef] [Green Version]
- Igawa, T.; Kurabayashi, A.; Usuki, C.; Fujii, T.; Sumida, M. Complete mitochondrial genomes of three neobatrachian anurans: A case study of divergence time estimation using different data and calibration settings. Gene 2008, 407, 116–129. [Google Scholar] [CrossRef]
- Didinger, C.; Eimes, J.A.; Lillie, M.; Waldman, B. Multiple major histocompatibility complex class I genes in asian anurans: Ontogeny and phylogeny of expression. Dev. Comp. Immunol. 2016, 70, 69–79. [Google Scholar] [CrossRef]
- Lau, Q.; Igawa, T.; Minei, R.; Kosch, T.A.; Satta, Y. Transcriptome analyses of immune tissues from three Japanese frogs (genus Rana) reveals their utility in characterizing major histocompatibility complex class II. BMC Genom. 2017, 18, 994. [Google Scholar] [CrossRef] [Green Version]
- Tahara, Y. Table of the normal developmental stages of the frog, Rana japonica. 1. Early development (Stages 1–25). Jpn. J. Exp. Morphol. 1959, 13, 49–60. [Google Scholar]
- Tahara, Y. Table of normal developmental stages of the frog, Rana japonica. 2. Late development (stages 26-40). Mem. Osaka Kyoiku Univ. (Nat. Sci. Appl. Sci.) 1974, 23, 33–53. [Google Scholar]
- Lau, Q.; Igawa, T.; Komaki, S.; Satta, Y. Characterisation of major histocompatibility complex class I genes in Japanese Ranidae frogs. Immunogenetics 2016, 68, 797–806. [Google Scholar] [CrossRef] [Green Version]
- Lau, Q.; Igawa, T.; Kosch, T.A.; Satta, Y. Selective constraint acting on TLR2 and TLR4 genes of Japanese Rana frogs. PeerJ 2018, 6, e4842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nieuwkoop, P.D.; Faber, J. Normal Table of Xenopus laevis (Daudin): A Systematical and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis; Garland Publishing, Inc.: New York, NY, USA, 1994; ISBN 0815318960. [Google Scholar]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Trinity: Reconstructing a full-length transcriptome without a genome from RNA-Seq data. Nat. Biotechnol. 2013, 29, 644–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bray, N.L.; Pimentel, H.; Melsted, P.; Pachter, L. Near-optimal probabilistic RNA-seq quantification. Nat. Biotechnol. 2016, 34, 525–527. [Google Scholar] [CrossRef] [PubMed]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- James-Zorn, C.; Ponferrada, V.; Fisher, M.E.; Burns, K.; Fortriede, J.; Segerdell, E.; Karimi, K.; Lotay, V.; Wang, D.Z.; Chu, S.; et al. Navigating xenbase: An integrated Xenopus genomics and gene expression database. Methods Mol. Biol. 2018, 1757, 251–305. [Google Scholar] [CrossRef]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- McDiarmid, R.W.; Altig, R. Research: materials and techniques. In Tadpoles: The Biology of Anuran Larvae; McDiarmid, R.W., Altig, R., Eds.; University of Chicago Press: Chicago, IL, USA, 1999; pp. 7–23. [Google Scholar]
- Gosner, K.L. A simplified table for staging anuran embryos larvae with notes on identification. Herpetologica 1960, 16, 183–190. [Google Scholar]
- Flajnik, M.F.; Ohta, Y.; Greenberg, A.S.; Salter-Cid, L.; Carrizosa, A.; Du Pasquier, L.; Kasahara, M. Two ancient allelic lineages at the single classical class I locus in the Xenopus MHC. J. Immunol. 1999, 163, 3826–3833. [Google Scholar]
Target Gene | Target Species | Boundary Crossed | Forward Primer (5’–3’) | Reverse Primer (5’–3’) | Amplicon Length (bp) |
---|---|---|---|---|---|
MHC class I | R. ornativentris | exon 3–4 | TCCCGACCATGAATGAGG | GACTGACGATGACCCCACA | 190 |
MHC class II beta | R. ornativentris | exon 3–4 | CACAGCAGCCTGGAGACA | AGCACAAATCCCACAATTCC | 98 |
GAPDH | Japanese Rana | exon 5–6 | CCAACGTGTCTGTGGTTGAC | TCCCAGAATTCCCTTCAGTG | 113 |
Sample or Comparison | Raor MHC-I (Transcript 1) | Raor MHC-I (Transcript 2) | Raor MHC-II | Xetr MHC-I [hla-a] (NP_001106536.1) | Xetr MHC-II [hla-dra] (XP_017951884.1) | Xetr MHC-II [hla-drb1] (NP_001039259.1) |
---|---|---|---|---|---|---|
TPM mean ± SD | ||||||
E_body | 1.9 ± 1.4 | 7.7 ± 3.2 | 0.0 ± 0.0 | - | - | - |
M_body | 18.1 ± 3.4 | 19.4 ± 8.6 | 3.1 ± 2.3 | - | - | - |
E_skin | 1.9 ± 0.8 | 6.7 ± 5.5 | 0.2 ± 0.2 | 2.0 ± 2.6 | 3.0 ± 2.6 | 43.0 ± 5.6 |
M_skin | 25.3 ± 2.7 | 50.0 ± 21.2 | 7.5 ± 4.2 | 484.3 ± 184.8 | 741.4 ± 354.3 | 1957.7 ± 877.9 |
L_skin | 10.8 ± 6.6 | 41.1 ± 4.9 | 10.0 ± 7.7 | 608.5 ± 290.6 | 711.9 ± 877.9 | 2374.0 ± 1492.0 |
logFC (FDR) | ||||||
skin: E v M | 3.81 (0.008) | 3.00 (0.103) | 2.51 (0.024) | 8.27 (1.50 × 10−24) | 8.33 (4.58 × 10−27) | 5.93 (4.15 × 10−21) |
skin: E v L | 2.37 (0.400) | 2.55 (0.297) | 5.38 (0.037) | 8.73 (5.57 × 10−47) | 8.33 (3.92 × 10−43) | 6.30 (1.87 × 10−40) |
skin: M v L | −1.40 (0.550) | −0.46 (1) | 0.27 (1) | 0.49 (1) | 0.04 (1) | 0.39 (1) |
body v skin: E | −0.02 (1) | −0.29 (1) | 4.70 (1) | - | - | - |
body v skin: M | 0.63 (0.904) | 1.54 (0.465) | 1.39 (0.682) | - | - | - |
body v skin: E/M | 0.58 (1) | 1.16 (0.751) | 1.46 (0.922) | - | - | - |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lau, Q.; Igawa, T.; Komaki, S.; Satta, Y. Expression Changes of MHC and Other Immune Genes in Frog Skin during Ontogeny. Animals 2020, 10, 91. https://doi.org/10.3390/ani10010091
Lau Q, Igawa T, Komaki S, Satta Y. Expression Changes of MHC and Other Immune Genes in Frog Skin during Ontogeny. Animals. 2020; 10(1):91. https://doi.org/10.3390/ani10010091
Chicago/Turabian StyleLau, Quintin, Takeshi Igawa, Shohei Komaki, and Yoko Satta. 2020. "Expression Changes of MHC and Other Immune Genes in Frog Skin during Ontogeny" Animals 10, no. 1: 91. https://doi.org/10.3390/ani10010091