Next Article in Journal
Taxonomic and Functional Diversity of Heterotrophic Protists (Cercozoa and Endomyxa) from Biological Soil Crusts
Next Article in Special Issue
Current Evidence for Corynebacterium on the Ocular Surface
Previous Article in Journal
Study on Bacteria Isolates and Antimicrobial Resistance in Wildlife in Sicily, Southern Italy
Previous Article in Special Issue
Corynebacterium glutamicum Mechanosensing: From Osmoregulation to L-Glutamate Secretion for the Avian Microbiota-Gut-Brain Axis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 9
Issue 1
10.3390/microorganisms9010204
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum

by
Nadja A. Henke
,
Irene Krahn
and
Volker F. Wendisch
*
Genetics of Prokaryotes, Faculty of Biology & CeBiTec, Bielefeld University, 33615 Bielefeld, Germany
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(1), 204; https://doi.org/10.3390/microorganisms9010204
Submission received: 27 December 2020 / Revised: 15 January 2021 / Accepted: 18 January 2021 / Published: 19 January 2021
(This article belongs to the Special Issue Genetics and Physiology of Corynebacteria)
Browse Figures
Versions Notes

Abstract

:
Corynebacterium glutamicum has been safely used in white biotechnology for the last 60 years and the portfolio of new pathways and products is increasing rapidly. Hence, expression vectors play a central role in discovering endogenous gene functions and in establishing heterologous gene expression. In this work, new expression vectors were designed based on two strategies: (i) a library screening of constitutive native and synthetic promoters and (ii) an increase of the plasmid copy number. Both strategies were combined and resulted in a very strong expression and overproduction of the fluorescence protein GfpUV. As a second test case, the improved vector for constitutive expression was used to overexpress the endogenous xylulokinase gene xylB in a synthetic operon with xylose isomerase gene xylA from Xanthomonas campestris. The xylose isomerase activity in crude extracts was increased by about three-fold as compared to that of the parental vector. In terms of application, the improved vector for constitutive xylA and xylB expression was used for production of the N-methylated amino acid sarcosine from monomethylamine, acetate, and xylose. As a consequence, the volumetric productivity of sarcosine production was 50% higher as compared to that of the strain carrying the parental vector.

1. Introduction

C. glutamicum was discovered in the 1960s as a natural L-glutamate producer [1]. Since then, both its genetic toolbox [2] and its number of heterologous pathways [3,4] have been extended. On the one side, production of value-added compounds such as amino acids [5,6], organic acids [7,8], and terpenoids [9,10] has been established. Recently, the production of sarcosine (N-methylglycine) was enabled by overexpression of the imine reductase DpkA from Pseudomonas putida in a glyoxylate-overproducing C. glutamicum strain by providing monomethylamine as the methyl-donor [11]. On the other side, several approaches were followed in order to establish a flexible feedstock concept that allows C. glutamicum production strains to grow/produce on the basis of a variety of non-food competitive substrates such as industrial or agricultural/aquatic side streams [12]. The access to glycerol, the stoichiometric byproduct of biodiesel production, was enabled and applied to various production strains [13,14]. Moreover, recent attempts have aimed to establish the methylotrophy in C. glutamicum for methanol utilization [15]. Besides the sugar polymers starch [16] and cellulose [17], the pentose sugars xylose and arabinose [18,19] that derive from hemicellulose can be used as alternative substrates for a variety of high-value products including the fragrance compound patchoulol [20] and the potential antipsychotic compound sarcosine [11].
Many of these production strain-engineering efforts rely on gene expression vectors, which represent a powerful tool not only for metabolic engineering, but also for in depth analysis of basic metabolic principles in C. glutamicum that facilitate the development of new metabolic engineering strategies. For C. glutamicum, a wide range of different expression vectors have been used in research: inducible expression vectors, constitutive expression vectors [21], dual-expression vectors [22,23], promoter-probe vectors [24], and suicide-vectors for homologous recombination [25]. Most of the expression vectors used today for C. glutamicum are based on the origins of replication pBL1, pGA1, pCG1, and pHM1519 that derive from natural plasmids of corynebacteria [26].
Among many others, pVWEx1 and pECXT99A represent well-established expression vectors for C. glutamicum that use the Ptac/Ptrc promoter and carry a lacI gene allowing for IPTG-inducible gene expression [27,28]. These IPTG-inducible expression systems make use of the Lac repressor from E. coli since C. glutamicum lacks a homolog and they provide lac operator(s) [29]. Replication of pVWEx1 in C. glutamicum relies on the pHM1519 replicon. Recently, it was shown that a mutation in the initiator protein RepA improved the plasmid copy number of pHM1519 origin to around 800 copies per cell [30].
The promoter structure and consensus sequence have been intensively examined [31]. In addition, the assignment of sigma factors of the RNA polymerase to the respective promoters [32] paved the way to the identification of their regulatory networks [33,34,35]. The promoters that are depending on the house-keeping sigma factor SigA or the alternative sigma factor SigB are suitable for application in metabolic engineering [35,36]. Therefore, the choice of interesting promoters as genetic elements in vector design also relies on the respective sigma factor that facilitates promoter recognition. Libraries of natural and synthetic promoters have been screened and identified, e.g., the synthetic promoter H36 was described to be 16-fold stronger than the Ptrc promoter [37] and a synthetic promoter comprising the −10 consensus sequence TAnnnT from C. glutamicum and the −35 motif TTGACA supported very high transcription [38].
In this work, we assessed the improvement of plasmid copy number and the choice of strong promoters alone or in combination for plasmid-borne target gene expression. In addition to scoring fluorescent reporter gene expression, we applied the gained insight to improve production of the N-methylated amino acid sarcosine from monomethylamine, acetate, and xylose.

2. Materials and Methods

2.1. Bacterial Strains and Growth Conditions

Strains and plasmids used in this study are listed in Table 1. Newly constructed vectors were evaluated to be functional in C. glutamicum WT. Chemicals were delivered by Carl Roth (Karlsruhe, Germany) if not stated differently. Precultures of C. glutamicum strains were grown in complex medium Luria broth (LB) (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl) or brain heart infusion (BHI) (37 g/L) supplemented with 50 mL 2% glucose overnight in 500 mL baffled flasks. Main cultures were grown in CGXII minimal medium (20 g/L (NH4)2SO4, 5 g/L urea, 1 g/L KH2PO4, 1 g/L K2HPO4, 42 g/L MOPS, 0.25 g/L MgSO4 × 7 H2O, 10 mg/L CaCl2, 10 mg/L FeSO4 × 7H2O, 10 mg/L MnSO4 × H2O, 1 mg/L ZnSO4 × 7H2O, 0.2 mg/L CuSO4, 0.02 mg/L NiCl2 × 6H2O, 0.2 mg/L biotin (Sigma-Aldrich, Taufkirchen, Germany), and 30 mg/L protocatechuate (VWR, Darmstadt, Germany)) supplemented with the named carbon source after washing in TN-buffer (10 mM Tric-HCl (pH 6.3), 10 mM NaCl). Sarcosine production was performed with 12 g/L xylose and 20 g/L potassium acetate as carbon sources and a reduced concentration of nitrogen (2 g/L (NH4)2SO4 and 0.5 g/L urea) in the presence of 3.1 g/L monomethylamine (MMA) (TCI, Eschborn, Germany). Main cultures were inoculated to an initial OD600 nm of 1 using a Shimadzu UV-1202 spectrophotometer (Duisburg, Germany). To achieve the high aeration required for aerobic cultures of C. glutamicum, cultivations were performed in 50 mL of culture medium in 500 mL baffled shake flasks at 120 rpm, or alternatively in 1 mL culture medium in the Biolector® flowerplate system (m2p-labs GmbH, Baesweiler, Germany) at 1100 rpm at 30 °C. E. coli DH5α cells were cultivated at 37 °C in LB medium. Tetracycline, kanamycin, and spectinomycin (VWR, Darmstadt, Germany) were added if appropriate in concentrations of 5, 25, and 100 µg mL−1.

2.2. Construction of New Expression Vectors

The new expression plasmids were constructed in E. coli DH5α. First, target promoters or genes were amplified by a high-fidelity PCR (All-in HiFi, highQu, Kraichtal, Germany) and cloned into digested or backbone-amplified expression vectors by Gibson-Assembly [44]. The oligonucleotides are listed in Table 2 and were delivered by Metabion (Planegg/Steinkirchen, Germany). The PCR amplificates were purified with a PCR and gel extraction kit (Macherey-Nagel, Düren, Germany). E. coli DH5α-competent cells were prepared with CaCl2 and transformed via heat shock. Recombinant clones were screened by colony-PCR and plasmids were isolated with a miniprep kit (GeneJET, Thermo Fisher Scientific, Schwerte, Germany). New expression vectors were confirmed by sequencing. C. glutamicum cells were transformed by electroporation as described elsewhere [45].

2.3. Cloning of pECXT99A and pVWEx1-Based Expression Vectors

For construction of the pECXT99A-based expression vectors, pECXT99A was digested with NcoI and NdeI (Thermo Scientific Fisher, Schwerte, Germany) and dephosphorylated (Antarctic phosphatase, New England Biolabs, Frankfurt, Germany). Target promoters were amplified using the oligonucleotides as follows: Ptuf (cg0587): HN12 + HN13; PgapA (cg1791): HN14 + HN15; PilvC (cg1437): HN16 + HN17; PsodA (cg3237): HN30 + HN31; Ppgk (cg1790): HN97 + HN98; P45: HA02 + HA03; PH36: HA04 + HA05; Psyn: HA06 + HA07. The native promoters were amplified from the genomic DNA of C. glutamicum WT. The synthetic promoters Psyn (5′-TTGACATTAATTTGAATCTGTGTTATAATGGTTC-3′), PH36 (5′-CAAAAGCTGGGTACCTCTATCTGGTGCCCTAAACGGGGGAATATTAACGGGCCCAGGGTG.
GTCGCACCTTGGTTGGTAGGAGTAGCATG-3′), and P45 (5′-TTGGTCAGGGATTTTTTCCCGAGGGCACTAATTTTGCTAAAGTAAGTGACGAAGAAGTTC-3′) were synthesized or inserted by oligonucleotides in the case of P45. All constructs were checked by sequencing. Newly constructed expression vectors were digested with BamHI and the fluorescence reporter gene gfpUV (HN49 + HN50) was cloned via Gibson-Assembly.
For construction of the pVWEx4 expression vectors, a site-directed mutagenesis in the repA gene was performed on pVWEx1 for an increased plasmid copy number. Site-directed mutagenesis was conducted via plasmid backbone amplification (HA36 + HA37) with Pfu Turbo DNA Polymerase. The vector pVWEx6 was constructed via digestion of pVWEx4 with KpnI and MauBI and insertion of the Psyn promoter including a lac operator motif (N105 + N106).

2.4. Fluorescence Analysis

GfpUV fluorescence was measured on a FACS GalliosTM (Beckmann Coulter GmbH, Krefeld, Germany) with 405 nm excitation from a blue solid-state laser. Forward-scatter characteristics (FSC) and side-scatter characteristics (SSC) were monitored as small- and large-angle scatters of the 405 nm laser. Fluorescence was detected using a band-pass filter (500/50 nm). The produced GfpUV protein possesses characteristic emission at 509 nm with an excitation wavelength of 385 nm. C. glutamicum WT harboring the newly constructed plasmids or the control plasmid were harvested in stationary growth, washed once in phosphate-buffered saline, and the optical density was adjusted to OD600nm ~0.1. C. glutamicum WT was used to determine autofluorescence. Median fluorescence intensities of 20,000 cells were calculated from each culture.

2.5. SDS-PAGE

C. glutamicum WT cells carrying the newly constructed plasmids were grown at 30 °C in 1 mL in Biolector® flowerplate system (m2p-labs GmbH, Baesweiler, Germany). Cells were harvested by centrifugation and stored at −20 °C. For cell extract preparation, thawed cells were re-suspended in KPI buffer (100 mM disodium hydrogenphosphate and 100 mM sodium dihydrogenphosphate with pH 6.9). Cells were disrupted by ultrasonification using Hielscher UP200S2 (Teltow, Germany) with an amplitude of 60% and a pulsing cycle of 0.5 (power discharge 0.5 s, pause 0.5 s) for 9 min. After ultracentrifugation (1 h, 45,000× g, 4 °C) the protein concentration was determined with Bradford Reagent (Sigma-Aldrich, Germany). Then, a 10 µg protein sample was mixed with Lämmli-Buffer and loaded on an SDS-PAGE, comprising a 4% stacking gel and 10% running gel. Gels were initially run at 50 V and then at 100 V. Protein gels were stained in 0.1% Coomassie blue solution (30% methanol; 10% acetic acid).

2.6. Enzyme Assay for Xylose Isomerase XylA

Cells of the strains WT (pECXT99A-xylAB) and WT (pECXT_Psyn-xylAB) were inoculated from a fresh LB overnight culture into a LB main culture with antibiotics and IPTG (1 mM) if applicable. Cultures were inoculated with an initial OD600 nm of 0.6 and grown until OD600 nm was 4. All cells from each culture were harvested at 4 °C and stored at −20 °C till further use. Cells were washed in Tris-HCl Buffer (100 mM pH 7.5) and resuspended in 2 mL buffer prior to ultrasonification using Hielscher UP200S2 (Teltow, Germany) with an amplitude of 60% and a pulsing cycle of 0.5 (power discharge 0.5 s, pause 0.5 s) for 9 min. After ultracentrifugation (1 h, 45,000× g, 4 °C) the protein concentration was determined with Bradford Reagent (Sigma-Aldrich, Germany). Enzymatic activity of XylA was measured from the raw extract in a total volume of 1 mL at 30 °C: 100 mM Tris-HCl pH 7.5, 10 mM MgCl2, 0.17 mM NADH, and 1 U sorbitol dehydrogenase. Then, 200 µL D-xylose (2.5 M) was added and absorption was measured for an additional 3 min using a Shimadzu UV-1650 PC photometer (Shimadzu, Duisburg, Germany). The assay was performed with three appropriate protein concentrations each, applying 5/10/15 µL of crude extracts from strains WT (pECXT99A-xylAB) and WT (pECXT_Psyn-xylAB) with protein concentrations of 5.8 mg/mL and 1.72 mg/mL, respectively. Specific activities were calculated as µmol min−1 (mg protein)−1, defined as one unit (U/mg).

2.7. Sarcosine Quantification

Sarcosine quantification was performed from the clear supernatant of culture samples. Samples were derivatized with 9-fluorenylmethyl chlorocarbonate (FMOC) as decribed elsewhere [46]. Identification and separation was performed on a reversed phase HPLC. The column system consisted of a precolumn (LiChrospher 100 RP18 EC-5, 40 × 4 mm) and a main column (LiChrospher 100 RP18 EC-5, 125 × 4 mm) (CS Chromatographie Service GmbH, Langerwehe, Germany). Sodium acetate (50 mM pH 4.2) (A) and acetonitrile (B) were used as the mobile phases. A gradient with a flow rate of 1.2 mL min−1 was used as follows: 0 min 38% B; 10 min 38% B; 17 min 57% B; 19 min 76% B; 20 min 76% B, and 23 min 38% B. Detection of the fluorescent derivatives was performed by a fluorescence detector (FLD G1321A, 1200 series, Agilent Technologies, Ratingen, Germany) with an excitation wavelength of 263 nm and emission wavelength of 310 nm. Calibration was conducted with a sarcosine standard (Sigma-Aldrich, Steinheim, Germany). L-proline was used as an internal standard.

3. Results

3.1. Screening of Strong Constitutive Promoters in the pECXT99A-Based Vector System

A selection of native and synthetic promoters was cloned in the pECXT99A-backbone (lacking the lacIq gene to allow for constitutive expression) in order to test the different promoter strengths using the promoterless reporter gene gfpUV. The promoters from the endogenous genes tuf (cg0587), ilvC (cg1437), sodA (cg3237), gapA (cg1791), and pgk (cg1790) were amplified from the genome of C. glutamicum WT. The synthetic promoters PH36 and Psyn were generated by gene synthesis, whereas P45 was generated by oligonucleotide insertion. GfpUV reporter fluorescence in C. glutamicum WT carrying the plasmids was monitored 18 h after inoculation in CGXII with 4% glucose without any inducer. The strain carrying the parental plasmid pECXT99A-gfpUV (with lacIq) was chosen as a reference (cultured in the presence of 1 mM IPTG), as this vector served as the starting point for the cloning of the promoter library. All tested promoters showed activity and, thus, allowed for constitutive gene expression without the need to add an inducer to the medium (Figure 1). The synthetic promoter PH36 (norm. MFI: 2.7 ± 13%) and the endogenous promoters Ppgk (norm. MFI: 4.0 ± 12%) and PilvC (norm. MFI: 7.0 ± 5%) showed significant expression in comparison to that of the autofluorescence (norm. MFI: 1.0 ± 10%). However, the expression was relatively low in comparison to that of the other vectors. The endogenous promoters PsodA (norm. MFI: 10.8 ± 1%), PgapA (norm. MFI: 19 ± 9%), and Ptuf (norm. MFI: 50 ± 15%) showed increasing expression levels with the latter one showing comparable expression values to that of the synthetic P45 (norm. MFI: 56 ± 7%). Thus, gfpUV expression from the constitutive P45 was as strong as IPTG-induced gfpUV expression from Ptrc in pECXT99A (with lacIq and Ptrc; norm. MFI: 56 ± 6%). Notably, gfpUV expression from the synthetic promoter Psyn exceeded this level by about a factor of five (norm. MFI: 286 ± 4%). Thus, the newly constructed pECXT_Psyn showed the highest gfpUV expression of the compared vectors (Figure 1).

3.2. Improving Plasmid-Borne Inducible Gene Expression in C. glutamicum by Combination of a Stronger Promoter with Increased Plasmid Copy Number

First, the properties of the commonly used IPTG-inducible expression vectors pEKEx3, pVWEx1, and pECXT99A were compared with regard to gfpUV gene expression by FACS analysis (Figure 2) and protein abundance by SDS-PAGE (Figure 3). Induction factors were determined from reporter fluorescence measured in the absence and presence of 1 mM IPTG. With vector pEKEx3-gfpUV, a maximal norm. MFI of 64 ± 13% was reached, but expression was leaky, thus, an induction factor of only 6 resulted (Figure 2). The vector pECXT99A-gfpUV supported a maximal norm. MFI of 48 ± 3% with an induction factor of 47. Expression from pVWEx1-gfpUV without IPTG was as tight as that observed for pECXT99A-gfpUV. With higher maximal norm. MFI of 99 ± 3% an induction factor of 76 was observed with pVWEx1-gfpUV. SDS-PAGE revealed lower GfpUV protein abundance for pEKEx3-gfpUV as compared to that of pECXT99A-gfpUV, which was highest among the three vectors for pVWEx1-gfpUV (Figure 3).
Next, we sought to improve inducible gene expression vector pVWEx1, which possesses the origin of replication pHM1519. It has been show that pHM1519-based vectors are maintained at plasmid copy numbers of approximately 140 in C. glutamicum cells [47]. Importantly, it has recently been shown that the copy number of vectors with a pHM1519 replicon can be increased about 5-fold to about 800 [30]. This finding prompted us to increase the plasmid copy number of pVWEx1. Therefore, the repA gene encoding an initiator protein for the pHM1519 replicon was mutated (base transition from G to A at nucleotide 1286) to exchange Gly at position 429 of RepA protein by Glu via site-directed mutagenesis, which was designated as copA1 [30]. The resulting vector based on pVWEx1 with the mutation RepAG429D was named pVWEx4. FACS analysis revealed an approximately 1.5-fold increased IPTG-induced gfpUV gene expression using vector pVWEx4-gfpUV as compared to that using pVWEx1-gfpUV (norm. MFI of 145 ± 7% as compared to 99 ± 3%). Since expression without IPTG was almost as tight for pVWEx4 as for pVWEx1, the induction factor with pVWEx4 was higher than that with pVWEx1 (121 as compared to 76). Thus, introduction of the copA1 mutation into the repA gene increased the plasmid copy number as expected, and allowed for a very strong and more than 100-fold inducible target gene expression.
Third, since Ptrc was weaker than Psyn (Figure 1), we hypothesized that replacing Ptrc in plasmid pVWEx4 by the stronger Psyn, while maintaining the lacIq and lac operator sequences for IPTG-inducible gene expression, would lead to increased target gene expression that could be modulated by titrating IPTG concentrations. The resulting vector was named pVWEx6. This vector allowed for an approximately 50-fold induction with 1 mM IPTG, leading to a maximal norm. MFI of 410 ± 1% (Figure 2 and Table 3).
Moreover, we sought to find a lower IPTG concentration for pVWEx6 that would achieve comparable expression as that of the fully induced pVWEx1, pEXCT99A, and/or pEKEx3. Our choice of 0.025 mM and 0.050 mM IPTG as intermediate IPTG concentrations was guided by prior experience with vectors pVWEx1 and pEKEx3 for expression of genes for membrane proteins or transporter proteins [48,49,50]. Overexpression of genes for membrane proteins or transporter proteins proved difficult as too high levels reduced growth, probably by altering membrane integrity. However, with 0.025 mM or 0.050 mM IPTG as the intermediate IPTG concentrations, functional overexpression of genes coding for membrane proteins or transporter proteins was achieved without observed growth impairment [48,49,50]. Here, intermediate GfpUV fluorescence was observed with 0.025 and 0.05 mM IPTG. SDS-PAGE analysis of GfpUV reporter protein abundance (Figure 3) confirmed the FACS results of very strong expression (Figure 2). In fact, the IPTG-induction factor was as high as those obtained with pVWEx1 and pECXT99A, while the fully induced expression strength supported by pVWEx6 was one magnitude higher than those achieved with pEKEx3, pECXT99A, and pVWEx1.

3.3. Fast Production of Sarcosine from Xylose by Application of the Newly Constructed pECXT_Psyn

As an application test, sarcosine production by C. glutamicum was chosen (Figure 4A). C. glutamicum was engineered to produce the N-methylated amino acid sarcosine in the enzyme reaction catalyzed by the Pseudomonas putida KT2440 imine reductase DpkA using glyoxylate as the 2-oxo acid substrate and monomethylamine as the N-alkyl donor [11]. To enable xylose utilization, the WT carrying malate synthase gene deletion ΔaceB, a start codon exchange from ATG to GTG for isocitrate dehydrogenase gene icd and the vector pVWEx1-dpkA_RBSopt for IPTG-inducible expression of dpkA, was transformed with pECXT99A-xylAB as the second vector. Notably, the resulting C. glutamicum strain SAR3 produced sarcosine with higher yield coefficients than that with glucose, however, the volumetric productivity was low due to slow growth with xylose [11]. To test if stronger expression of xylAB using the newly constructed vector pECXT99A_Psyn-xylAB accelerates xylose-based sarcosine production, strain SAR3* that carried pECXT99A_Psyn-xylAB instead of pECXT99A-xylAB was constructed (Figure 4A).
First, to score xylose catabolism an enzyme assay of the heterologous xylose isomerase XylA was performed. To this end, crude extracts of C. glutamicum WT carrying either pECXT99A_Psyn-xylAB or pECXT99A-xylAB were prepared and assayed spectrophotometrically for XylA activity (Figure 4B). A more than 3-fold increase in the specific XylA activity indicated that pECXT99A_Psyn-xylAB provided higher xylAB expression than pECXT99A-xylAB (Figure 4B). Next, sarcosine production by strains SAR3 and SAR3* was compared in media containing monomethylamine, potassium acetate, and xylose. When grown in the presence of acetate, C. glutamicum is known to carry a high flux from acetyl-CoA into the TCA cycle and to glyoxylate [7,51] (Figure 4A). This is due to transcriptional regulation of the isocitrate lyase gene aceA (and malate synthase gene aceB that is deleted in SAR3) by the transcriptional activator RamA and the transcriptional repressor RamB [52,53]. Xylose served as the primary carbon and energy source for growth under these conditions. Growth of SAR3* was 1.3-fold faster than growth of SAR3 (growth rates of 0.13 ± 0.01 h−1 as compared to 0.10 ± 0.01 h−1, respectively). Importantly, after 20 h, sarcosine accumulated to titers of 1.0 ± 0.08 g L−1 for SAR3 and 1.5 ± 0.13 g L−1 for SAR3* (Figure 4C). As a consequence, the volumetric productivity was improved by 50% (0.077 g L−1 h−1 for SAR3*) as compared to SAR3 (0.051 g L−1 h−1). Thus, pECXT99A_Psyn-xylAB proved useful to improve the xylose-based sarcosine production by recombinant C. glutamicum.

4. Discussion

Expression vectors play a crucial role in basic research to investigate endogenous metabolism and to establish microbial bio-production by metabolic engineering. However, the development and/or optimization of expression systems is rarely the focus of scientific work. In this study, we focused on the optimization of the two well-established expression vectors pECXT99A and pVWEx1 by application of a strong promoter and by an increased plasmid copy number, respectively. Due to different C. glutamicum origins of replication and antibiotic resistance markers (Table 3), these vectors can co-exist: pEKEx3 plus pECXT99A or pECXT_Psyn plus pVWEx1 or pVWEx4 or pVWEx6.
The expression level of a vector system is dependent on a wide range of aspects that affect either transcription or translation of an overexpressed gene or the protein stability itself. For example, plasmid-driven gene expression relies on the number of gene copies (plasmid-copy number) and the promoter strength. Both aspects were part of this work. In addition, the translational efficiency of target genes may be optimized by changing the translational start codon [54] or by changing ribosome binding sites as a trade-off between an optimal RBS (consensus C. glutamicum: 5′-GAAAGGAGG-3′) and the prevention of secondary mRNA structures [55,56,57]. Independent of vector characteristics, the target gene (and gene product) may be optimized. Protein stability can be improved either by adding tags, by construction of fusion enzymes [58,59], or by truncations to improve protein solubility [60,61] while taking into account dimerization domains, catalytic centers, and cofactor binding sites [62]. If their termini are freely accessible, membrane proteins may be fused as shown in the fusion of the cytosolic C terminus of CrtZ to the cytosolic N terminus of CrtW, which resulted in improved astaxanthin production by C. glutamicum [10]. The improved vectors developed here (pVWEx4, pVWEx6, and pECXT99A_Psyn) add to the toolbox available to microbiologists studying the physiology of C. glutamicum as well as for metabolic engineering in strain and process development. Moreover, the expression characteristics obtained in comparative fluorescence reporter gene expression experiments will guide the choice of vectors according to the task of interest.
To compare plasmid-borne target gene expression, the endogenous promoters of the genes pgk, ilvC, sodA, gapA, and tuf were chosen in this study. The promoters of the glycolytic genes pgk [63] and gapA [64], encoding phosphoglycerate kinase and glyceraldehyde 3-phosphate dehydrogenase, respectively, as well as of the superoxide dismutase gene sodA [65], the ketol-acid reductoisomerase gene ilvC [65], and the transcription elongation factor gene tuf [66] have already been described as strong constitutive promoters. In a different vector background, it was shown that PilvC and PsodA showed strong expression in a GFP reporter assay with comparable expression levels as that of Ptac in the case of PilvC and around a 2.5-fold higher expression in the case of PsodA [65]. In the study presented here, expression levels of both promoters were lower than that of Ptrc. As discussed above, the promoter is one of several factors influencing reporter gene expression, making comparisons of reporter gene expression using different vector backbones, ribosome binding sites, etc. difficult. Nevertheless, the previously described vectors along with those described here allow for low, but constitutive expression and are of interest for the production of membrane proteins, transporter proteins, or enzymes that lead to the formation of toxic byproducts and for balancing of engineered pathways [48].
To maximize target gene expression, the design and usage of synthetic promoters for genetic engineering in C. glutamicum is on the rise, as these usually short promoters can achieve high transcription levels [37,38]. Moreover, the utilization of artificial promoters allows researchers to circumvent the challenges of regulatory interference in metabolic engineering approaches for overproduction. The PH36 promoter was identified by Yim et al. 2013, where it showed a 60-fold higher expression level in the pCES plasmid background in comparison to that of the Ptrc promoter [37]. In contrast, here, PH36 showed the weakest expression in the fluorescence assay. The synthetic Psyn was designed and identified as it showed high promoter activity in a β-galactosidase assay [38]. Although this result is difficult to compare with the fluorescence assay used here, we have shown that the short synthetic promoter Psyn (5′-TTGACATTAATTTGAATCTGTGTTATAATGGTTC-3′) enabled tunable and strong expression in combination with the lac operator sequence in cis (5′-CTGGAATTGTGAGCGGATAACAATTC-3′) and lacIq in trans. The newly constructed pVWEx6 vector showed a gene expression strength that is one magnitude higher than that of other commonly used expression vectors. Thus, the application of pVWEx6 can reduce the costs for IPTG, as 25 µM IPTG lead to comparable expression patterns as that of pVWEx1, pECXT99A, and pEKEx3 induced with 1 mM IPTG. Potentially, leakiness of these vectors can be further minimized as shown very recently for pEKEx2 by restoring lacIq gene sequences and by avoiding duplicate DNA sequences [67].
As an application case, we transferred the findings about elevated gene expression to fermentative sarcosine production with C. glutamicum. Strain SAR3* was based on the newly designed pECXT_Psyn for expression of xylose utilization gene xylAB and it showed a volumetric productivity for sarcosine with 0.077 g L−1 h−1 as compared to that of the reference strain (0.051 g L−1 h−1) [11]. Our previous work on sarcosine production [11] identified slow growth with xylose as the limitation of the volumetric productivity for sarcosine. Here, we have shown that accelerating growth with xylose improved the volumetric productivity of SAR3* by 50% as compared to that of SAR3. We deliberately did not use pVWEx4 or pVWEx6 for dpkA expression here, since N-methylation of glyoxylate to yield sarcosine as catalyzed by DpkA does not limit sarcosine production. This was deduced from our previous work [68], where pVWEx1-dpkA supported a volumetric productivity of up to 0.35 g L−1 h−1 for N-methylation of pyruvate to N-methylalanine. Since it was shown that doubling of the MMA concentration as well as optimization of the carbon source composition (5 g/L xylose and 30 g/L actetate) improved the sarcosine production by SAR3 about 3-fold, combination of the newly constructed strain SAR3* with those culture conditions might further improve sarcosine production with C. glutamicum.

Author Contributions

N.A.H. and V.F.W. designed the experiments. N.A.H. and I.K. planned and performed the experiments. N.A.H., I.K., and V.F.W. analyzed the data. N.A.H. and V.F.W. drafted the manuscript. V.F.W. coordinated the study and finalized the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the European Regional Development Fund (ERDF) and the Ministry of Economic Affairs, Innovation, Digitalization and Energy of the State of North Rhine-Westphalia, grant number EFRE-0400184 (Bicomer). Support for the Article Processing Charge by the Deutsche Forschungsgemeinschaft and the Open Access Publication Fund of Bielefeld University is acknowledged.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in article.

Acknowledgments

We thank Anna Hamker for assistance during plasmid construction and Petra Peters-Wendisch for scientific discussion.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Kinoshita, S.; Udaka, S.; Shimono, M. Studies on the amino acid fermentation. Production of L-glutamic acid by various microorganisms. J. Gen. Appl. Microbiol. 1957, 3, 193–205. [Google Scholar] [CrossRef]
  2. Kirchner, O.; Tauch, A. Tools for genetic engineering in the amino acid-producing bacterium Corynebacterium glutamicum. J. Biotechnol. 2003, 104, 287–299. [Google Scholar] [CrossRef]
  3. Becker, J.; Rohles, C.M.; Wittmann, C. Metabolically engineered Corynebacterium glutamicum for bio-based production of chemicals, fuels, materials, and healthcare products. Metab. Eng. 2018, 50, 122–141. [Google Scholar] [CrossRef] [PubMed]
  4. Heider, S.A.; Wendisch, V.F. Engineering microbial cell factories: Metabolic engineering of Corynebacterium glutamicum with a focus on non-natural products. Biotechnol. J. 2015, 10, 1170–1184. [Google Scholar] [CrossRef]
  5. Wendisch, V.F. Metabolic engineering advances and prospects for amino acid production. Metab. Eng. 2020, 58, 17–34. [Google Scholar] [CrossRef] [PubMed]
  6. Pérez-García, F.; Peters-Wendisch, P.; Wendisch, V.F. Engineering Corynebacterium glutamicum for fast production of L-lysine and L-pipecolic acid. Appl. Microbiol. Biotechnol. 2016, 100, 8075–8090. [Google Scholar] [CrossRef] [PubMed]
  7. Zahoor, A.; Otten, A.; Wendisch, V.F. Metabolic engineering of Corynebacterium glutamicum for glycolate production. J. Biotechnol. 2014, 192, 366–375. [Google Scholar] [CrossRef]
  8. Wieschalka, S.; Blombach, B.; Bott, M.; Eikmanns, B.J. Bio-based production of organic acids with Corynebacterium glutamicum. Microb. Biotechnol. 2013, 6, 87–102. [Google Scholar] [CrossRef] [Green Version]
  9. Frohwitter, J.; Heider, S.A.; Peters-Wendisch, P.; Beekwilder, J.; Wendisch, V.F. Production of the sesquiterpene (+)-valencene by metabolically engineered Corynebacterium glutamicum. J. Biotechnol. 2014, 191, 205–213. [Google Scholar] [CrossRef]
  10. Henke, N.A.; Wendisch, V.F. Improved Astaxanthin Production with Corynebacterium glutamicum by Application of a Membrane Fusion Protein. Mar. Drugs 2019, 17, 621. [Google Scholar] [CrossRef] [Green Version]
  11. Mindt, M.; Heuser, M.; Wendisch, V.F. Xylose as preferred substrate for sarcosine production by recombinant Corynebacterium glutamicum. Bioresour. Technol. 2019, 281, 135–142. [Google Scholar] [CrossRef]
  12. Wendisch, V.F.; Brito, L.F.; Gil Lopez, M.; Hennig, G.; Pfeifenschneider, J.; Sgobba, E.; Veldmann, K.H. The flexible feedstock concept in Industrial Biotechnology: Metabolic engineering of Escherichia coli, Corynebacterium glutamicum, Pseudomonas, Bacillus and yeast strains for access to alternative carbon sources. J. Biotechnol. 2016, 234, 139–157. [Google Scholar] [CrossRef] [PubMed]
  13. Rittmann, D.; Lindner, S.N.; Wendisch, V.F. Engineering of a glycerol utilization pathway for amino acid production by Corynebacterium glutamicum. Appl. Environ. Microbiol. 2008, 74, 6216–6222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Meiswinkel, T.M.; Rittmann, D.; Lindner, S.N.; Wendisch, V.F. Crude glycerol-based production of amino acids and putrescine by Corynebacterium glutamicum. Bioresour. Technol. 2013, 145, 254–258. [Google Scholar] [CrossRef] [PubMed]
  15. Hennig, G.; Haupka, C.; Brito, L.F.; Rückert, C.; Cahoreau, E.; Heux, S.; Wendisch, V.F. Methanol-Essential Growth of Corynebacterium glutamicum: Adaptive Laboratory Evolution Overcomes Limitation due to Methanethiol Assimilation Pathway. Int. J. Mol. Sci. 2020, 21, 3617. [Google Scholar] [CrossRef]
  16. Seibold, G.; Auchter, M.; Berens, S.; Kalinowski, J.; Eikmanns, B.J. Utilization of soluble starch by a recombinant Corynebacterium glutamicum strain: Growth and lysine production. J. Biotechnol. 2006, 124, 381–391. [Google Scholar] [CrossRef]
  17. Anusree, M.; Wendisch, V.F.; Nampoothiri, K.M. Co-expression of endoglucanase and β-glucosidase in Corynebacterium glutamicum DM1729 towards direct lysine fermentation from cellulose. Bioresour. Technol. 2016, 213, 239–244. [Google Scholar] [CrossRef]
  18. Gopinath, V.; Meiswinkel, T.M.; Wendisch, V.F.; Nampoothiri, K.M. Amino acid production from rice straw and wheat bran hydrolysates by recombinant pentose-utilizing Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2011, 92, 985–996. [Google Scholar] [CrossRef]
  19. Gopinath, V.; Murali, A.; Dhar, K.S.; Nampoothiri, K.M. Corynebacterium glutamicum as a potent biocatalyst for the bioconversion of pentose sugars to value-added products. Appl. Microbiol. Biotechnol. 2012, 93, 95–106. [Google Scholar] [CrossRef]
  20. Henke, N.A.; Wichmann, J.; Baier, T.; Frohwitter, J.; Lauersen, K.J.; Risse, J.M.; Peters-Wendisch, P.; Kruse, O.; Wendisch, V.F. Patchoulol Production with Metabolically Engineered Corynebacterium glutamicum. Genes (Basel) 2018, 9, 219. [Google Scholar] [CrossRef] [Green Version]
  21. Henke, N.A.; Heider, S.A.; Peters-Wendisch, P.; Wendisch, V.F. Production of the Marine Carotenoid Astaxanthin by Metabolically Engineered Corynebacterium glutamicum. Mar. Drugs 2016, 14, 124. [Google Scholar] [CrossRef] [PubMed]
  22. Gauttam, R.; Desiderato, C.; Jung, L.; Shah, A.; Eikmanns, B.J. A step forward: Compatible and dual-inducible expression vectors for gene co-expression in Corynebacterium glutamicum. Plasmid 2019, 101, 20–27. [Google Scholar] [CrossRef] [PubMed]
  23. Goldbeck, O.; Seibold, G.M. Construction of pOGOduet—An inducible, bicistronic vector for synthesis of recombinant proteins in Corynebacterium glutamicum. Plasmid 2018, 95, 11–15. [Google Scholar] [CrossRef] [PubMed]
  24. Knoppova, M.; Phensaijai, M.; Vesely, M.; Zemanova, M.; Nesvera, J.; Patek, M. Plasmid vectors for testing in vivo promoter activities in Corynebacterium glutamicum and Rhodococcus erythropolis. Curr. Microbiol. 2007, 55, 234–239. [Google Scholar] [CrossRef]
  25. Schäfer, A.; Tauch, A.; Jäger, W.; Kalinowski, J.; Thierbach, G.; Puhler, A. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: Selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 1994, 145, 69–73. [Google Scholar] [CrossRef]
  26. Eggeling, L.; Bott, M. (Eds.) Handbook of Corynebacterium Glutamicum; CRC Press Taylor & Francis Group: Boca Raton, FL, USA, 2005. [Google Scholar]
  27. Tauch, A.; Kirchner, O.; Loffler, B.; Gotker, S.; Puhler, A.; Kalinowski, J. Efficient electrotransformation of Corynebacterium diphtheriae with a mini-replicon derived from the Corynebacterium glutamicum plasmid pGA1. Curr. Microbiol. 2002, 45, 362–367. [Google Scholar] [CrossRef]
  28. Peters-Wendisch, P.G.; Schiel, B.; Wendisch, V.F.; Katsoulidis, E.; Mockel, B.; Sahm, H.; Eikmanns, B.J. Pyruvate carboxylase is a major bottleneck for glutamate and lysine production by Corynebacterium glutamicum. J. Mol. Microbiol. Biotechnol. 2001, 3, 295–300. [Google Scholar]
  29. Oehler, S.; Amouyal, M.; Kolkhof, P.; von Wilcken-Bergmann, B.; Müller-Hill, B. Quality and position of the three lac operators of E. coli define efficiency of repression. EMBO J. 1994, 13, 3348–3355. [Google Scholar] [CrossRef]
  30. Hashiro, S.; Yasueda, H. Plasmid copy number mutation in repA gene encoding RepA replication initiator of cryptic plasmid pHM1519 in Corynebacterium glutamicum. Biosci. Biotechnol. Biochem. 2018, 82, 2212–2224. [Google Scholar] [CrossRef]
  31. Patek, M.; Eikmanns, B.J.; Patek, J.; Sahm, H. Promoters from Corynebacterium glutamicum: Cloning, molecular analysis and search for a consensus motif. Microbiology 1996, 142, 1297–1309. [Google Scholar] [CrossRef] [Green Version]
  32. Dostalova, H.; Holatko, J.; Busche, T.; Rucka, L.; Rapoport, A.; Halada, P.; Nesvera, J.; Kalinowski, J.; Patek, M. Assignment of sigma factors of RNA polymerase to promoters in Corynebacterium glutamicum. AMB Express 2017, 7, 133. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Taniguchi, H.; Busche, T.; Patschkowski, T.; Niehaus, K.; Patek, M.; Kalinowski, J.; Wendisch, V.F. Physiological roles of sigma factor SigD in Corynebacterium glutamicum. BMC Microbiol. 2017, 17, 158. [Google Scholar] [CrossRef] [PubMed]
  34. Busche, T.; Silar, R.; Pičmanová, M.; Pátek, M.; Kalinowski, J. Transcriptional regulation of the operon encoding stress-responsive ECF sigma factor SigH and its anti-sigma factor RshA, and control of its regulatory network in Corynebacterium glutamicum. BMC Genom. 2012, 13, 445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Patek, M.; Nesvera, J. Sigma factors and promoters in Corynebacterium glutamicum. J. Biotechnol. 2011, 154, 101–113. [Google Scholar] [CrossRef]
  36. Pátek, M.; Holátko, J.; Busche, T.; Kalinowski, J.; Nešvera, J. Corynebacterium glutamicum promoters: A practical approach. Microb. Biotechnol. 2013, 6, 103–117. [Google Scholar] [CrossRef]
  37. Yim, S.S.; An, S.J.; Kang, M.; Lee, J.; Jeong, K.J. Isolation of fully synthetic promoters for high-level gene expression in Corynebacterium glutamicum. Biotechnol. Bioeng. 2013, 110, 2959–2969. [Google Scholar] [CrossRef]
  38. Rytter, J.V.; Helmark, S.; Chen, J.; Lezyk, M.J.; Solem, C.; Jensen, P.R. Synthetic promoter libraries for Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2014, 98, 2617–2623. [Google Scholar] [CrossRef] [Green Version]
  39. Abe, S.; Takayarna, K.; Kinoshita, S. Taxonomical studies on glutamic acid producing bacteria. J. Gen. Appl. Microbiol. 1967, 13, 279–301. [Google Scholar] [CrossRef]
  40. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 1983, 166, 557–580. [Google Scholar] [CrossRef]
  41. Stansen, C.; Uy, D.; Delaunay, S.; Eggeling, L.; Goergen, J.L.; Wendisch, V.F. Characterization of a Corynebacterium glutamicum lactate utilization operon induced during temperature-triggered glutamate production. Appl. Environ. Microbiol. 2005, 71, 5920–5928. [Google Scholar] [CrossRef] [Green Version]
  42. Sgobba, E.; Stumpf, A.K.; Vortmann, M.; Jagmann, N.; Krehenbrink, M.; Dirks-Hofmeister, M.E.; Moerschbacher, B.; Philipp, B.; Wendisch, V.F. Synthetic Escherichia coli-Corynebacterium glutamicum consortia for l-lysine production from starch and sucrose. Bioresour. Technol. 2018, 260, 302–310. [Google Scholar] [CrossRef] [PubMed]
  43. Veldmann, K.H.; Dachwitz, S.; Risse, J.M.; Lee, J.H.; Sewald, N.; Wendisch, V.F. Bromination of L-tryptophan in a Fermentative Process With Corynebacterium glutamicum. Front. Bioeng. Biotechnol. 2019, 7, 219. [Google Scholar] [CrossRef] [PubMed]
  44. Gibson, D.G.; Young, L.; Chuang, R.Y.; Venter, J.C.; Hutchison, C.A., 3rd; Smith, H.O. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 2009, 6, 343–345. [Google Scholar] [CrossRef] [PubMed]
  45. Van der Rest, M.E.; Lange, C.; Molenaar, D. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biot. 1999, 52, 541–545. [Google Scholar] [CrossRef]
  46. Mindt, M.; Walter, T.; Risse, J.M.; Wendisch, V.F. Fermentative Production of N-Methylglutamate From Glycerol by Recombinant Pseudomonas putida. Front. Bioeng. Biotechnol. 2018, 6, 159. [Google Scholar] [CrossRef] [Green Version]
  47. Miwa, K.; Matsui, H.; Terabe, M.; Nakamori, S.; Sano, K.; Momose, H. Cryptic Plasmids in Glutamic Acid-producing Bacteria. Agric. Biol. Chem. 1984, 48, 2901–2903. [Google Scholar] [CrossRef]
  48. Youn, J.W.; Jolkver, E.; Kramer, R.; Marin, K.; Wendisch, V.F. Characterization of the dicarboxylate transporter DctA in Corynebacterium glutamicum. J. Bacteriol. 2009, 191, 5480–5488. [Google Scholar] [CrossRef] [Green Version]
  49. Taniguchi, H.; Wendisch, V.F. Exploring the role of sigma factor gene expression on production by Corynebacterium glutamicum: Sigma factor H and FMN as example. Front. Microbiol. 2015, 6, 740. [Google Scholar] [CrossRef] [Green Version]
  50. Binder, D.; Frohwitter, J.; Mahr, R.; Bier, C.; Grunberger, A.; Loeschcke, A.; Peters-Wendisch, P.; Kohlheyer, D.; Pietruszka, J.; Frunzke, J.; et al. Light-Controlled Cell Factories: Employing Photocaged Isopropyl-beta-d-Thiogalactopyranoside for Light-Mediated Optimization of lac Promoter-Based Gene Expression and (+)-Valencene Biosynthesis in Corynebacterium glutamicum. Appl. Environ. Microbiol. 2016, 82, 6141–6149. [Google Scholar] [CrossRef] [Green Version]
  51. Wendisch, V.F.; Spies, M.; Reinscheid, D.J.; Schnicke, S.; Sahm, H.; Eikmanns, B.J. Regulation of acetate metabolism in Corynebacterium glutamicum: Transcriptional control of the isocitrate lyase and malate synthase genes. Arch. Microbiol. 1997, 168, 262–269. [Google Scholar] [CrossRef]
  52. Cramer, A.; Gerstmeir, R.; Schaffer, S.; Bott, M.; Eikmanns, B.J. Identification of RamA, a novel LuxR-type transcriptional regulator of genes involved in acetate metabolism of Corynebacterium glutamicum. J. Bacteriol. 2006, 188, 2554–2567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Auchter, M.; Cramer, A.; Huser, A.; Ruckert, C.; Emer, D.; Schwarz, P.; Arndt, A.; Lange, C.; Kalinowski, J.; Wendisch, V.F.; et al. RamA and RamB are global transcriptional regulators in Corynebacterium glutamicum and control genes for enzymes of the central metabolism. J. Biotechnol. 2011, 154, 126–139. [Google Scholar] [CrossRef] [PubMed]
  54. Jensen, J.V.; Wendisch, V.F. Ornithine cyclodeaminase-based proline production by Corynebacterium glutamicum. Microb. Cell Fact. 2013, 12, 63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Pfeifer-Sancar, K.; Mentz, A.; Ruckert, C.; Kalinowski, J. Comprehensive analysis of the Corynebacterium glutamicum transcriptome using an improved RNAseq technique. BMC Genom. 2013, 14, 888. [Google Scholar] [CrossRef] [Green Version]
  56. Espah Borujeni, A.; Cetnar, D.; Farasat, I.; Smith, A.; Lundgren, N.; Salis, H.M. Precise quantification of translation inhibition by mRNA structures that overlap with the ribosomal footprint in N-terminal coding sequences. Nucleic Acids Res. 2017, 45, 5437–5448. [Google Scholar] [CrossRef]
  57. Salis, H.M.; Mirsky, E.A.; Voigt, C.A. Automated design of synthetic ribosome binding sites to control protein expression. Nat. Biotechnol. 2009, 27, 946–950. [Google Scholar] [CrossRef] [Green Version]
  58. Kosobokova, E.N.; Skrypnik, K.A.; Kosorukov, V.S. Overview of Fusion Tags for Recombinant Proteins. Biochemistry (Mosc) 2016, 81, 187–200. [Google Scholar] [CrossRef]
  59. Widakowich, G.; Zhang, C.; Harris, S.; Mitri, K.; Powers, G.; Troung, K.S.; Hearn, M.T. Effects of IMAC specific peptide tags on the stability of recombinant green fluorescent protein. Biotechnol. Prog. 2011, 27, 1048–1053. [Google Scholar] [CrossRef]
  60. Cooper, C.D.O.; Marsden, B.D. N- and C-Terminal Truncations to Enhance Protein Solubility and Crystallization: Predicting Protein Domain Boundaries with Bioinformatics Tools. In Heterologous Gene Expression in E.coli: Methods and Protocols; Burgess-Brown, N.A., Ed.; Springer: New York, NY, USA, 2017; pp. 11–31. [Google Scholar] [CrossRef]
  61. Speck, J.; Hecky, J.; Tam, H.K.; Arndt, K.M.; Einsle, O.; Müller, K.M. Exploring the molecular linkage of protein stability traits for enzyme optimization by iterative truncation and evolution. Biochemistry 2012, 51, 4850–4867. [Google Scholar] [CrossRef]
  62. Sinha, R.; Shukla, P. Current Trends in Protein Engineering: Updates and Progress. Curr. Protein Pept. Sci. 2019, 20, 398–407. [Google Scholar] [CrossRef]
  63. Han, S.O.; Inui, M.; Yukawa, H. Expression of Corynebacterium glutamicum glycolytic genes varies with carbon source and growth phase. Microbiology 2007, 153, 2190–2202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Wang, Y.; Liu, J.; Ni, X.; Lei, Y.; Zheng, P.; Diao, A. Screening efficient constitutive promoters in Corynebacterium glutamicum based on time-series transcriptome analysis. Sheng Wu Gong Cheng Xue Bao 2018, 34, 1760–1771. [Google Scholar] [CrossRef] [PubMed]
  65. Lee, J. Development and characterization of expression vectors for Corynebacterium glutamicum. J. Microbiol. Biotechnol. 2014, 24, 70–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Kind, S.; Jeong, W.K.; Schroder, H.; Wittmann, C. Systems-wide metabolic pathway engineering in Corynebacterium glutamicum for bio-based production of diaminopentane. Metab. Eng. 2010. [Google Scholar] [CrossRef] [PubMed]
  67. Bakkes, P.J.; Ramp, P.; Bida, A.; Dohmen-Olma, D.; Bott, M.; Freudl, R. Improved pEKEx2-derived expression vectors for tightly controlled production of recombinant proteins in Corynebacterium glutamicum. Plasmid 2020, 112, 102540. [Google Scholar] [CrossRef]
  68. Mindt, M.; Risse, J.M.; Gruß, H.; Sewald, N.; Eikmanns, B.J.; Wendisch, V.F. One-step process for production of N-methylated amino acids from sugars and methylamine using recombinant Corynebacterium glutamicum as biocatalyst. Sci. Rep. 2018, 8, 12895. [Google Scholar] [CrossRef]
Microorganisms 09 00204 g001 550
Figure 1. Fluorescence reporter assay of a promoter library in the pECXT99A plasmid background in C. glutamicum WT. Median GfpUV fluorescence intensities were normalized to an autofluorescent control. Mean values and standard deviations of biological triplicates are shown. Measurements were performed 18 h after inoculation in CGXII medium with 4% glucose. Endogenous promoters: Ppgk, PilvC, PsodA, PgapA, and Ptuf. Synthetic promoters: PH36, P45, and Psyn. Reference: the IPTG-inducible promoter Ptrc induced with 1 mM IPTG.
Figure 1. Fluorescence reporter assay of a promoter library in the pECXT99A plasmid background in C. glutamicum WT. Median GfpUV fluorescence intensities were normalized to an autofluorescent control. Mean values and standard deviations of biological triplicates are shown. Measurements were performed 18 h after inoculation in CGXII medium with 4% glucose. Endogenous promoters: Ppgk, PilvC, PsodA, PgapA, and Ptuf. Synthetic promoters: PH36, P45, and Psyn. Reference: the IPTG-inducible promoter Ptrc induced with 1 mM IPTG.
Microorganisms 09 00204 g001
Microorganisms 09 00204 g002 550
Figure 2. Fluorescence reporter assay of conventional and newly constructed IPTG-inducible expression vectors in C. glutamicum WT. Vector pECXT99A-gfpUV expressed gfpUV from Ptrc, while Ptac was used for vectors pEKEx3-gfpUV, pVWEx1-gfpUV, pVWEx4-gfpUV, and pVWEx6-gfpUV. Median GfpUV fluorescence intensities were normalized to an autofluorescent control. Mean values and standard deviations of biological triplicates are shown. Measurements were performed 20 h after inoculation in CGXII medium with 4% glucose. Newly constructed vectors: pVWEx4 and pVWEx6. Reference vectors: pEKEx3, pECXT99A, and pVWEx1. Concentration of the inductor IPTG is given in mM.
Figure 2. Fluorescence reporter assay of conventional and newly constructed IPTG-inducible expression vectors in C. glutamicum WT. Vector pECXT99A-gfpUV expressed gfpUV from Ptrc, while Ptac was used for vectors pEKEx3-gfpUV, pVWEx1-gfpUV, pVWEx4-gfpUV, and pVWEx6-gfpUV. Median GfpUV fluorescence intensities were normalized to an autofluorescent control. Mean values and standard deviations of biological triplicates are shown. Measurements were performed 20 h after inoculation in CGXII medium with 4% glucose. Newly constructed vectors: pVWEx4 and pVWEx6. Reference vectors: pEKEx3, pECXT99A, and pVWEx1. Concentration of the inductor IPTG is given in mM.
Microorganisms 09 00204 g002
Microorganisms 09 00204 g003 550
Figure 3. SDS-PAGE for comparison of GfpUV (27 kDa) protein abundance based on different expression vectors in C. glutamicum WT. 10 µg of crude extracts from the main cultivation in CGXII with 4% glucose was loaded on a 10% SDS-PAGE. Pre-stained protein ladder (26616 from Thermo Scientific) was used as reference standard. Concentration of the inductor IPTG is given in mM.
Figure 3. SDS-PAGE for comparison of GfpUV (27 kDa) protein abundance based on different expression vectors in C. glutamicum WT. 10 µg of crude extracts from the main cultivation in CGXII with 4% glucose was loaded on a 10% SDS-PAGE. Pre-stained protein ladder (26616 from Thermo Scientific) was used as reference standard. Concentration of the inductor IPTG is given in mM.
Microorganisms 09 00204 g003
Microorganisms 09 00204 g004 550
Figure 4. Schematic representation of sarcosine production by recombinant C. glutamicum (A), Xylose isomerase (XylA) activities in crude extracts measured in triplicates (B), and sarcosine titers produced by C. glutamicum strains SAR3 and SAR3* measured 20 h after inoculation from triplicates (C). XylA: xylose isomerase; XylB: xylulose kinase; PPP: pentose phosphate pathway; GAP: glyceraldehyde 3-phosphate; AceB: malate synthase; AceA: isocitrate lyase; DpkA: imine reductase; Icd: isocitrate dehydrogenase; MMA: monomethylamine.
Figure 4. Schematic representation of sarcosine production by recombinant C. glutamicum (A), Xylose isomerase (XylA) activities in crude extracts measured in triplicates (B), and sarcosine titers produced by C. glutamicum strains SAR3 and SAR3* measured 20 h after inoculation from triplicates (C). XylA: xylose isomerase; XylB: xylulose kinase; PPP: pentose phosphate pathway; GAP: glyceraldehyde 3-phosphate; AceB: malate synthase; AceA: isocitrate lyase; DpkA: imine reductase; Icd: isocitrate dehydrogenase; MMA: monomethylamine.
Microorganisms 09 00204 g004
Table
Table 1. Strains and plasmids used in this study.
Table 1. Strains and plasmids used in this study.
StrainCharacteristics of strains and plasmidsReference
C. glutamicum strains
WTWild type, ATCC 13032[39]
SAR3WT ΔaceB icdGTG (pVWEx1-dpkA_RBSopt) (pECXT99A-xylAB)[11]
SAR3*WT ΔaceB icdGTG (pVWEx1-dpkA_RBSopt) (pECXT-Psyn-xylAB)This work
Other strains
E. coli DH5αF-thi-1 endA1 hsdr17(r-, m-) supE44 ΔlacU169 (Φ80lacZΔM15) recA1 gyrA96[40]
Plasmids
pEKEx3SpecR, PtrclacIq, pBL1 oriVCg, C. glutamicum/E. coli expression shuttle vector[41]
pEKEx3-gfpUVpEKEx3 derivative for inducible expression of gfpUV from Ptac promoter[42]
pECXT99A (pECXT)TetR, PtrclacIq, pGA1 oriVCg, C. glutamicum/E. coli expression shuttle vector[2]
pECXT99A-gfpUVpECXT99A derivative for inducible expression of gfpUV from Ptrc promoterThis work
pECXT99A-xylABpECXT99A derivative for inducible expression of xylA from Xanthomonas campestris and xylB from C. glutamicum from Ptrc promoter[43]
pECXT-PpgkpECXT99A derivative for constitutive expression from C. glutamicum pgk promoterThis work
pECXT-PilvCpECXT99A derivative for constitutive expression from C. glutamicum ilvC promoterThis work
pECXT-PsodApECXT99A derivative for constitutive expression from C. glutamicum sodA promoterThis work
pECXT-PgapApECXT99A derivative for constitutive expression from C. glutamicum gapA promoterThis work
pECXT-PtufpECXT99A derivative for constitutive expression from C. glutamicum tuf promoterThis work
pECXT-PH36pECXT99A derivative for constitutive expression from synthetic PH36 promoterThis work
pECXT-P45pECXT99A derivative for constitutive expression from synthetic P45 promoterThis work
pECXT-PsynpECXT99A derivative for constitutive expression from synthetic Psyn promoterThis work
pECXT-Ppgk-gfpUVpECXT99A derivative for constitutive expression of gfpUV from C. glutamicum pgk promoterThis work
pECXT-PilvC-gfpUVpECXT99A derivative for constitutive expression of gfpUV from C. glutamicum ilvC promoterThis work
pECXT-PsodA-gfpUVpECXT99A derivative for constitutive expression of gfpUV from C. glutamicum sodA promoterThis work
pECXT-PgapA-gfpUVpECXT99A derivative for constitutive expression of gfpUV from C. glutamicum gapA promoterThis work
pECXT-Ptuf-gfpUVpECXT99A derivative for constitutive expression of gfpUV from C. glutamicum tuf promoterThis work
pECXT-PH36-gfpUVpECXT99A derivative for constitutive expression of gfpUV from synthetic PH36 promoterThis work
pECXT-P45-gfpUVpECXT99A derivative for constitutive expression of gfpUV from synthetic P45 promoterThis work
pECXT-Psyn-gfpUVpECXT99A derivative for constitutive expression of gfpUV from synthetic Psyn promoterThis work
pECXT-Psyn-xylABpECXT99A derivative for constitutive expression of xylA from Xanthomonas campestris and xylB from C. glutamicum from synthetic Psyn promoterThis work
pVWEx1KmR, PtaclacIq, pHM1519 oriVCg, C. glutamicum/E. coli expression shuttle vector[28]
pVWEx4pVWEx1 derivative with mutation repAThis work
pVWEx6pVWEx4 derivative with Psyn promoter and lac operator for IPTG inducible expressionThis work
pVWEx1-gfpUVpVWEx1 derivative for IPTG-inducible expression of gfpUV from Ptac promoter[42]
pVWEx1-dpkA_RBSoptpVWEx1 derivative for IPTG-inducible expression of dpkA from P. putida KT2440 and change of its start codon GTG to ATG and an RBS optimised for C. glutamicum[11]
pVWEx4-gfpUVpVWEx4 derivative for IPTG-inducible expression of gfpUV from Ptac promoterThis work
pVWEx6-gfpUVpVWEx6 derivative for IPTG-inducible expression of gfpUV from Psyn promoterThis work
Table
Table 2. Oligonucleotides used in this study.
Table 2. Oligonucleotides used in this study.
OligonucleotideTargetSequence (5′ → 3′)
HN12Ptuf-fwCTGTGCGGTATTTCACACCGCAGTTTTAGCGTGTCAGTAGGC
HN13Ptuf-rvCCGGGTACCGAGCTCGAATTCCATGTTACTGAATCCTAAGGGCAACG
HN14PgapA-fwCTGTGCGGTATTTCACACCGCAGTGTCTGTATGATTTTGCATCTG
HN15PgapA-rvCCGGGTACCGAGCTCGAATTCCATGCACGCACCAAACCTACTCACA
HN16PilvC-fwCTGTGCGGTATTTCACACCGCAATCCGGACAGATTGCACTCAAC
HN17PilvC-rvCCGGGTACCGAGCTCGAATTCCATGCATTATTGTTCTACCACACACATG
HN30PsodA-fwCTGTGCGGTATTTCACACCGCATACTTAGCTGCCAATTATTCCG
HN31PsodA-rvCCGGGTACCGAGCTCGAATTCCATGCCGCACCGAGCATATACATCT
HN97Ppgk-fwCTGTGCGGTATTTCACACCGCATAACGTGGGCGATCGATGC
HN98Ppgk-rvCCGGGTACCGAGCTCGAATTCCATGGCCGTACTCCTTGGAGATTTG
HA02P45-fwCTGTGCGGTATTTCACACCGCATTGGTCAGGGATTTTTTCCCG
HA03P45-rvCCGGGTACCGAGCTCGAATTCCATGGAACTTCTTCGTCACTTACTTTA
HA04PH36-fwCTGTGCGGTATTTCACACCGCACAAAAGCTGGGTACCTCTATCTG
HA05PH36-rvCCGGGTACCGAGCTCGAATTCCATGCATGCTACTCCTACCAACCAAG
HA06Psyn-fwGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATTGACATTAATTTGAATCTGTGTTAT
HA07Psyn-rvCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCCATGGAACCATTATAACACAGATTCAAA
HA36repA-fwAAAATCGCTTGACCATTGCAGGTTG
HA37repA-rvCTTTAGCTTTCCTAGCTTGTCGTTGAC
HA40repA-seqTGCTCGTCAGACAGAGACGCAG
N101pVWEx4-fwATGCATGCCGCTTCGCCTTCGATTGACATTAATTTGAATCTGTGTTATAATGGTTC
N102pVWEx4-rvCGGCCAGTGAATTCGAGCTCGAAATTGTTATCCGCTCACAATTCCAGGAACCATTATAACACAGATTCAA
N103xylAB-fwATGGAATTCGAGCTCGGTACCCGGGGAAAGGAGGCCCTTCAGATGAGCAACACCGTTTTCATC
N104xylAB-rvCTGCAGGTCGACTCTAGAGGATCTTAGTACCAACCCTGCGTTGC
N105Psyn-fw2ATGCATGCCGCTTCGCCTTCGTTGACATTAATTTGAATCTGTGTTATAATGGTTC
N106Psyn-rv2GGCCAGTGAATTCGAGCTCGCTGCAGGTCGACTCTAGAGGATC
HN49gfpUV-fwATGGAATTCGAGCTCGGTACCCGGGGAAAGGAGGCCCTTCAGATGAGTAAAGGAGAAGAACTTTTCA
HN50gfpUV-rvGCATGCCTGCAGGTCGACTCTAGAGGATCTTATTTGTAGAGCTCATCCATGC
582 ATCTTCTCTCATCCTCCA
Table
Table 3. Comparison of C. glutamicum expression vectors. *: high-copy number variant of the pHM1519 replicon.
Table 3. Comparison of C. glutamicum expression vectors. *: high-copy number variant of the pHM1519 replicon.
PlasmidpEKEx3pVWEx1pVWEx4pVWEx6pECXT99ApECXT_Psyn
ExpressionInducibleInducibleInducibleInducibleInducibleConstitutive
Repressor genelacIqlacIqlacIqlacIqlacIq-
PromoterPtacPtacPtacPsynPtrcPsyn
Induction factor6761215140non
Maximal expression649914541047140
Origin for CgpBL1pHM1519pHM1519 *pHM1519 *pGA1 minipGA1 mini
Origin for EcColE1 oriColE1 oriColE1 oriColE1 oripMB1pMB1
ResistanceSpecKanKanKanTetTet
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Henke, N.A.; Krahn, I.; Wendisch, V.F. Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum. Microorganisms 2021, 9, 204. https://doi.org/10.3390/microorganisms9010204

AMA Style

Henke NA, Krahn I, Wendisch VF. Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum. Microorganisms. 2021; 9(1):204. https://doi.org/10.3390/microorganisms9010204

Chicago/Turabian Style

Henke, Nadja A., Irene Krahn, and Volker F. Wendisch. 2021. "Improved Plasmid-Based Inducible and Constitutive Gene Expression in Corynebacterium glutamicum" Microorganisms 9, no. 1: 204. https://doi.org/10.3390/microorganisms9010204

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop