Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Diseased S. broughtonii Samples
2.2. Detection of OsHV-1
2.3. Histopathology Analysis of Diseased S. broughtonii
2.4. Bacterial Isolation
2.5. Bacteria Identification
2.6. Morphological Structure Analysis of V. kanaloae Strain SbA1-1
2.7. Experimental Infection
2.8. Detection of V. kanaloae in Ark Clam Using Nested PCR
2.9. Quantitation of Vibrio Abundance
2.10. Minimal Inhibitory Concentration (MIC)Determination of 2,2′-Dipyridyl (DP)
2.11. Hemolysis Assay
2.12. CAS Assay
2.13. Statistical Analysis
3. Results
3.1. Pathological Characteristics of Natural Diseased S. broughtonii in Cold Season
3.2. Isolation and Identification of Bacterial Pathogens in Diseased S. broughtonii
3.3. Growth Kinetics and Pathogenicity of V. kanaloae Strain SbA1-1 at Low (15 °C) and High (25 °C) Temperatures
3.4. Temperature Effect on the Hemolytic Activity and Siderophore Production in V. kanaloae Strain SbA1-1
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bai, C.-M.; Xin, L.-S.; Rosani, U.; Wu, B.; Wang, Q.-C.; Duan, X.-K.; Liu, Z.-H.; Wang, C.-M. Chromosomal-level assembly of the blood clam, Scapharca (Anadara) broughtonii, using long sequence reads and Hi-C. GigaScience 2019, 8, giz067. [Google Scholar] [CrossRef]
- Taniguchi, C.N.; Dobbs, J.; Dunn, M.A. Heme iron, non-heme iron, and mineral content of blood clams (Anadara spp.) compared to Manila clams (V. philippinarum), Pacific oysters (C. gigas), and beef liver (B. taurus). J. Food Compos. Anal. 2017, 57, 49–55. [Google Scholar] [CrossRef]
- Yokogawa, K. Morphological and genetic differences between Japanese and Chinese red ark shell Scapharca broughtonii. Fish. Sci. 1997, 63, 332–337. [Google Scholar] [CrossRef]
- Wei, Z.; Xin, L.; Zhang, W.; Bai, C.; Wang, C.; Li, C. Isolation and characterization of Vibrio harveyi as a major pathogen associated with mass mortalities of ark clam, Scapharca broughtonii, in summer. Aquaculture 2019, 511, 734248. [Google Scholar] [CrossRef]
- Bai, C.-M.; Wang, Q.-C.; Morga, B.; Shi, J.; Wang, C.-M. Experimental infection of adult Scapharca broughtonii with Ostreid herpesvirus SB strain. J. Invertebr. Pathol. 2017, 143, 79–82. [Google Scholar] [CrossRef]
- Xin, L.; Wei, Z.; Bai, C.; Chen, H.; Huang, B.; Wang, C. Influence of temperature on the pathogenicity of Ostreid herpesvirus-1 in ark clam, Scapharca broughtonii. J. Invertebr. Pathol. 2020, 169, 107299. [Google Scholar] [CrossRef] [PubMed]
- Park, M.S.; Lim, H.J.; Kim, P.J. Effect of environmental factors on the growth, glycogen and hemoglobin content of cultured arkshell, Scapharca broughtonii. Korean J. Fish. Aquat. Sci. 1998, 31, 176–185. [Google Scholar]
- Bai, C.; Gao, W.; Wang, C.; Yu, T.; Zhang, T.; Qiu, Z.; Wang, Q.; Huang, J. Identification and characterization of ostreid herpesvirus 1 associated with massive mortalities of Scapharca broughtonii broodstocks in China. Dis. Aquat. Org. 2016, 118, 65–75. [Google Scholar] [CrossRef]
- Alfaro, A.C.; Nguyen, T.V.; Merien, F. The complex interactions of Ostreid herpesvirus 1, Vibrio bacteria, environment and host factors in mass mortality outbreaks of Crassostrea gigas. Rev. Aquac. 2019, 11, 1148–1168. [Google Scholar] [CrossRef]
- Ina-Salwany, M.; Al-saari, N.; Mohamad, A.; Mursidi, F.A.; Mohd-Aris, A.; Amal, M.; Kasai, H.; Mino, S.; Sawabe, T.; Zamri-Saad, M. Vibriosis in fish: A review on disease development and prevention. J. Aquat. Anim. Health 2019, 31, 3–22. [Google Scholar] [CrossRef]
- Mereghetti, L.; Sitkiewicz, I.; Green, N.M.; Musser, J.M. Remodeling of the Streptococcus agalactiae transcriptome in response to growth temperature. PLoS ONE 2008, 3, e2785. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Chen, H.; Zhang, R.; Zhou, Z.; Hou, Z.; Gao, D.; Zhang, H.; Wang, L.; Song, L. Comparative transcriptome analysis of Vibrio splendidus JZ6 reveals the mechanism of its pathogenicity at low temperatures. Appl. Environ. Microbiol. 2016, 82, 2050–2061. [Google Scholar] [CrossRef] [PubMed]
- Beaz-Hidalgo, R.; Balboa, S.; Romalde, J.L.; Figueras, M.J. Diversity and pathogenecity of Vibrio species in cultured bivalve molluscs. Environ. Microbiol. Rep. 2010, 2, 34–43. [Google Scholar] [CrossRef]
- Liu, P.C.; Chen, Y.C.; Huang, C.Y.; Lee, K.K. Virulence of Vibrio parahaemolyticus isolated from cultured small abalone, Haliotis diversicolor supertexta, with withering syndrome. Lett. Appl. Microbiol. 2000, 31, 433–437. [Google Scholar] [CrossRef]
- Allam, B.; Paillard, C.; Ford, S.E. Pathogenicity of Vibrio tapetis, the etiological agent of brown ring disease in clams. Dis. Aquat. Org. 2002, 48, 221–231. [Google Scholar] [CrossRef] [PubMed]
- Anguiano-Beltrán, C.; Lizárraga-Partida, M.L.; Searcy-Bernal, R. Effect of Vibrio alginolyticus on larval survival of the blue mussel Mytilus galloprovincialis. Dis. Aquat. Org. 2004, 59, 119–123. [Google Scholar] [CrossRef]
- Estes, R.M.; Friedman, C.S.; Elston, R.A.; Herwig, R.P. Pathogenicity testing of shellfish hatchery bacterial isolates on Pacific oyster Crassostrea gigas larvae. Dis. Aquat. Org. 2004, 58, 223–230. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Qiu, L.; Yu, Z.; Zi, J.; Yue, F.; Wang, L.; Zhang, H.; Teng, W.; Liu, X.; Song, L. Identification and characterisation of pathogenic Vibrio splendidus from Yesso scallop (Patinopecten yessoensis) cultured in a low temperature environment. J. Invertebr. Pathol. 2013, 114, 144–150. [Google Scholar] [CrossRef]
- Nicolas, J.-L.; Basuyaux, O.; Mazurie, J.; Thébault, A. Vibrio carchariae, a pathogen of the abalone Haliotis tuberculata. Dis. Aquat. Org. 2002, 50, 35–43. [Google Scholar] [CrossRef]
- Wang, H.; Yue, X.; Yu, J.; Wang, R.; Teng, S.; Fang, J.; Liu, B. Microbial community changes in the digestive tract of the clam Meretrix petechialis in response to Vibrio parahaemolyticus challenge. J. Oceanol. Limnol. 2021, 39, 329–339. [Google Scholar] [CrossRef]
- Lacoste, A.; Jalabert, F.; Malham, S.; Cueff, A.; Gelebart, F.; Cordevant, C.; Lange, M.; Poulet, S. A Vibrio splendidus strain is associated with summer mortality of juvenile oysters Crassostrea gigas in the Bay of Morlaix (North Brittany, France). Dis. Aquat. Org. 2001, 46, 139–145. [Google Scholar] [CrossRef] [PubMed]
- Mechri, B.; Salem, I.B.; Medhioub, A.; Medhioub, M.N.; Aouni, M. Isolation and genotyping of potentially pathogenic Vibrio alginolyticus associated with Ruditapes decussatus larva and juvenile mass mortalities. Aquac. Int. 2015, 23, 1033–1047. [Google Scholar] [CrossRef]
- Romalde, J.; Diéguez, A.; Lasa, A.; Balboa, S. New Vibrio species associated to molluscan microbiota: A review. Front. Microbiol. 2014, 4. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Li, C. Virulence mechanisms of vibrios belonging to the Splendidus clade as aquaculture pathogens, from case studies and genome data. Rev. Aquac. 2021, 13. [Google Scholar] [CrossRef]
- Gay, M.; Berthe, F.C.; Le Roux, F. Screening of Vibrio isolates to develop an experimental infection model in the Pacific oyster Crassostrea gigas. Dis. Aquat. Org. 2004, 59, 49–56. [Google Scholar] [CrossRef]
- Labreuche, Y.; Soudant, P.; Gonçalves, M.; Lambert, C.; Nicolas, J.-L. Effects of extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on lethality and cellular immune responses of the oyster Crassostrea gigas. Dev. Comp. Immunol. 2006, 30, 367–379. [Google Scholar] [CrossRef]
- Travers, M.-A.; Miller, K.B.; Roque, A.; Friedman, C.S. Bacterial diseases in marine bivalves. J. Invertebr. Pathol. 2015, 131, 11–31. [Google Scholar] [CrossRef]
- Guijarro, J.A.; Cascales, D.; García-Torrico, A.I.; García-Domínguez, M.; Méndez, J. Temperature-dependent expression of virulence genes in fish-pathogenic bacteria. Front. Microbiol. 2015, 6. [Google Scholar] [CrossRef]
- Maeda, T.; Matsuo, Y.; Furushita, M.; Shiba, T. Seasonal dynamics in a coastal Vibrio community examined by a rapid clustering method based on 16S rDNA. Fish. Sci. 2003, 69, 385–394. [Google Scholar] [CrossRef]
- Townsley, L.; Sison Mangus, M.P.; Mehic, S.; Yildiz, F.H. Response of Vibrio cholerae to Low-Temperature Shifts: CspV Regulation of Type VI Secretion, Biofilm Formation, and Association with Zooplankton. Appl. Environ. Microbiol. 2016, 82, 4441–4452. [Google Scholar] [CrossRef]
- Oliver, J.D. Recent findings on the viable but nonculturable state in pathogenic bacteria. FEMS Microbiol. Rev. 2010, 34, 415–425. [Google Scholar] [CrossRef] [PubMed]
- Lages, M.A.; Balado, M.; Lemos, M.L. The expression of virulence factors in Vibrio anguillarum is dually regulated by iron levels and temperature. Front. Microbiol. 2019, 10, 2335. [Google Scholar] [CrossRef]
- Balado, M.; Lages, M.A.; Fuentes-Monteverde, J.C.; Martínez-Matamoros, D.; Rodríguez, J.; Jiménez, C.; Lemos, M.L. The Siderophore Piscibactin Is a Relevant Virulence Factor for Vibrio anguillarum Favored at Low Temperatures. Front. Microbiol. 2018, 9, 1766. [Google Scholar] [CrossRef] [PubMed]
- Cassat, J.E.; Skaar, E.P. Iron in infection and immunity. Cell Host Microbe 2013, 13, 509–519. [Google Scholar] [CrossRef] [PubMed]
- Schaible, U.E.; Kaufmann, S.H. Iron and microbial infection. Nat. Rev. Microbiol. 2004, 2, 946–953. [Google Scholar] [CrossRef]
- Richard, K.L.; Kelley, B.R.; Johnson, J.G. Heme uptake and utilization by gram-negative bacterial pathogens. Front. Cell. Infect. Microbiol. 2019, 9, 81. [Google Scholar] [CrossRef]
- Li, Y.; Ma, Q. Iron acquisition strategies of Vibrio anguillarum. Front. Cell. Infect. Microbiol. 2017, 7, 342. [Google Scholar] [CrossRef]
- León-Sicairos, N.; Angulo-Zamudio, U.A.; de la Garza, M.; Velazquez-Roman, J.A.; Flores-Villaseñor, H.M.; Canizalez-Román, A. Strategies of Vibrio parahaemolyticus to acquire nutritional iron during host colonization. Front. Microbiol. 2015, 6, 702. [Google Scholar] [CrossRef]
- Kawano, H.; Miyamoto, K.; Yasunobe, M.; Murata, M.; Yamahata, E.; Yamaguchi, R.; Miyaki, Y.; Tsuchiya, T.; Tanabe, T.; Funahashi, T. Identification of the heme acquisition system in Vibrio vulnificus M2799. Microb. Pathog. 2018, 117, 100–108. [Google Scholar] [CrossRef]
- Oh, M.H.; Lee, S.M.; Lee, D.H.; Choi, S.H. Regulation of the Vibrio vulnificus hupA gene by temperature alteration and cyclic AMP receptor protein and evaluation of its role in virulence. Infect. Immun. 2009, 77, 1208–1215. [Google Scholar] [CrossRef][Green Version]
- Litwin, C.M.; Rayback, T.W.; Skinner, J. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect. Immun. 1996, 64, 2834–2838. [Google Scholar] [CrossRef] [PubMed]
- Lemos, M.L.; Balado, M. Iron uptake mechanisms as key virulence factors in bacterial fish pathogens. J. Appl. Microbiol. 2020, 129, 104–115. [Google Scholar] [CrossRef]
- Martenot, C.; Oden, E.; Travaillé, E.; Malas, J.P.; Houssin, M. Comparison of two real-time PCR methods for detection of ostreid herpesvirus 1 in the Pacific oyster Crassostrea gigas. J. Virol. Methods 2010, 170, 86–89. [Google Scholar] [CrossRef]
- DeLong, E.F. Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 1992, 89, 5685–5689. [Google Scholar] [CrossRef]
- Pérez-Cataluña, A.; Lucena, T.; Tarazona, E.; Arahal, D.R.; Macián, M.C.; Pujalte, M.J. An MLSA approach for the taxonomic update of the Splendidus clade, a lineage containing several fish and shellfish pathogenic Vibrio spp. Syst. Appl. Microbiol. 2016, 39, 361–369. [Google Scholar] [CrossRef] [PubMed]
- Thompson, C.C.; Thompson, F.L.; Vicente, A.C.P.; Swings, J. Phylogenetic analysis of vibrios and related species by means of atpA gene sequences. Int. J. Syst. Evol. Microbiol. 2007, 57, 2480–2484. [Google Scholar] [CrossRef]
- Sawabe, T.; Kita-Tsukamoto, K.; Thompson, F.L. Inferring the evolutionary history of vibrios by means of multilocus sequence analysis. J. Bacteriol. 2007, 189, 7932–7936. [Google Scholar] [CrossRef] [PubMed]
- Pascual, J.; Macián, M.C.; Arahal, D.R.; Garay, E.; Pujalte, M.J. Multilocus sequence analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA, pyrH, rpoD, gyrB, rctB and toxR genes. Int. J. Syst. Evol. Microbiol. 2010, 60, 154–165. [Google Scholar] [CrossRef]
- Thompson, F.; Gevers, D.; Thompson, C.; Dawyndt, P.; Naser, S.; Hoste, B.; Munn, C.; Swings, J. Phylogeny and molecular identification of vibrios on the basis of multilocus sequence analysis. Appl. Environ. Microbiol. 2005, 71, 5107–5115. [Google Scholar] [CrossRef]
- Thompson, J.R.; Randa, M.A.; Marcelino, L.A.; Tomita-Mitchell, A.; Lim, E.; Polz, M.F. Diversity and dynamics of a north atlantic coastal Vibrio community. Appl. Environ. Microbiol. 2004, 70, 4103–4110. [Google Scholar] [CrossRef]
- De Lorenzo, V.; Neilands, J. Characterization of iucA and iucC genes of the aerobactin system of plasmid ColV-K30 in Escherichia coli. J. Bacteriol. 1986, 167, 350–355. [Google Scholar] [CrossRef]
- Ling, J.; Pan, H.; Gao, Q.; Xiong, L.; Zhou, Y.; Zhang, D.; Gao, S.; Liu, X. Aerobactin synthesis genes iucA and iucC contribute to the pathogenicity of avian pathogenic Escherichia coli O2 strain E058. PLoS ONE 2013, 8, e57794. [Google Scholar] [CrossRef] [PubMed]
- Bethke, J.; Poblete-Morales, M.; Irgang, R.; Yáñez, A.; Avendaño-Herrera, R. Iron acquisition and siderophore production in the fish pathogen Renibacterium salmoninarum. J. Fish Dis. 2016, 39, 1275–1283. [Google Scholar] [CrossRef] [PubMed]
- Lv, T.; Song, T.; Liu, H.; Peng, R.; Jiang, X.; Zhang, W.; Han, Q. Isolation and characterization of a virulence related Vibrio alginolyticus strain Wz11 pathogenic to cuttlefish, Sepia pharaonis. Microb. Pathog. 2019, 126, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Zong, B.; Wang, X.; Zhu, Y.; Hu, L.; Li, P.; Zhang, A.; Chen, H.; Liu, M.; Tan, C. Fisetin Lowers Streptococcus suis serotype 2 Pathogenicity in Mice by Inhibiting the Hemolytic Activity of Suilysin. Front. Microbiol. 2018, 9. [Google Scholar] [CrossRef] [PubMed]
- Schwyn, B.; Neilands, J.B. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 1987, 160, 47–56. [Google Scholar] [CrossRef]
- Gay, M.; Renault, T.; Pons, A.-M.; Le Roux, F. Two Vibrio splendidus related strains collaborate to kill Crassostrea gigas: Taxonomy and host alterations. Dis. Aquat. Org. 2004, 62, 65–74. [Google Scholar] [CrossRef]
- Austin, B.; Austin, D.; Sutherland, R.; Thompson, F.; Swings, J. Pathogenicity of vibrios to rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii. Environ. Microbiol. 2005, 7, 1488–1495. [Google Scholar] [CrossRef]
- Saco, A.; Rey-Campos, M.; Novoa, B.; Figueras, A. Transcriptomic Response of Mussel Gills After a Vibrio splendidus Infection Demonstrates Their Role in the Immune Response. Front. Immunol. 2020, 11. [Google Scholar] [CrossRef]
- Loof, T.G.; Schmidt, O.; Herwald, H.; Theopold, U. Coagulation systems of invertebrates and vertebrates and their roles in innate immunity: The same side of two coins? J. Innate Immun. 2011, 3, 34–40. [Google Scholar] [CrossRef]
- Xin, L.; Huang, B.; Zhang, H.; Li, C.; Bai, C.; Wang, C. OsHV-1 infection leads to mollusc tissue lesion and iron redistribution, revealing a strategy of iron limitation against pathogen. Metallomics 2019, 11, 822–832. [Google Scholar] [CrossRef]
- De Vico, G.; Carella, F. Morphological features of the inflammatory response in molluscs. Res. Vet. Sci. 2012, 93, 1109–1115. [Google Scholar] [CrossRef]
- Deriu, E.; Liu, J.Z.; Pezeshki, M.; Edwards, R.A.; Ochoa, R.J.; Contreras, H.; Libby, S.J.; Fang, F.C.; Raffatellu, M. Probiotic Bacteria Reduce Salmonella Typhimurium Intestinal Colonization by Competing for Iron. Cell Host Microbe 2013, 14, 26–37. [Google Scholar] [CrossRef]
- Hammer, N.D.; Skaar, E.P. Molecular mechanisms of Staphylococcus aureus iron acquisition. Annu. Rev. Microbiol. 2011, 65, 129–147. [Google Scholar] [CrossRef]
- Wendling, C.C.; Batista, F.M.; Wegner, K.M. Persistence, seasonal dynamics and pathogenic potential of Vibrio communities from Pacific oyster hemolymph. PLoS ONE 2014, 9, e94256. [Google Scholar] [CrossRef]
- Yue, X.; Liu, B.; Xiang, J.; Jia, J. Identification and characterization of the pathogenic effect of a Vibrio parahaemolyticus-related bacterium isolated from clam Meretrix meretrix with mass mortality. J. Invertebr. Pathol. 2010, 103, 109–115. [Google Scholar] [CrossRef]
- Paillard, C.; Le Roux, F.; Borrego, J.J. Bacterial disease in marine bivalves, a review of recent studies: Trends and evolution. Aquat. Living Resour. 2004, 17, 477–498. [Google Scholar] [CrossRef]
- Farmer, J. The family vibrionaceae. Prokaryotes 2006, 6, 495–507. [Google Scholar]
- Schumann, W. Thermosensorsy Stems in Eubacteria. In Sensing in Nature; López-Larrea, C., Ed.; Springer US: New York, NY, USA, 2012; pp. 1–16. [Google Scholar]
- Konkel, M.E.; Tilly, K. Temperature-regulated expression of bacterial virulence genes. Microbes Infect. 2000, 2, 157–166. [Google Scholar] [CrossRef]
- Colquhoun, D.; Sørum, H. Temperature dependent siderophore production in Vibrio salmonicida. Microb. Pathog. 2001, 31, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Ratledge, C.; Dover, L.G. Iron metabolism in pathogenic bacteria. Annu. Rev. Microbiol. 2000, 54, 881–941. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S.C.; Robinson, A.K.; Rodríguez-Quiñones, F. Bacterial iron homeostasis. FEMS Microbiol. Rev. 2003, 27, 215–237. [Google Scholar] [CrossRef]
- Skaar, E.P. The battle for iron between bacterial pathogens and their vertebrate hosts. PLoS Pathog. 2010, 6, e1000949. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, P.; Issac, P.K.; Raju, S.V.; Elumalai, P.; Arshad, A.; Arockiaraj, J. Pathogenic bacterial toxins and virulence influences in cultivable fish. Aquac. Res. 2021, 52, 2361–2376. [Google Scholar] [CrossRef]
- Knapp, O.; Stiles, B.; Popoff, M.R. The aerolysin-like toxin family of cytolytic, pore-forming toxins. Open Toxinol. J. 2010, 3, 53–68. [Google Scholar] [CrossRef]







| Primer Name | Product | Primer Sequence (5′-3′) | References/GenBank Accession Number |
|---|---|---|---|
| OsHV-1 quantification primers | [43] | ||
| BF | GTCGCATCTTTGGATTTAACAA | ||
| B4 | ACTGGGATCCGACTGACAAC | ||
| BP | FAM-TGCCCCTGTCATCTTGAGGTATAGACAATC-BHQ | ||
| Vibrio housekeeping gene primers | |||
| 27F | 16S rDNA | AGAGTTTGATCCTGGCTCAG | [44] |
| 1492R | GGTTACCTTGTTACGACTT | ||
| atpA-F | ATP synthase alpha subunit | CTDAATTCHACNGAAATYAGYG | [46] |
| atpA-R | TTACCARGWYTGGGTTGC | ||
| mreB-F | rod shaping protein B subunit | ACTTCGTGGCATGTTTTC | [47] |
| mreB-R | CCGTGCATATCGATCATTTC | ||
| pyrH-F | uridylate kinase | ATGASNACBAAYCCWAAACC | [48] |
| pyrH-R | GTRAABGCNGMYARRTCCA | ||
| recA-F | recombinase A | TGARAARCARTTYGGTAAAGG | [48] |
| recA-R | TCRCCNTTRTAGCTRTACC | ||
| rpoA-F | RNA polymerase alpha subunit | ATGCAGGGTTCTGTDACAG | [49] |
| rpoA-R | GHGGCCARTTTTCHARRCGC | ||
| Total Vibrio quantification primers | |||
| Vib1 | 16S rDNA | GGCGTAAAGCGCATGCAGGT | [50] |
| Vib2 | GAAATTCTACCCCCCTCTACAG | ||
| Specific nested PCR primers | |||
| Vkan-F1 | IucA/IucC family siderophore biosynthesis protein | TCGTTTTGATTTTGACTTAGGACGC | QPK06640.1 |
| Vkan-R1 | CTTGAGGTGATACACCTGAGCGTTC | ||
| Vkan-F2 | IucA/IucC family siderophore biosynthesis protein | GTCGATATTCAGATCAGGAGTCGTC | QPK06640.1 |
| Vkan-R2 | CCTTGTTAAAAGCAAATTTAGGGTG | ||
| Bacterial Names | Frequency of Occurrence a | Number | Proportion (%) b |
|---|---|---|---|
| Vibrio | 172 | 86 ± 0.07 | |
| V. fischeri | 2/10 | 3 | 1.5 ± 0.03 |
| V. penaeicida | 3/10 | 3 | 1.5 ± 0.02 |
| V. atlanticus | 3/10 | 4 | 2.0 ± 0.03 |
| V. crassostreae | 4/10 | 4 | 2.0 ± 0.03 |
| V. splendidus | 3/10 | 4 | 2.0 ± 0.03 |
| V. lentus | 4/10 | 5 | 2.5 ± 0.04 |
| V. gigantis | 5/10 | 6 | 3.0 ± 0.03 |
| V. crassostreae | 3/10 | 7 | 3.5 ± 0.05 |
| V. alginolyticus | 5/10 | 9 | 4.5 ± 0.05 |
| V. cyclitrophicus | 5/10 | 12 | 6.0 ± 0.07 |
| V. toranzoniae | 5/10 | 16 | 8.0 ± 0.09 |
| V. harveyi | 6/10 | 20 | 10.0 ± 0.10 |
| V. kanaloaec | 10/10 | 79 | 39.5 ± 0.15 |
| Pseudoalteromonas | 16 | 8 ± 0.04 | |
| P. atlantica | 4/10 | 4 | 2.0 ± 0.03 |
| P. issachenkonii | 2/10 | 4 | 2.0 ± 0.04 |
| P. tetraodonis | 2/10 | 4 | 2.0 ± 0.04 |
| P. elyakovii | 2/10 | 4 | 2.0 ± 0.04 |
| Photobacterium | 8 | 4 ± 0.05 | |
| P. swingsii | 5/10 | 8 | 4.0 ± 0.05 |
| Tenacibaculum | 4 | 2 ± 0.03 | |
| T. lutimaris | 3/10 | 4 | 2.0 ± 0.03 |
| Total | 200 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, B.; Zhang, X.; Wang, C.; Bai, C.; Li, C.; Li, C.; Xin, L. Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season. Microorganisms 2021, 9, 2161. https://doi.org/10.3390/microorganisms9102161
Huang B, Zhang X, Wang C, Bai C, Li C, Li C, Xin L. Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season. Microorganisms. 2021; 9(10):2161. https://doi.org/10.3390/microorganisms9102161
Chicago/Turabian StyleHuang, Bowen, Xiang Zhang, Chongming Wang, Changming Bai, Chen Li, Chenghua Li, and Lusheng Xin. 2021. "Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season" Microorganisms 9, no. 10: 2161. https://doi.org/10.3390/microorganisms9102161
APA StyleHuang, B., Zhang, X., Wang, C., Bai, C., Li, C., Li, C., & Xin, L. (2021). Isolation and Characterization of Vibrio kanaloae as a Major Pathogen Associated with Mass Mortalities of Ark Clam, Scapharca broughtonii, in Cold Season. Microorganisms, 9(10), 2161. https://doi.org/10.3390/microorganisms9102161

