Next Article in Journal
Bioactive Compounds in Food as a Current Therapeutic Approach to Maintain a Healthy Intestinal Epithelium
Next Article in Special Issue
How Microbial Food Web Interactions Shape the Arctic Ocean Bacterial Community Revealed by Size Fractionation Experiments
Previous Article in Journal
Multiple Techno-Functional Characteristics of Leuconostoc and Their Potential in Sourdough Fermentations
Previous Article in Special Issue
Bacterial Communities Associated with Poa annua Roots in Central European (Poland) and Antarctic Settings (King George Island)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 9
Issue 8
10.3390/microorganisms9081631
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Microbial Communities Present in Hydrothermal Sediments from Deception Island, Antarctica

by
Javier Vicente
,
Miguel de Celis
,
Alejandro Alonso
,
Domingo Marquina
and
Antonio Santos
*
Unit of Microbiology, Department of Genetics, Physiology and Microbiology, Biology Faculty, Complutense University of Madrid, 28040 Madrid, Spain
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(8), 1631; https://doi.org/10.3390/microorganisms9081631
Submission received: 2 July 2021 / Revised: 26 July 2021 / Accepted: 27 July 2021 / Published: 30 July 2021
(This article belongs to the Special Issue Polar Microbes)
Browse Figures
Versions Notes

Abstract

:
Deception Island is a geothermal location in Antarctica that presents active fumaroles, which confers unique characteristics to this habitat. Several studies about microbial communities in Antarctica have been carried out, nevertheless, Antarctic microbiota is still partially unknown. Here we present a multidisciplinary study about sediments obtained by deposition during 4 years in which several approaches have been considered for their characterization. First, a physicochemical characterization, using ionic chromatography and mass spectrometry for the determination of most abundant ions (chloride and sulphate) and elements (mainly silicon), was conducted. In addition, the total microbial community was studied using a metataxonomical approach, revealing a bacterial community dominated by Proteobacteria and Thaumarchaeota as the main archaeal genera and a fungal community mainly composed by Aspergillaceae. Culture-dependent studies showed low microbial diversity, only achieving the isolation of Bacillus-related species, some of them thermophilic, and the isolation of common fungi of Aspergillus or Penicillium spp. Furthermore, diatoms were detected in the sediment and characterized attending to their morphological characteristics using scanning electron microscopy. The study reveals a high influence of the physicochemical conditions in the microbial populations and their distribution, offering valuable data on the interaction between the island and water microbiota.

1. Introduction

Microorganisms are the most versatile and ubiquitous life form on Earth. Microbial populations can dwell and grow in extreme environments such as Antarctica. The Antarctic continent presents unique characteristics, most of its extension is ice-covered, and in some parts, different extreme conditions converge. One of these unique locations is Deception Island, which is an extremely cold location with geothermal wells.
Deception Island is a ring-shaped island of 15 km of merged diameter [1]. Mont Pond (542 m above sea level) is the highest point on the island. Deception Island is near the Antarctic peninsula, being the most active volcano in the South Shetland Islands and has been the scene of more than twenty identified eruptions over the past two centuries. The last documented eruption occurred in 1970 [2]. Bathymetric studies accomplished between 1949 and 1993 indicated a shoaling rate of 0.5 m per year, attributed to fluvial depositions and pyroclastic input [3]. It is a unique ground settled on the expansion axis on Bransfield rift [2], which divides the Archipelago from the Continent. The origin of the island is directly related to that rift when the upper part of a volcano integrated within collapsed during the Cenozoic Era.
The great majority of Antarctic volcanoes do not present any evidence of geological activity, and only four stand out as hydrothermal habitats in Antarctica. Three of them are in the continent, in Victoria Land, and the fourth is Deception Island [4]. Those Antarctic geothermal locations are small areas of relatively hot liquid water in a vast, dry, and cold territory, composed of mineral soils like lapilli or pyroclastic ash [5]. Those locations are upon regions that present raised temperatures near hydrothermal vents or cracks related to geological active volcanoes. In Deception Island, numerous hot soils, hot springs, and fumaroles evidence volcanic activity. The abundant geothermal activity provides the appropriate characteristics to the development of a singular environment [6].
Deception Island is one of the locations that has contributed to a greater extent of the knowledge about hydrothermal ecosystems in Antarctica because, since 1930, it has accommodated numerous scientific stations due to its accessibility [5].
The whole experimental terms offered by this habitat allow the presence of microbial communities that are extremely adapted to the ground [7]. The communities are locally adapted, responding to physiochemical gradients and biotic characteristics of soils [8]. The first study of the Antarctic soil microbiology was carried out by Darling and Siple [9], that, together with other studies [10], described different microbial species. Bacillus subtilis and B. megaterium were the first species described in the Antarctic continent. Subsequent researchers indicated an apparent microbial poverty of Antarctic soils, some of them being described as sterile [11]. Probably, in those cases in which any viabilization was achieved, the samples were composed only of viable but non-culturable microorganisms [12].
The 21st century, by applying different molecular approaches, was when the real microbial abundance and diversity present in Antarctic soils was made known [13]. The most common bacterial phyla in island-soils are Proteobacteria, Bacteroidetes, and Actinobacteria [14,15], which are common to those observed in other regions of the continent, which communities are mainly composed of Actinobacteria, Proteobacteria, Bacteroidetes, Acidobacteria, or Deinococcus-Thermus [8]. As far as fungi are concerned, few studies have been carried out; some of them [16,17] demonstrated that the community is mainly composed of Ascomycetes. Nevertheless, despite these studies, the microbial community is still poorly characterized, representing a huge unknown potential of biotechnological applications.
The uniqueness of this study lies in the characteristics of the samples; the sediment has not been taken in a specific moment, but by the accumulation over four years. During this time, the material that seawater currents carry in suspension has been accumulated in the precipitation column used for sampling. This study aims to gain a deeper insight into the Polar microbiology, by describing the microbiome of the sediments generated in a unique location on Deception Island. We analyze the nature of the sediments, the microbial input on the Antarctic continent, and the settlement of new microbial populations.

2. Materials and Methods

2.1. Sampling

The sample object of study was taken from the hydrothermal precipitation column number 2 from the HYDRODEC-2000 campaign (Special Action Project ANT1998-1557-E/HESP from the Spanish Antarctic Program). The column was placed in Deception Island, South Shetland Islands, Antarctica (60°34′9.300″ W–62°58′48.30″ S), Antarctic Specially Protected Area 140 (ASPA 140), in an intermediate point between Kroner Lake and Whalers Bay coast, and in a shallow coastal zone in which the temperature is between 40 and 60 °C according to previous works [1,4]. The sediments in the column were obtained by deposition from the upper zone of material dragged by sea currents and tides for four years. After column removal, sediments were stored at −20 °C until laboratory processing.

2.2. Geological Study and Determination of Physicochemical Parameters

2.2.1. Ionic and Atomic Compositional Analysis: Inductively Coupled Plasma Atomic Emission Spectroscopy (ICP-OES) and Ionic Chromatography (IC)

For the aqueous extract from the sample, five grams of sediment were resuspended in 50.0 milliliters of MilliQ water and kept at room temperature and constant shaking for 24 h. The mixture was centrifuged, and the supernatant was recovered and filtered by a 0.45 microns PES filter (Whatman, Maidstone, Kent, UK). MilliQ water was added up to 100 milliliters. An ionic chromatograph with a conductivity detector, 940 Professional Ionic Chromatograph Vario One (Metrohm, Herisau, Switzerland), and a MetroSep A Supp 7 (250.0 × 4.0 mm) column were used. Fifty microliters of the sample were used in a mobile phase of Na2CO3 and a constant flux of 0.70 mL·min−1. The sample was analyzed in triplicate.
For the ICP-OES study, 0.25 g of sediment were resuspended in 5.0 of nitric acid. The mixture was kept at 100 °C up to 24 h. Therefore, 5.0 milliliters of fluorhydric acid was added for silicate digestion, and the mixture was kept at 100 °C for 24 h. Finally, perchloric acid was added and the mixture was maintained on a heating plate until it dried. The product was carried up to 50 milliliters with MilliQ water, and the final concentration of nitric acid was 8%. A SPECTRO Arcos spectrometer was used and analyzed in triplicate. International Reference Material CRM-277 Estuarine Sediment was used as standard for comparison.
Both analyses were carried out at the Geologic Techniques and Archaeometry Research Assistance Centre of the Geological Sciences Faculty at the Complutense University of Madrid.

2.2.2. Structural Analysis by X-ray Powder Diffraction (XRD)

The sample was ground on an agate mortar and passed through a 52-micron sieve. A powder coat was spread on an aluminum slide and placed on a D500 Siemens diffractometer with a graphite monochromator. The analysis was carried out using a cupper Kα anode (λ = 1.54 Å). An X-ray generator was set to an acceleration voltage of 40 kV and a filament emission of 30 mA. The exploration angle was set between 2 and 70° of 2-Theta, and the speed was set at 2° per minute. The diffract Plus diffraction program and EVA 9 (Siemens, Munich, Germany) were used as analysis software. Minerals were identified using the standard reference diffractograms acquired from the American Society for Testing and Materials (ASTM) database.
The analysis was carried out at the Mineralogy and Crystallography Department of the Geological Sciences Faculty at the Complutense University of Madrid.

2.3. Microbial Diversity Analysis

2.3.1. Metataxonomic Study

The sediment sample was analyzed following a 16S and ITS metabarcoding strategy for determining prokaryotic and fungal populations. The sample was stored at −20 °C until DNA extraction was performed. DNA extraction was carried out using 0.25 g of the sample and using a commercial kit (DNeasy Powerlyzer Powersoil Kit, Qiagen, Hilden, Germany). The V4 region of the 16S rRNA gene was amplified by PCR, using primers 515F (GTGYCAGCMGCCGCGGTAA) and 806R (GGACTACNVGGGTWTCTAAT) and the ITS1 region using WineSeq custom primers (patent number: Patent WO2017096385). Libraries were prepared following the two-step PCR Illumina® protocol, applying the Nextera XT index kit (Illumina Inc. San Diego, CA, USA), as described. Then, these were subsequently sequenced on Illumina® MiSeq instrument (Illumina®, San Diego, CA, USA) using 2 × 300 paired-end reads. PCR conditions such as the number of cycles, annealing temperature, thermocycler, and Master-mix composition were carried out according to the WineSeq® technology procedures [18]. The resulting fastQ sequences were analyzed following the DADA2 pipeline implemented in R using default parameters [19]. This pipeline implements an error correction model, allowing the differentiation of a single nucleotide [20], giving as a final output an Amplicon Sequence Variants (ASV) table. The taxonomic assignment was performed using the naïve Bayesian classifier implemented in DADA2 using Silva (release 132) as a reference database [21] for prokaryotes and the UNITE reference database for fungi [22] with a bootstrap cut-off of 80%.

2.3.2. Isolation and Identification of Viable Microorganisms

Different culture broths were used to isolate different taxa of bacteria and fungus: Tryptone Soy Broth (TSB, Conda–Pronadisa Laboratories); Potato Dextrose Broth, (PDB, Conda–Pronadisa Laboratories, Madrid, Spain); Yeast Malt Broth, (YMB, Conda–Pronadisa Laboratories, Madrid, Spain); and Sea Water Yeast Extract (SW); 9K and R2A [23]. Sediment was resuspended in the culture media in a 1:10 ratio on sterile 100 mL Erlenmeyer flasks and incubated at 15, 32, and 60 °C with constant shaking (120 rpm).
Every 24 h, up to 96 h, 100 µL aliquots were sampled and spread on the correspondent solid medium and incubated under the same temperature conditions. Attending to their morphological characteristics, different colonies were picked and streaked on agar plates. Axenic cultures were maintained in glycerol (20%) at −80 °C.
DNA extraction was carried out according to the Cenis modified method, using silica spheres (0.2–0.5 mm diameter) for cellular breaking [24]. Identification was conducted according to the 16S ribosomal (for bacteria) region and ITS region (for fungi) using the extracted DNA. Y1 (5′TGGCTCAGGACGAAGCTGGCGGC3′) and Y2 (5′CCTACTGCTGCCTCCCGTAGGAGT3′) were the primers used for amplification of the 16S region. PCR conditions, up to 30 cycles, were: denaturing, 95 °C, 45 s; annealing, 58 °C, 1 min; extension, 72 °C, 45 s. NL1 (5′GCATATCAATAAGCGGAGGAAAAG3′) and NL4 (5′GGTCCGTGTTTCAAGACGG3′) were the primers used for the amplification of the ITS region. PCR conditions, up to 30 cycles, were: denaturing, 95 °C, 1 min; annealing, 56 °C, 90 s; extension, 72 °C, 2 min. The PCR reaction mixture was: 25 µL DreamTaq Green DNA polymerase 2x (Fisher Scientific, Waltham, MA, USA), 2 µL of each primer (50 µM), 2 µL of template DNA, and 19 µL of molecular grade water.
PCR amplicons were visualized on a TAE-agarose 1% gel with GelRed® (2 µL/30 mL) and then purified using the mi-PCR Purification Kit (Metabion, Planneg, Germany). Fragments were Sanger-sequenced (Macrogen Europe, Amsterdam, Netherlands) using an ABI3730 XL Sanger technology sequencer. Sequences were compared to GenBank sequences using the Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information (NCBI).

2.3.3. Phenotypical Characterization of the Bacterial Isolates

Growth of the thermophilic strains was verified at 45 and 75 °C using SW as the culture media and measured turbidically at 600 nm. Salinity resistance characterization of the bacterial isolates was determined using Sea Water Yeast Extract agar plates with different marine salt concentrations (0 to 16% through 2% growths). The extracellular enzymatic characterization was performed using the Ashby for nitrogen-fixation activity, Pikovskaya for phosphate-solubilizing activity [25], Aleksandrow for potassium-solubilizing activity [26], and TSA supplemented with 10 g/L of starch (Sigma-Aldrich, Burlington, MA, USA) for amylolytic activity or 10 g/L gelatin (Sigma-Aldrich, Burlington, MA, USA) for protease activity determination. Fifty microliters of a bacterial suspension (0.5 McFarland scale) was spotted onto the plates. Incubation was carried out at 32 and 60 °C, depending on the isolation temperature, up to 48 h. Starch-TSA and gelatin-TSA were revealed with Lugol and Frazier reagents, respectively.

2.3.4. Study of Scanning Electron Microscopy (SEM)

The analysis was carried out at the Geologic Techniques and Archaeometry Research Assistance Centre of the Geological Sciences Faculty from the Complutense University of Madrid. The sample was placed on a carbon tape, gold-coated, and visualized using a JEOL JSM-820 scanning electron microscope (SEM). For morphological identification of diatoms, SEM digital images were compared with online databases [27,28,29]. We discriminated between central and pennal divisions; and, as morphologic differential characteristics, we used the apical, transversal, and pervalvar ratios, as well as ornamentation characteristics.

3. Results

3.1. Geological Study and Determination of Physicochemical Parameters

Ionic chromatography (IC) analysis showed that chloride and sulphur are the main ions in the sample (Table 1), whereas the atomic composition determinations (ICP-OES) indicated that silicon, aluminum, and iron are the main macroelements, and, regarding the microelements, strontium, sulphur, and nickel are the commonest (Table 2).
Using XRD, we could identify two principal minerals in the sediment sample, anorthite and halite, identified using the American Society for Testing and Materials (ASTM) file number 00-018-1202 and 01-075-0306, respectively. The sample presented a very low crystalline structure, conformed by amorph glasses due to the shape; it showed numerous not well-defined peaks and a central bulge standing out (Appendix A, Figure A1).

3.2. Microbial Diversity Analysis

3.2.1. Metataxonomic Study

The fastQ sequences analyzed in R provided a total of 70.287 good quality reads for prokaryotes and 86.890 for fungi (NCBI Accession Number PRJNA702109). Considering prokaryotes, at a phylum level, the most abundant populations detected were Proteobacteria (more than 50% of the total reads) and Actinobacteria (around 25%); furthermore, some Archaea, as Thaumarchaeota, were also found (Figure 1A). Regarding the fungal populations found in the sample, they were dominated by almost 75% at the family level by Aspergillaceae; the remaining the population was formed by Phaeosphaeriaceae, Pseudeurotiacee, and other unidentified families (Figure 1B).

3.2.2. Isolation and Identification of Viable Microorganisms

To determine the viability of the meta-taxonomically detected populations, an isolation study conducted after an enrichment step in different broths was conducted for fungi and bacteria. No bacteria were isolated when the incubation was conducted at 15 °C; however, most isolates were isolated at 32 °C, and a few at 60 °C (Table 3). Concerning the bacterial isolates, a total of 30 strains were isolated, all of them identified as Bacillus-related species.
Only 12 fungal isolates (Table 4) were obtained after enrichment, most of them belonging to the genus Penicillium, as indicated by molecular identification.

3.2.3. Phenotypical Characterization of the Bacterial Isolates

The bacterial strains of the present study were diverse according to their phenotypical characteristics (extracellular enzyme profiles and salinity resistance). All isolates were able to grow in saline concentrations up to 8% w/v. From the 30 bacterial isolates tested, 25 were able to grow at 10% NaCl, 15 at 12%, 11 at 14%, and 9 at 16%.
The study of a basic panel of metabolic traits of the isolates indicated that only one bacterial isolate (DIP-7) was able to grow in a nitrogen-free medium, indicating that it was a free-living nitrogen-fixing strain. Furthermore, only one strain was found to be able to solubilize potassium (isolate DIP-18). More common among the isolates were the phosphate solubilizing bacteria (near 73%) which are very important for biogeochemical cycles, increasing the P availability in soils. Finally, proteolytic (near 67%) and amylolytic activities (60%) were normal among the isolates.

3.2.4. Study of Scanning Electron Microscopy (SEM)

The microscopic analysis of the sediments revealed that diatoms were present in the sediment at a high frequency. Up to six different species of diatoms were found according to the study of their morphological characteristics observed by SEM: Dactyliosolen spp., Thalassiosira spp., Coscinodiscus spp., Actynocyclus spp., Odontella spp., and Psammothidium spp. (Figure 2).

4. Discussion

Deception Island is covered by lapilli and pyroclastic ash on most of its surface [30]. The DRX study of the sample revealed two main minerals, anorthite and halite. Anorthite could be explained by the presence of lapilli since it is formed by basaltic-andesitic and volcanic glasses. The andesite that conforms lapilli is fundamentally composed by plagioclases, belonging to the albite-anortite series, from the tectosilicates group which their general formula is (Na, Ca) (Si, Al)3O8. Halite, another main component of the sample, comes from the deposition of marine water.
Recently, some DRX studies of samples coming from Deception Island have been carried out. Lezcano and colleagues analyzed a soil sample from Cerro Caliente Hill and determined that the phyllosilicates (montmorillonite, nontronite, and saponite) group was the most prevalent group of minerals [31]. Nevertheless, regarding the chemical composition of the sediments, some ions differed in that study compared to our findings: in the case of soluble SO42−, the observed concentration was one thousand times lower (1.39 ± 1.17 μg/g), and NO3− was ten times less concentrated (0.22 ± 0.15 μg/g). The chemical analysis of several sediment samples revealed that in Whaler’s Bay some metallic elements were more concentrated than in other island locations [32]. Among all, Fe was observed as the most common element (15.814 ± 581 μg/g).
Regarding other kinds of substrates, the chemical composition is more different. The ionic analysis of melted water [33] revealed quite a different composition if compared to those obtained in geothermal sediments: the concentration of NO3− rise up to 3 mg/mL, and other elements, like S (6.76 ppm compared to 329 ppm), on the contrary, were less concentrated. Some of them, like Mg (0.1 ppm), were in similar concentrations.
Our samples were formed by sediments that air and water transported and then, were deposited. The chemical analysis carried out in this study showed that the sediment is mainly composed of materials that conform to the island, probably originating there. Nevertheless, the ionic composition is slightly different from the sediments obtained in the island and glacial water. The main difference is in regard to ions such as SO42− and NO3−. In the case of nitrates, our sediments could have been enriched by materials from glaciers. Due to the presence of the fumaroles, a soil–temperature gradient was established as the temperature increases, and glaciers melt enriching the seawater. On the contrary, we could hypothesize that sulfur does not come neither from the island nor from glaciers, in both cases, it is present in much less concentration. High concentrations of sulphur could be found due to the presence of fumaroles and volcanic activity [34]. An indicator of volcanic enrichment is the presence of high concentrations of iron, manganese, and silicon at high concentrations [35]. In this sample, we cannot affirm that a volcanic enrichment could have occurred because sulphur and iron concentrations are not in the proper ratio. Silicon cannot be considered an indicator of volcanic activity in this case either, this element may come from materials that conform to the island. Either way, geothermal phenomena are not only the emission of volcanic materials through steam vents or fissures.
We can highlight the presence of amorphous minerals detected by SEM-EDX. These minerals, composed of sulphur trioxide and aluminum oxide, could be interpreted as particles of the sediment coming from the volcanic activity that occurred in the last century [2].
Other interesting and abundant elements detected in the optical emission spectroscopy studies were silicon, aluminum, nickel, sodium, calcium, and strontium, which are the main elements of basalt and andesite [36].
In conclusion, we can assume that the origin of the materials present in the sample are sediments that come from the island dragged by water.
Our bacterial meta-taxonomic results are comparable to previously reported results [36], showing a stable bacterial community in different sediment samples at Whaler’s Bay over several years. In that study, Proteobacteria, Bacteroidetes, and Actinobacteria were the main groups. In other analyzed substrates, the results are similar. The microbial composition of different microbial structures such as biofilms and microbial mats have been studied. Proteobacteria is the most common phylum (in around 75%) in different bacterial biofilms isolated at Whaler’s Bay [37], as well as in microbial mats taken from the island (in around 30%). Bacteroidetes and Acidobacteria (in different ranges depending on the microbial mat) are also usually present [31]. Martínez-Alonso and colleagues studied the volcanic endoglacial sediments and described Actinobacteria as the most common phylum in this ecosystem (30%), followed by Bacteroidetes (27%) and Proteobacteria (15%) among others [33].
The archaeal phylum Thaumarcheota detected in the meta-taxonomic analysis has been yet to be described on the island. Lezcano and colleagues described this as the most common phylum in different microbial mats, representing near 35% of the archaeal community [30].
To study the viable microbial population present in the sediment sample and their adaptations to such an environment, an isolation protocol was conducted. It should be highlighted that the great difference observed between the present microbiota, analyzed using molecular approaches (meta-taxonomic study), and the viable microbiota, by cultivation on agar plates, is known as the “the great plate count anomaly”. Nevertheless, this low percentage of viabilization has been previously reported in similar Antarctic samples from other studies [6]. Using culture media similar to those previously used in other studies, both for chemoheterotrophs and chemolithotrophs, the majority of isolates presented a chemoheterotrophic metabolism [6,14]. All the isolated strains belonged to the Bacillus-related genera, which are spore-forming species, allowing survival under adverse conditions. Furthermore, only 7.69% of the species detected by the meta-taxonomic analysis have been described as spore-forming microorganisms. The absence of lithotrophic isolates could be explained by these two facts: the lack of endospore-forming species (which affects the long-term survival of the community), and the nutritional requirements.
Studies carried out during the 20th century in soils with different characteristics, discovered bacteria that could only be identified up to the genus level and, interestingly, all of them belonged to the Bacillus genus [11,38]. Later, advances in molecular techniques for microbial identification and taxonomy made possible the new reidentification of these isolates, describing new genera such as Alicyclobacillus [39] and Geobacillus [40].
Thermophilic strains of Geobacillus spp. and Brevibacillus thermoruber where previously described at Deception Island by Muñoz and colleagues in a sample from Fumaroles Bay, located northwest from our sampling point [41]. Other species isolated in this research, such as Bacillus cereus and B. megaterium, have been described previously on Deception Island [42]. More recently, some thermophilic strains have been isolated from the island, despite sediment temperature from Whaler’s and Fumarole Bays, either from glacier or fumarole zones [14]. The isolates belonged to Bacillus-related genera such as Geobacillus, Brevibacillus and Anoxybacillus, and were recovered from samples with environmental temperatures ranging from 0 to 80 °C and using general culture media, such as TSA or Marine Agar, such as in our study.
High saline resistance of the isolated strains could be an adaptation to the dehydration caused under freeze and high salinity conditions [43]. This could be related to wider resistance to several stresses [44]. Our strains were halotolerant, all of them were able to grow in up to 8% NaCl (w/v) and some of them up to 16%. Some authors have reported osmophilic bacterial strains, isolated from the rhizosphere of Antarctic plants, resistant to NaCl concentrations up to 16% [45]. This generalized osmotolerance is linked with molecular and physiological adaptations to these environments as indicated by [36] that analyzed the stress response genes in Whaler’s Bay, describing the osmotic stress genes as the most common stress genes in a metagenomic analysis.
The production, transformation, decomposition, and/or transport of organic matter is a central part in the geochemical cycle of bioelements. In that way, microorganisms play a fundamental role, contributing an efficient set of extracellular enzymes to an optimum nutrient uptake [45]. In our study, the strains presented different enzymatic profiles, with few strain-specific activities. Phosphatase, protease, and amylase were the commonest in our study as was also reported in other studies [46].
The studies regarding the fungal diversity on the island reported the same overall pattern of dominant fungal populations by isolation and meta-taxonomic approaches. Concerning the cultivable fungal community, we have detected a low diversity level as other studies have shown [16,47], with most of the isolates identified as members of the Aspergillus and Penicillium genera. These genera have been isolated regardless of the soil temperature, both in hot and cold volcanic soils of the island [16]. Only one isolate belonged to a different genus, Exophiala, nevertheless, this was usually found in the meta-taxonomic studies carried out in the same island [17]. Exophiala spp., as well as some Penicillium spp., have been described to be extremely thermotolerant [48]. In other locations, such as King George Island (South Shetland Islands), Penicillium spp. has also been frequently isolated [49].
According to the reported results, more than 1000 fungal species have been described in morphological or cultivation studies of Antarctic fungi, nevertheless, the use of ‘omic’ approaches is essential in describing the microbial life in each habitat [17]. Several ‘omics’ (metabarcoding or metataxonomic) studies have been realized. In all of them [17,31,50], Ascomycetes was the dominant phylum. Our metataxonomic data suggests that the fungal community is dominated by the Aspergillaceae family (Ascomycetes). The meta-barcoding analysis of fungal diversity in different areas (impacted and non-impacted locations) of the island revealed that the main phylum is Ascomycota, up to 44.3% of the ASVs, not being influenced by the consideration or protection status of the area [17]. In other types of samples, as well as in soils, the population was dominated by Ascomycota.
In microbial mats, sampled at different temperatures, Ascomycota was the predominant fungal phyla among all the eukaryotes. At 88 °C, this phylum was the most abundant (9% of the phyla) as well as at 2 °C (2%); interestingly, at 8 °C it practically disappeared (abundance less than 0.55%) due to an increase of the eukaryotic-autotroph population [30].
As indicated before, a diatom population was also present in the sediment, and it was described using the morphological data obtained with SEM. Only the Psammothidium and Thalassiosira genera, two out of the six diatom genera, have been previously described on the island, near Kroner Lake [51]. The remaining genera (Dactyliosolen, Coscinodiscus, Actynnocyclus, and Odontella) have not been previously described on the island, but their presence on the continent has already been documented. Generally, benthonic diatoms belong to the pennate group, whereas those in the pelagic habitat belong to central ones [52]. In this study, most of the identified genera were identified as central ones and were probably diatoms (or their cellular rests) with a pelagic habitat that were dragged to the sampling point by sea-water streams.
In this study, the different analyses carried out in such a unique sediment sample provided interesting information about the microbiological and physicochemical influences between the island and the surrounding sea. The ionic and mineral composition revealed the confluence between the sea and glacier water, creating a transition zone between ice, land, and sea. The microbiological determinations provided interesting information about the community present in that confluence zone. The metataxonomic analysis itself could only show the quantitative/qualitative structure of the community, but its comparison to other types of samples could give valuable information about the ecological micro-structure and interactions between two different environments, defining different roles and influencing mechanisms. In addition, the viable community inhabiting such an extreme environment showed different metabolic potentials, not only in their enzymatic activities but also in their resistance profiles to environmental stresses, promising a high biotechnological potential capable of being screened for useful industrial enzymes or bioactive compounds.

Author Contributions

Conceptualization, A.A., D.M. and A.S.; methodology, D.M. and A.S.; software, M.d.C.; formal analysis, J.V., M.d.C., A.A., D.M. and A.S.; investigation, J.V. and A.A.; writing—original draft preparation, J.V.; writing—review and editing, A.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

The authors of this work thankJesús Martínez-Frías (Geosciences Institute, CSIC-UCM) for his contribution by providing the sample under study. We also thank Ana Martín (Department of Genetics, Physiology and Microbiology, UCM) for the help provided during the study of diatoms.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Microorganisms 09 01631 g0a1 550
Figure A1. X-Ray Diffractogram showing the anorthite profile according to ASTM file number 00-018-1202.
Figure A1. X-Ray Diffractogram showing the anorthite profile according to ASTM file number 00-018-1202.
Microorganisms 09 01631 g0a1

References

  1. Marti, J.; Vila, J.; Rey, J. Deception Island (Bransfield Strait, Antarctica): An example of a volcanic caldera developed by extensional tectonics. Geol. Soc. Lond. Spec. Publ. 1996, 110, 253–265. [Google Scholar] [CrossRef]
  2. Barker, D.H.N.; Austin, J.A. Rift propagation, detachment faulting, and associated magmatism in Bransfield Strait, Antarctic Peninsula. J. Geophys. Res. Solid Earth 1998, 103, 24017–24043. [Google Scholar] [CrossRef]
  3. Cooper, A.P.R.; Smellie, J.L.; Maylin, J. Evidence for shallowing and uplift from bathymetric records of Deception Island, Antarctica. Antarct. Sci. 2004, 10, 455–461. [Google Scholar] [CrossRef]
  4. Herbold, C.W.; McDonald, I.R.; Cary, S.C. Microbial Ecology of Geothermal Habitats in Antarctica. In Antarctic Terrestrial Microbiology; Springer: Berlin/Heidelberg, Germany, 2014; pp. 181–215. [Google Scholar] [CrossRef]
  5. Smith, K.; Baldwin, R.; Kaufmann, R.; Sturz, A. Ecosystem studies at Deception Island, Antarctica: An overview. Deep. Sea Res. Part II Top. Stud. Oceanogr. 2003, 50, 1595–1609. [Google Scholar] [CrossRef]
  6. Marquez, S.L.; Blamey, J.M. Isolation and partial characterization of a new moderate thermophilic Albidovulum sp. SLM16 with transaminase activity from Deception Island, Antarctica. Biol. Res. 2019, 52, 5. [Google Scholar] [CrossRef] [Green Version]
  7. Pepi, M.; Agnorelli, C.; Bargagli, R. Iron demand by thermophilic and mesophilic bacteria isolated from an antarctic geothermal soil. Biometals 2005, 18, 529–536. [Google Scholar] [CrossRef]
  8. Bottos, E.M.; Scarrow, J.W.; Archer, S.D.; McDonald, I.R.; Cary, S.C. Bacterial Community Structures of Antarctic Soils. In Antarctic Terrestrial Microbiology; Springer: Berlin/Heidelberg, Germany, 2014; pp. 9–33. [Google Scholar]
  9. Darling, C.A.; Siple, P.A. Bacteria of Antarctica. J. Bacteriol. 1941, 42, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Flint, E.A.; Stout, J.D. Microbiology of Some Soils from Antarctica. Nature 1960, 188, 767–768. [Google Scholar] [CrossRef]
  11. Horowitz, N.H.; Cameron, R.E.; Hubbard, J.S. Microbiology of the dry valleys of antarctica. Science 1972, 176, 242–245. [Google Scholar] [CrossRef]
  12. Smith, J.J.; Tow, L.A.; Stafford, W.; Cary, C.; Cowan, D.A. Bacterial diversity in three different Antarctic Cold Desert mineral soils. Microb. Ecol. 2006, 51, 413–421. [Google Scholar] [CrossRef] [PubMed]
  13. Cowan, D.A.; Russell, N.J.; Mamais, A.; Sheppard, D.M. Antarctic Dry Valley mineral soils contain unexpectedly high levels of microbial biomass. Extremophiles 2002, 6, 431–436. [Google Scholar] [CrossRef] [Green Version]
  14. Bendia, A.G.; Araujo, G.G.; Pulschen, A.A.; Contro, B.; Duarte, R.T.; Rodrigues, F.; Galante, D.; Pellizari, V.H. Surviving in hot and cold: Psychrophiles and thermophiles from Deception Island volcano, Antarctica. Extremophiles 2018, 22, 917–929. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Bendia, A.G.; Signori, C.N.; Franco, D.C.; Duarte, R.T.; Bohannan, B.J.; Pellizari, V.H. A mosaic of geothermal and marine features shapes microbial community structure on deception Island Volcano, Antarctica. Front. Microbiol. 2018, 9, 899. [Google Scholar] [CrossRef] [Green Version]
  16. Figueredo, H.M.; Gonçalves, V.N.; Godinho, V.M.; Lopes, D.V.; Oliveira, F.S.; Rosa, L.H. Diversity and ecology of cultivable fungi isolated from the thermal soil gradients in Deception Island, Antarctica. Extremophiles 2020, 24, 219–225. [Google Scholar] [CrossRef]
  17. Rosa, L.H.; da Silva, T.H.; Ogaki, M.B.; Pinto, O.H.B.; Stech, M.; Convey, P.; Carvalho-Silva, M.; Rosa, C.A.; Câmara, P.E. DNA metabarcoding uncovers fungal diversity in soils of protected and non-protected areas on Deception Island, Antarctica. Sci. Rep. 2020, 10, 21986. [Google Scholar] [CrossRef]
  18. Belda, I.; Zarraonaindia, I.; Perisin, M.; Palacios, A.; Acedo, A. From Vineyard Soil to Wine Fermentation: Microbiome Approximations to Explain the “terroir”. Concept. Front. Microbiol. 2017, 8, 821. [Google Scholar] [CrossRef] [Green Version]
  19. Callahan, B.J.; Sankaran, K.; Fukuyama, J.A.; McMurdie, P.J.; Holmes, S.P. Bioconductor Workflow for Microbiome Data Analysis: From raw reads to community analyses. F1000Res 2016, 5, 1492. [Google Scholar] [CrossRef]
  20. Callahan, B.J.; McMurdie, P.J.; Holmes, S.P. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J. 2017, 11, 2639–2643. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glockner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2013, 41, D590–D596. [Google Scholar] [CrossRef]
  22. Nilsson, R.H.; Larsson, K.H.; Taylor, A.F.S.; Bengtsson-Palme, J.; Jeppesen, T.S.; Schigel, D.; Kennedy, P.; Picard, K.; Glockner, F.O.; Tedersoo, L.; et al. The UNITE database for molecular identification of fungi: Handling dark taxa and parallel taxonomic classifications. Nucleic Acids Res. 2019, 47, D259–D264. [Google Scholar] [CrossRef] [PubMed]
  23. Atlas, R.M. Handbook of Media for Environmental Microbiology; CRC Press: Boca Raton, FL, USA, 2005. [Google Scholar]
  24. Cenis, J. Rapid extraction of fungal DNA for PCR amplification. J. Nucleic Acids Res. 1992, 20, 2380. [Google Scholar] [CrossRef]
  25. Nautiyal, C.S. An efficient microbiological growth medium for screening phosphate solubilizing microorganisms. FEMS Microbiol. Lett. 1999, 170, 265–270. [Google Scholar] [CrossRef] [PubMed]
  26. Aleksandrov, V.; Blagodyr, R.; Ilev, I. Liberation of phosphoric acid from apatite by silicate bacteria. J. Mikrobiol. Z. 1967, 29, 111–114. [Google Scholar]
  27. Olney, M. MIRACLE. Microfossil Image Recovery and Circulation for Learning and Education. Available online: https://www.ucl.ac.uk/GeolSci/micropal/index.html (accessed on 29 October 2020).
  28. Scott, F.J.; Marchant, H.J. Antarctic Marine Protists; Australian Biological Resources Study and Australian Antarctic Division: Canberra, Australia, 2005. [Google Scholar]
  29. Spaulding, S.A.; Bishop, I.W.; Edlund, M.B.; Lee, S.; Furey, P.; Jovanovska, E.; Potapova, M. Diatoms of North America. Available online: https://diatoms.org/ (accessed on 29 October 2020).
  30. Rey, J.; Somoza, L.; Martínez-Frías, J. Tectonic, volcanic, and hydrothermal event sequence on Deception Island (Antarctica). J. Geo-Mar. Lett. 1995, 15, 1–8. [Google Scholar] [CrossRef]
  31. Lezcano, M.A.; Moreno-Paz, M.; Carrizo, D.; Prieto-Ballesteros, O.; Fernandez-Martinez, M.A.; Sanchez-Garcia, L.; Blanco, Y.; Puente-Sanchez, F.; de Diego-Castilla, G.; Garcia-Villadangos, M.; et al. Biomarker Profiling of Microbial Mats in the Geothermal Band of Cerro Caliente, Deception Island (Antarctica): Life at the Edge of Heat and cold. Astrobiology 2019, 119, 1490–1504. [Google Scholar] [CrossRef]
  32. Di Giglio, S.; Agüera, A.; Pernet, P.; M’Zoudi, S.; Angulo-Preckler, C.; Avila, C.; Dubois, P. Effects of ocean acidification on acid-base physiology, skeleton properties, and metal contamination in two echinoderms from vent sites in Deception Island, Antarctica. Sci. Total Environ. 2020, 765, 142669. [Google Scholar] [CrossRef]
  33. Martinez-Alonso, E.; Pena-Perez, S.; Serrano, S.; Garcia-Lopez, E.; Alcazar, A.; Cid, C. Taxonomic and functional characterization of a microbial community from a volcanic englacial ecosystem in Deception Island, Antarctica. Sci. Rep. 2019, 9, 12158. [Google Scholar] [CrossRef] [PubMed]
  34. Ortiz, R.; Vila, J.; García, A.; Camacho, A.; Diez, J.; Aparicio, A.; Soto, R.; Viramonte, J.; Risso, C.; Menegatt, N. Geophysical Features of Deception Island. In Recent Progress in Antarctic Earth Science; Terrapub: Tokyo, Japan, 1992; pp. 143–152. [Google Scholar]
  35. Elderfield, H. Effects of volcanism on water chemistry, Deception Island, Antarctica. J. Mar. Geol. 1972, 13, M1–M6. [Google Scholar] [CrossRef]
  36. Wilkinson, J.F.G. Classification and Average Chemical-Compositions of Common Basalts and Andesites. J. Petrol. 1986, 27, 31–62. [Google Scholar] [CrossRef]
  37. Centurion, V.; Lacerda-Júnior, G.; Duarte, A.; Silva, T.; Silva, L.; Rosa, L.; Oliveira, V. Dynamics of microbial stress responses driven by abiotic changes along a temporal gradient in Deception Island, Maritime Antarctica. Sci. Total Environ. 2021, 758, 143671. [Google Scholar] [CrossRef]
  38. Nicolaus, B.; Marsiglia, F.; Esposito, E.; Trincone, A.; Lama, L.; Sharp, R.; Di Prisco, G.; Gambacorta, A. Isolation of five strains of thermophilic eubacteria in Antarctica. J. Polar Biol. 1991, 11, 425–429. [Google Scholar] [CrossRef]
  39. Wisotzkey, J.D.; Jurtshuk, P., Jr.; Fox, G.E.; Deinhard, G.; Poralla, K. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov. Int. J. Syst. Bacteriol. 1992, 42, 263–269. [Google Scholar] [CrossRef]
  40. Coorevits, A.; Dinsdale, A.E.; Halket, G.; Lebbe, L.; De Vos, P.; Van Landschoot, A.; Logan, N.A. Taxonomic revision of the genus Geobacillus: Emendation of Geobacillus, G. stearothermophilus, G. jurassicus, G. toebii, G. thermodenitrificans and G. thermoglucosidans (nom. corrig., formerly ‘thermoglucosidasius’); transfer of Bacillus thermantarcticus to the genus as G. thermantarcticus comb. nov.; proposal of Caldibacillus debilis gen. nov., comb. nov.; transfer of G. tepidamans to Anoxybacillus as A. tepidamans comb. nov.; and proposal of Anoxybacillus caldiproteolyticus sp. nov. Int. J. Syst. Evol. Microbiol. 2012, 62, 1470–1485. [Google Scholar] [CrossRef] [PubMed]
  41. Muñoz, P.A.; Flores, P.A.; Boehmwald, F.A.; Blamey, J.M. Thermophilic bacteria present in a sample from Fumarole Bay, Deception Island. Antarct. Sci. 2011, 23, 549–555. [Google Scholar] [CrossRef]
  42. Llarch, A.; Logan, N.A.; Castellvi, J.; Prieto, M.J.; Guinea, J. Isolation and Characterization of Thermophilic Bacillus spp. from Geothermal Environments on Deception Island, South Shetland Archipelago. Microb. Ecol. 1997, 34, 58–65. [Google Scholar] [CrossRef]
  43. Thomas, D.; Dieckmann, G. Antarctic sea ice—A habitat for extremophiles. J. Sci. 2002, 295, 641–644. [Google Scholar] [CrossRef] [Green Version]
  44. Yukimura, K.; Nakai, R.; Kohshima, S.; Uetake, J.; Kanda, H.; Naganuma, T. Spore-forming halophilic bacteria isolated from Arctic terrains: Implications for long-range transportation of microorganisms. J. Polar Sci. 2009, 3, 163–169. [Google Scholar] [CrossRef] [Green Version]
  45. Vasileva-Tonkova, E.; Romanovskaya, V.; Gladka, G.; Gouliamova, D.; Tomova, I.; Stoilova-Disheva, M.; Tashyrev, O. Ecophysiological properties of cultivable heterotrophic bacteria and yeasts dominating in phytocenoses of Galindez Island, maritime Antarctica. World J. Microbiol. Biotechnol. 2014, 30, 1387–1398. [Google Scholar] [CrossRef]
  46. Aislabie, J.M.; Chhour, K.-L.; Saul, D.J.; Miyauchi, S.; Ayton, J.; Paetzold, R.F.; Balks, M.R. Dominant bacteria in soils of Marble Point and Wright Valley, Victoria Land, Antarctica. Soil Biol. Biochem. 2006, 38, 3041–3056. [Google Scholar] [CrossRef]
  47. Alves, I.M.; Gonçalves, V.N.; Oliveira, F.S.; Schaefer, C.E.; Rosa, C.A.; Rosa, L.H. The diversity, distribution, and pathogenic potential of cultivable fungi present in rocks from the South Shetlands archipelago, Maritime Antarctica. Extremophiles 2019, 23, 327–336. [Google Scholar] [CrossRef]
  48. Tesei, D.; Marzban, G.; Zakharova, K.; Isola, D.; Selbmann, L.; Sterflinger, K. Alteration of protein patterns in black rock inhabiting fungi as a response to different temperatures. Fungal Biol. 2012, 116, 932–934. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Wentzel, L.C.P.; Inforsato, F.J.; Montoya, Q.V.; Rossin, B.G.; Nascimento, N.R.; Rodrigues, A.; Sette, L.D. Fungi from Admiralty Bay (King George Island, Antarctica) Soils and Marine Sediments. Microb. Ecol. 2019, 77, 12–24. [Google Scholar] [CrossRef] [Green Version]
  50. Baeza, M.; Barahona, S.; Alcaíno, J.; Cifuentes, V. Amplicon-metagenomic analysis of fungi from Antarctic terrestrial habitats. Front. Microbiol. 2017, 8, 2235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  51. Fermani, P.; Mataloni, G.; Van de Vijver, B. Soil microalgal communities on an antarctic active volcano (Deception Island, South Shetlands). Polar Biol. 2007, 30, 1381–1393. [Google Scholar] [CrossRef]
  52. Sabater, S. Diatoms. Encyclopedia of Inland Waters; Elsevier: Oxford, UK, 2009. [Google Scholar]
Microorganisms 09 01631 g001 550
Figure 1. Accumulated microbial abundances in the sediment sample. (A) Accumulated bacterial and archaeal abundances at the phylum level. (B) Accumulated fungal abundance at the family level.
Figure 1. Accumulated microbial abundances in the sediment sample. (A) Accumulated bacterial and archaeal abundances at the phylum level. (B) Accumulated fungal abundance at the family level.
Microorganisms 09 01631 g001
Microorganisms 09 01631 g002 550
Figure 2. Identified diatoms present in the sediment according to the morphological characteristics observed by SEM. (A) Dactyliosolen spp., (B) Thalassiosira spp., (C) Coscinodiscus spp., (D) Actynocyclus spp., (E) Odontella spp., (F) Psammothidium spp.
Figure 2. Identified diatoms present in the sediment according to the morphological characteristics observed by SEM. (A) Dactyliosolen spp., (B) Thalassiosira spp., (C) Coscinodiscus spp., (D) Actynocyclus spp., (E) Odontella spp., (F) Psammothidium spp.
Microorganisms 09 01631 g002
Table
Table 1. Main ions present in the sediment sample determined by ionic chromatography.
Table 1. Main ions present in the sediment sample determined by ionic chromatography.
IonConcentration (μg/g)
Cl−4075 ± 408
SO42−1009 ± 202
Br−14 ± 1
NO3−6 ± 1
F−0.42 ± 0.04
Table
Table 2. Main elements present in the sample determined by ICP-OES.
Table 2. Main elements present in the sample determined by ICP-OES.
ElementsPercentage (%)Trace ElementsAmount
(μg/g)
Si17.49 ± 0.71Sr351.64 ± 43.84
Al8.14 ± 0.35S329.27 ± 40.31
Fe6.34 ± 0.07Ni172.00 ± 0.00
Na3.4 ± 0.00Zn87.98 ± 2.83
Ca2.29 ± 0.17Cu55.32 ± 6.36
K0.77 ± 0.01Ba52.21 ± 7.18
P0.17 ± 0.01Co45.99 ± 1.41
Mn0.11 ± 0.00Li18.89 ± 2.82
Mg0.11 ± 0.03Mo17.66 ± 7.76
Ti0.07 ± 0.00
Table
Table 3. Isolated bacterial strains in the sediment. Culture media and temperature of isolation.
Table 3. Isolated bacterial strains in the sediment. Culture media and temperature of isolation.
IsolatesIdentificationEnrichment MediaTemperature (°C)Enzymatic ActivitySalinity ResistanceNCBI Accesion Number
DIP-1Bacillus sp. SW32-8MZ600240
DIP-2Bacillus sp.SW32-8MZ600241
DIP-3Bacillus sp.SW32AMIL, PROT10MZ600242
DIP-4Bacillus sp.SW32PHOS8MZ600243
DIP-5Bacillus sp.SW32-8MZ600244
DIP-6Bacillus sp.SW32PROT16MZ600245
DIP-7Bacillus sp.SW32NIT, PHOS, AMIL, PROT10MZ600246
DIP-8Bacillus sp.SW32-16MZ600247
DIP-9Bacillus sp.SW32PHOS10MZ600248
DIP-10Bacillus cereusSW32PHOS, AMIL, PROT12MZ600249
DIP-11Bacillus sp.SW32PHOS, AMIL, PROT10MZ600250
DIP-12Bacillus sp.SW32PHOS, AMIL, PROT16MZ600251
DIP-13Bacillus megateriumSW32PHOS, AMIL, PROT10MZ600252
DIP-14Bacillus sp.SW32PHOS, AMIL, PROT16MZ600253
DIP-15Bacillus sp.SW32PHOS, AMIL, PROT12MZ600254
DIP-16Bacillus simplexSW32PHOS, AMIL, PROT10MZ600255
DIP-17Bacillus sp.SW32PHOS, PROT10MZ600256
DIP-18Bacillus sp.SW32PHOS, POT, AMIL, PROT16MZ600257
DIP-19Bacillus megateriumSW32PHOS, AMIL, PROT16MZ600258
DIP-20Bacillus sp.SW32PHOS, AMIL, PROT16MZ600259
DIP-21Bacillus mycoidesSW32PHOS, AMIL, PROT12MZ600260
DIP-22Bacillus simplexSW32AMIL16MZ600261
DIP-23Bacillus circulansSW32PHOS, AMIL, PROT14MZ600262
DIP-24Bacillus aryabhattaiSW32PHOS, PROT16MZ600263
DIP-25Bacillus sp.SW32PHOS, AMIL, PROT14MZ600264
DIP-26Bacillus sp.SW32PHOS, AMIL, PROT10MZ600265
DIP-27Bacillus sp.SW32PHOS, AMIL, PROT12MZ600266
DIP-28Brevibacillus thermoruberSW60PHOS12MZ600267
DIP-29Geobacillus sp.SW60-10MZ600268
DIP-30Bacillus sp.SW60PHOS10MZ600269
AMIL: amilase; PROT: protease; PHOS: phosphatase; NIT: nitrogen fixation.
Table
Table 4. Fungal strains isolated in the sediment. Culture media and temperature of isolation.
Table 4. Fungal strains isolated in the sediment. Culture media and temperature of isolation.
IsolatesIdentificationEnrichment MediaTemperature (°C)NCBI Accesion Number
DIF-1Aspergillus sp.PDB15MZ602115
DIF-2Penicillium chrysogenumYMB15MZ602116
DIF-3Aspergillus sp.PDB15MZ602117
DIF-4Aspergillus sydowiiPDB15MZ602118
DIF-5Penicillium sp.PDB15MZ602119
DIF-6Penicillium sp.YMB32MZ602120
DIF-7Penicillium sp.PDB32MZ602121
DIF-8Penicillium crustosumPDB32MZ602122
DIF-9Exophiala sp.PDB32MZ602123
DIF-10Penicillium chrysogenumPDB32MZ602124
DIF-11Penicillium sp.PDB32MZ602125
DIF-12Penicillium crustosumYMB32MZ602126
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Vicente, J.; de Celis, M.; Alonso, A.; Marquina, D.; Santos, A. Microbial Communities Present in Hydrothermal Sediments from Deception Island, Antarctica. Microorganisms 2021, 9, 1631. https://doi.org/10.3390/microorganisms9081631

AMA Style

Vicente J, de Celis M, Alonso A, Marquina D, Santos A. Microbial Communities Present in Hydrothermal Sediments from Deception Island, Antarctica. Microorganisms. 2021; 9(8):1631. https://doi.org/10.3390/microorganisms9081631

Chicago/Turabian Style

Vicente, Javier, Miguel de Celis, Alejandro Alonso, Domingo Marquina, and Antonio Santos. 2021. "Microbial Communities Present in Hydrothermal Sediments from Deception Island, Antarctica" Microorganisms 9, no. 8: 1631. https://doi.org/10.3390/microorganisms9081631

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop