Next Article in Journal
Catabolic Reductive Dehalogenase Substrate Complex Structures Underpin Rational Repurposing of Substrate Scope
Next Article in Special Issue
Genetic Relatedness and Diversity of Staphylococcus aureus from Different Reservoirs: Humans and Animals of Livestock, Poultry, Zoo, and Aquaculture
Previous Article in Journal
Innate Lymphoid Cells: Important Regulators of Host–Bacteria Interaction for Border Defense
Previous Article in Special Issue
Frequency and Characterization of Antimicrobial Resistance and Virulence Genes of Coagulase-Negative Staphylococci from Wild Birds in Spain. Detection of tst-Carrying S. sciuri Isolates
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture

1
National Reference Laboratory of Antibiotic Resistances and Healthcare Associated Infections (NRL-AMR-HAI), Department of Infectious Diseases, National Institute of Health Dr. Ricardo Jorge, 1649-016 Lisbon, Portugal
2
Centre for the Studies of Animal Science, Institute of Agrarian and Agri-Food Sciences and Technologies, Oporto University, 4051-401 Oporto, Portugal
3
Department of Sea and Marine Resources, Portuguese Institute for the Sea and Atmosphere (IPMA, IP), 1749-077 Lisbon, Portugal
*
Author to whom correspondence should be addressed.
Microorganisms 2020, 8(9), 1343; https://doi.org/10.3390/microorganisms8091343
Submission received: 3 August 2020 / Revised: 27 August 2020 / Accepted: 28 August 2020 / Published: 2 September 2020

Abstract

In a world where the population continues to increase and the volume of fishing catches stagnates or even falls, the aquaculture sector has great growth potential. This study aimed to contribute to the depth of knowledge of the diversity of bacterial species found in Sparus aurata collected from a fish farm and to understand which profiles of diminished susceptibility to antibiotics would be found in these bacteria that might be disseminated in the environment. One hundred thirty-six bacterial strains were recovered from the S. aurata samples. These strains belonged to Bacillaceae, Bacillales Family XII. Incertae Sedis, Comamonadaceae, Enterobacteriaceae, Enterococcaceae, Erwiniaceae, Micrococcaceae, Pseudomonadaceae and Staphylococcaceae families. Enterobacter sp. was more frequently found in gills, intestine and skin groups than in muscle groups (p ≤ 0.01). Antibiotic susceptibility tests found that non-susceptibility to phenicols was significantly higher in gills, intestine and skin samples (45%) than in muscle samples (24%) (p ≤ 0.01) and was the most frequently found non-susceptibility in both groups of samples. The group of Enterobacteriaceae from muscles presented less decreased susceptibility to florfenicol (44%) than in the group of gills, intestine and skin samples (76%). We found decreased susceptibilities to β-lactams and glycopeptides in the Bacillaceae family, to quinolones and mupirocin in the Staphylococcaceae family, and mostly to β-lactams, phenicols and quinolones in the Enterobacteriaceae and Pseudomonadaceae families. Seven Enterobacter spp. and five Pseudomonas spp. strains showed non-susceptibility to ertapenem and meropenem, respectively, which is of concern because they are antibiotics used as a last resort in serious clinical infections. To our knowledge, this is the first description of species Exiguobacterium acetylicum, Klebsiella michiganensis, Lelliottia sp. and Pantoea vagans associated with S. aurata (excluding cases where these bacteria are used as probiotics) and of plasmid-mediated quinolone resistance qnrB19-producing Leclercia adecarboxylata strain. The non-synonymous G385T and C402A mutations at parC gene (within quinolone resistance-determining regions) were also identified in a Klebsiella pneumoniae, revealing decreased susceptibility to ciprofloxacin. In this study, we found not only bacteria from the natural microbiota of fish but also pathogenic bacteria associated with fish and humans. Several antibiotics for which decreased susceptibility was found here are integrated into the World Health Organization list of “critically important antimicrobials” and “highly important antimicrobials” for human medicine.

1. Introduction

In the last 30 years, global production of the aquaculture sector has increased and today represents nearly half of the fish consumed worldwide, with China as the main producer. This was a consequence of higher demand due to the reduction or stagnation of fishing catches and an increasing world population [1].
Portugal is the third major consumer of fish, in Europe [2]. Although aquaculture represents a small portion of this consumption, this sector has grown in the last decades and is expected to increase in the coming years. This is a country with favorable conditions for aquaculture, where the main production is of bivalve mollusks, and extensive and intensive systems are predominant. Tanks for fish production represent about 5% of all Portuguese aquaculture infrastructures (in 2012), and turbot (Scophthalmus maximus), European seabass (Dicentrarchus labrax) and gilthead seabream (Sparus aurata) are main species produced [3]. S. aurata is a species belonging to the Sparidae family and Perciformes order [4] and is often found in shallow waters and is sensitive to water temperature. The gilthead seabream has great commercial importance in Europe, representing one of the main species cultivated in this continent [5].
However, despite all the advantages, aquaculture production can have a negative impact, specifically in degradation of natural resources and rising of antibiotic use [1,6]. A higher density of fish in a specific area is usually related to an increase in stress conditions, leading to a predisposition for infectious diseases and a higher antibiotic consumption. Therefore, these environments can function as a reservoir of antibiotic resistance and/or antibiotic-resistant genes. In Europe, antibiotics for growth promotion are not authorized, and only eight antibiotics are allowed for prophylaxis and therapeutics: ampicillin, oxytetracycline, florfenicol, flumequine, oxolinic acid, sarafloxacin, erythromycin and sulphonamides associated with trimethoprim or ormetoprim. These antibiotics are mostly administered by oral-medicated feed or bath, which are the easiest methods to apply but expose both sick and healthy individuals to antibiotics and allow the accumulation of these substances in sediments and water. This contributes to selective pressure in bacteria from these environments [7,8].
In this contexts, this study aimed to contribute to a deeper knowledge of the diversity of bacterial species found in S. aurata from aquaculture and the respective antibiotic susceptibilities that can be disseminated in their environment. The correlation of antibiotic resistance with the World Health Organization (WHO) list of “critically important antimicrobials” and “highly important antimicrobials” for human medicine will also be established.

2. Materials and Methods

2.1. Sample Collection and Preparation

Five commercial-size S. aurata (500–1500 g) were collected in March 2018 in a land tank from a fish farming pilot station in the south of Portugal by the Portuguese Institute of Sea and Atmosphere. This station is located in the Ria Formosa Natural Park and is an integrated multi-trophic aquaculture with a semi-intensive system. The weight, furcal length, total length, and condition index of the 5-gilthead seabream were measured (Table 1). Each fish was divided into 4 samples (gills, intestine, muscle, and skin), that were frozen and transported on ice to the National Institute of Health Dr. Ricardo Jorge, where they were analyzed. This study includes the results of the testing for 5 samples of muscle (from fish 1, 2, 3, 4 and 5) and the gills, intestine and skin samples from fish 1 that were treated separately (excepting for some results presentation) (Figure S1).

2.2. Bacterial Isolation and Identification

Ten grams of each sample was homogenized in peptone water (Stomacher 80 Biomaster®, Seward, UK), incubated for 12 to 18 h at 37 °C and further diluted [10,11]. Each dilution was plated in selective media (MacConkey agar, Mannitol salt agar and UriSelect™4 chromogenic agar) and incubated for 18 to 20 h at 37 °C. Colonies with different morphology (to avoid duplications) were selected and DNA extracted, according to manufacturer’s instructions (MagNA Pure 96 Instrument, Roche, Manheim, Germany). Strains were identified by VITEK2 and amplification of the 16S rRNA gene, as already described [12].

2.3. Antibiotic Susceptibility Testing

Antibiotic susceptibility testing was performed by disk diffusion (Bio-Rad, Marnes-la-Coquette, France) and minimum inhibitory concentration (MIC) by in-house broth microdilution and E-test® (bioMérieux, Marcy l’Etoile, France). Different bacterial families were tested for different antibiotics (Table 2).
For Enterobacteriaceae and Erwiniaceae, the antibiotics tested were amoxicillin/clavulanic acid, aztreonam, cefepime, cefotaxime, cefoxitin, ceftazidime, ertapenem, imipenem, meropenem, piperacillin/tazobactam, ciprofloxacin, trimethoprim/sulfamethoxazole, gentamicin, chloramphenicol, florfenicol, flumequine and oxytetracycline. For Pseudomonadaceae, the antibiotics tested were aztreonam, cefepime, ceftazidime, doripenem, ertapenem, imipenem, meropenem, piperacillin/tazobactam, ciprofloxacin, levofloxacin, amikacin, gentamicin, netilmicin, tobramycin, chloramphenicol, florfenicol, flumequine and oxytetracycline. On the other hand, for Staphylococcaceae, the antibiotics tested were cefoxitin, ciprofloxacin, levofloxacin, moxifloxacin, rifampicin, mupirocin, fusidic acid, daptomycin, linezolid, teicoplanin and vancomycin. For Enterococcaceae, the antibiotics tested were ampicillin, high concentration (HC) gentamicin, HC streptomycin, linezolid, teicoplanin and vancomycin. For Bacillaceae, the antibiotic tested was vancomycin.
For Gram-negative bacteria, the antibiogram was completed with (1) disc combination test (DCT or combined disk test, CDT) [13], which is based on the comparison between zone diameters of one disc of antibiotic alone and another with an inhibitor, here using cefotaxime (30 µg) and cefotaxime/clavulanic acid (30 µg + 10 µg) to search for the presence of extended-spectrum β-lactamase (ESBL-positive if there is a difference of ≥ 5 mm); (2) DCT to compare zone diameters of meropenem and meropenem/dipicolinic acid (1000 µg), to search for the presence of Metallo-β-lactamase (MBL-positive if ≥ 5 mm) [14]; (3) DCT with amoxicillin and amoxicillin/clavulanic acid plus cloxacillin (500 µg), to search for the presence of AmpC (positive for cephalosporinases if ≥ 5 mm) [13]; (4) double disc synergy test (DDST) with two discs containing predefined amounts of the β-lactam and the inhibitor, placed close to each other, here using boronic acid (300 µg) and carbapenems to search for any class A carbapenemase (positive if a synergy is observed between carbapenemes discs) [14]; (5) DDST to search for MBL when a synergy is observed between dipicolinic acid and carbapenemes [14]; (6) DDST to detect AmpC when a synergy is observed between boronic acid and third-generation cephalosporins and/or cloxacillin and cefoxitin/ceftazidime [13]; (7) temocillin disc to indicate the presence of an OXA-48 carbapenemase; and (8) faropenem disc to indicate the presence of carbapenemases, confirming the results from (4), (5) and (7) tests.
MIC50 and MIC90 were calculated for Enterobacteriaceae since it was the most represented family, as reported elsewhere [15]. MIC50 represents the MIC value that inhibits 50% of the strains tested (and is equivalent to the median MIC value), whereas MIC90 represents the MIC value that inhibits 90% of the strains tested. Escherichia coli strain ATCC 25922 was used as quality control for Gram-negative bacteria, whereas Staphylococcus aureus strain ATCC 25923 and Enterococcus faecalis ATCC 29212 were used for Gram-positive bacteria.

2.4. Statistical Analyses

Statistical analyses of the results were performed to detect positive or negative associations between fish samples (muscle vs. gills, intestine and skin) and each bacterial family/species and non-susceptibility to different antibiotic’s class (only factors identified as statistically significant are shown). Fisher exact test was used to assess differences in bacterial families/species/non-susceptibility to different antibiotic’s class between fish samples, and one-tailed p-values of ≤ 0.05 were considered to be statistically significant. Associations were established by calculation of odds ratios with 95% confidence intervals. The null hypothesis was rejected for p-values of ≤ 0.05. All statistical analyses were calculated using OpenEpi software, v. 3.01 [16].

2.5. Detection of Antibiotic Resistance Genes

The interpretation of the antibiotic susceptibility testing results guided the research of resistance genes by PCR (Polymerase Chain Reaction), and all the positive results were sequenced, as described elsewhere [12].
The genes blaCTX-M, blaTEM, blaSHV and blaOXA-1-type were investigated for Gram-negative strains that showed decreased susceptibility to β-lactams and/or demonstrated a positive result for the DCT and DDST [17,18]. The presence of genes blaOXA-48, blaVIM, blaIMP-1-type, blaNDM, blaKPC, blaGES and blaSME was studied for Gram-negative bacteria with decreased susceptibility to carbapenems and/or that demonstrated a positive result for the DCT and DDST, using primers described in this study for the first time (Table 3), and others previously described [19,20,21,22,23]. All Gram-negative strains with decreased susceptibility to quinolones were tested for qnrA, qnrB, qnrC, qnrD, qnrS, aac(6’)-Ib and qepA genes (Table 3) [24,25,26,27,28]. For one Klebsiella pneumoniae strain with decreased susceptibility to ciprofloxacin, which tested negative for the genes described previously, we searched for mutations in the gyrA, gyrB, parC and parE genes (Table 3) [29,30,31]. All Gram-negative bacteria with decreased susceptibility to quinolones but negative results for qnr, aac(6’)-Ib and qepA genes were investigated for the presence of oqxAB genes, with primers and PCR reactions conditions described elsewhere [12]. All Gram-negative strains were investigated for the presence of mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 genes as previously described [32].
Apart from the antibiotic susceptibility testing results, all Staphylococcus spp. were tested for the presence of mecA, mecC, vanA, vanB and vanD genes (Table 3) [33]. On the other hand, all Enterococcus spp. and three Bacillus spp. resistant to vancomycin were investigated for the presence of vanA, vanB and vanD genes. The cycling conditions for the PCR multiplex for detection of vanA, vanB and vanD genes were as follows: 1 cycle of denaturation at 94 °C for 10 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 1 min and elongation at 72 °C for 1 min, and a final cycle of elongation at 72 °C for 10 min.

3. Results

3.1. Bacterial Diversity in S. aurata Samples

One hundred thirty-six bacterial strains were recovered from the total of S. aurata samples. Eighty-eight were Gram-negative bacteria, and 48 were Gram-positive bacteria. The results of VITEK2 and amplification of the 16S rRNA gene revealed that the majority of strains belonged to the Enterobacteriaceae family (55% in muscle samples and 60% in gills, intestine and skin samples), followed by Staphylococcaceae in muscle samples (16%) and Bacillaceae in gills, intestine and skin samples (17%) (Table 4). Bacillales Family XII. Incertae Sedis, Comamonadaceae and Micrococcaceae families were only found in muscle samples, whereas Erwiniaceae family was only found in gills samples. Nevertheless, these results do not represent statistically significant differences.
Within the most represented family, Enterobacteriaceae, we observed the following species of bacteria: Enterobacter cloacae, Enterobacter hormaechei, Enterobacter sp., Klebsiella michiganensis, K. pneumoniae, Leclercia adecarboxylata, Lelliottia sp. (in both groups of samples), Citrobacter freundii, Citrobacter freundii complex (only in muscle samples) and E. coli (only in gills sample). Staphylococcaceae family included S. aureus, Staphylococcus haemolyticus, Staphylococcus pasteuri (in both groups of samples), Staphylococcus capitis, Staphylococcus epidermidis, Staphylococcus petrasii, Staphylococcus saprophyticus and Staphylococcus sp. (only in muscle samples). Bacillaceae included Bacillus cereus, Bacillus sp. (in both groups of samples), Bacillus pumilus, Bacillus thuringiensis (only in muscle samples), Bacillus amyloliquefaciens and Bacillus subtilis species (only in gills, intestine and skin group of samples). Pseudomonadaceae included Pseudomonas stutzeri (in both groups of samples) and Pseudomonas putida (only in muscle samples). Enterococcaceae included Enterococcus hirae (in both groups of samples) and Enterococcus faecalis (only in gills sample). Bacillales Family XII. Incertae Sedis included Exiguobacterium acetylicum species. Comamonadaceae included Comamonas aquatica species. Micrococcaceae included Kocuria rhizophila species. Finally, Erwiniaceae family included Pantoea vagans species. Despite appearing in both groups of samples, Enterobacter sp. are more frequently found in gills, intestine and skin group than in muscle group (p ≤ 0.01; Table 5, Table S1). Statistically significant associations were not found for the other species analysed.

3.2. Phenotypic Characterization of the Bacterial Strains

In this study, non-susceptibility to phenicols was the most frequently found in both groups of samples, being significantly higher in gills, intestine and skin samples (45%; Table 6) than in muscle samples (24%) (p ≤ 0.01; Table 5). Non-susceptibility to β-lactams is the second most prevalent in both groups of samples (13% in muscles and 10% in gills, intestine and skin samples; Table 6). Decreased susceptibility to quinolones was also found in this study (7% in muscle and 5% in gills, intestine and skin samples). On the other hand, decreased susceptibility to glycopeptides and to mupirocin was only found in muscle samples.
Among Enterobacteriaceae strains, no differences were observed in MIC50 and MIC90 between the two groups of samples for the four antibiotics tested (Table 7). For each antibiotic, slight differences were registered between MIC50 and MIC90 (just 1-fold dilution). When comparing the decreased susceptibilities between the two groups of samples (muscle vs. gills, intestine and skin), major difference were found only in florfenicol, with the group of Enterobacteriaceae from muscles presenting 44% of nonsusceptible strains, while in the group of gills, intestine and skin samples, the values were higher, with 76% (Table 7).
In Table 8 is registered the decreased susceptibility profile for the 61 strains that had a non-susceptibility result for at least one antibiotic (including intrinsic non-susceptibilities). In Gram-positive bacteria, we found decreased susceptibilities to β-lactams and glycopeptides in the Bacillaceae family and to quinolones and mupirocin in the Staphylococcaceae family. In Gram-negative bacteria, Enterobacteriaceae family showed several decreased susceptibility profiles, with non-susceptibilities to β-lactams, phenicols and quinolones; the same non-susceptibilities to these antibiotic classes were found in strains from the Pseudomonadaceae family. The non-susceptibility to ertapenem of seven Enterobacter spp. strains and to the antipseudomonal carbapenem (meropenem) of five Pseudomonas spp. was found.

3.3. Genotypic Characterization

The search for resistance genes by PCR revealed a qnrB19 gene in a L. adecarboxylata strain, with decreased susceptibility to ciprofloxacin (zone diameter = 24 mm). The analyses of the mutations present in gyrA, gyrB, parC and parE genes of a K. pneumoniae strain with decreased susceptibility to ciprofloxacin (zone diameter = 25 mm) showed the presence of non-synonymous mutations G385T (Ala129Ser in protein) and C402A (Ser134Arg in protein) in parC gene. No other resistance genes were identified in the studied bacteria among all the searched genes.

4. Discussion

The aquaculture sector has experienced a strong growth in recent decades and with it the number of studies to answer some concerns about the quality and safety of its products. Some studies have focused on the search of antibiotic residues in waters and/or sediments from fish farms, while others have focused on the search for specific pathogens, such as E. coli, not only in water and/or sediments but also in fish and shellfish [34,35,36,37,38,39]. This study aims to provide data, not only on the bacterial diversity in S. aurata from aquaculture, but also on antibiotic resistant genes that circulate in these environments. This information is crucial in the construction of science-based policies for the suitable use of antibiotics in aquaculture.
In this study, we found a very diverse bacterial population with 31 species that belonged to nine different families. Microbiota present in fish depends not only on the fish genetics and diet but is also determined by microbiota present in their environment, such as water and sediments. Microbiome composition is normally different between individual fish belonging to the same species but also varies between healthy and sick individuals, wherein the healthy individuals seem to have a higher diversity of bacterial population [40]. The condition index of fish belonging to this study varied between 1.56 and 2.04 (Table 1), meaning that these S. aurata were healthy (values higher than 1), possibly explaining the diversity found.
Of the species found in this study, only Pseudomonas spp. and K. rhizophila appeared to frequently cause diseases in fish, K. rhizophila being an emerging pathogen [41,42]. Pseudomonas spp. are ubiquitous in nature, and P. fluorescens is the most important species in fish infections (not found in this study), although P. putida had already been found in internal organs of fish and P. stutzeri in sediments of marine waters [43]. This genus is responsible for strawberry disease and septicaemia in some fish species [42]. P. putida and P. stutzeri are also opportunistic pathogens in humans and were already associated with bacteraemia, endocarditis, keratitis, meningitis, pneumonia, skin and soft tissue infections and urinary tract infections [44,45,46,47,48]. Kocuria spp. are Gram-positive and coccoid bacteria isolated from numerous environments: skin of mammals, marine sediments, soil and food [49,50,51,52,53]. Specifically, K. rhizophila causes a variety of lesions in fish and is responsible for a 50% mortality rate: exophthalmia, skin petechiae, increased skin melanization, liver congestion, inflammation of the intestine and hemorrhages [42]. Reports revealed that this species was already responsible for some infections in humans, mainly catheter-related bacteremia [54].
Other bacterial species from this study are known to be opportunistic pathogens in fish, some already described in S. aurata: C. freundii complex, Staphylococcus spp., K. pneumoniae, E. faecalis and E. cloacae [55,56,57,58,59]. All these species have pathogenic significance for humans, causing foodborne diseases, meningitides, wound and urinary tract infections, bacteremia, bone and joint infections, endocarditis, among others [59,60,61,62,63].
Bacillus spp., E. coli and E. hormaechei were already collected from fish, although they were not associated with fish diseases [64,65,66]. These three species are responsible for human diseases like food poisoning (especially, B. cereus and E. coli), bacteremia, meningitis, brain abscesses, endophthalmitis, pneumonia and sepsis [67,68,69].
There is a single report about the association of L. adecarboxylata with fish, more specifically in the oral cavity of sharks [70]. However, this species is frequently found in water environments. It can cause endocarditis, bacteremia and peritonitis in human hosts [71,72]. Some studies indicate that E. hirae could be a part of the natural microbiota of fish. There is no literature involving this bacterium in fish infections, but this species was well characterized in human infections, such as endocarditis, pyelonephritis, acute pancreatitis and septic shock, representing 1 to 3% of infections caused by Enterococcus spp. in clinical practice [73].
To our knowledge, this study seems to represent the first description of the species E. acetylicum, K. michiganensis, Lelliottia sp. and P. vagans associated with S. aurata (excluding cases where these bacteria are used as probiotics). These are environmental species, frequently found in soil, water, air, plants and insects [74,75,76,77,78,79,80]. Some of these species have been associated with infections in humans, namely immunocompromised individuals, but rarely [81,82,83,84,85,86].
Together with E. coli, E. faecalis is also an indicator of fecal contamination [87,88]. Species like Bacillus spp., E. acetylicum and Enterococcus spp. can be used as probiotics in aquaculture to reduce antibiotic consumption and avoid the spread of antibiotic resistance genes [66,89,90]. We could not obtain information if this was the case of this fish farming pilot station, in Portugal, possibly justifying the presence of these bacteria in our samples.
β-Lactam antibiotics are used in aquaculture in many countries, especially amoxicillin [7]. Several studies revealed a high prevalence of non-susceptibility to this class of antibiotic in fish, shrimps and water samples from aquaculture farms. These studies reported the discovery of blaSHV and blaTEM genes, associated with β-lactam non-susceptibility [91,92,93,94]. In our study, β-lactam resistance genes were not detected. The non-susceptibilities found here were probably related to genes or other resistance mechanisms not studied (e.g., efflux pumps). Likewise, some of the non-susceptibilities found to β-lactams are intrinsic, such as the resistance to ERT in Pseudomonas spp. [95]. Non-susceptibility to AMC, FOX, AZT, FEP, CTX, CAZ and PTZ in Enterobacter spp., E. coli and Citrobacter spp. could be explained by chromosomal AmpC β-lactamase or AmpC hyperproduction [96]. Worryingly, our study revealed decreased susceptibilities to carbapenems of Enterobacter spp. (ertapenem), usually associated with acquired resistance, as well as in Pseudomonas spp. (meropenem), which are not used in aquaculture and are considered last-resort antibiotics to treat serious infections caused by multidrug-resistant bacteria in humans [97].
Interestingly, although banned for use in food-producing animals in many countries (since 1994 in Europe; [98]), decreased chloramphenicol susceptibility continues to be described, not only in the present study (with MIC of 32 to > 64 mg/l), but also in others, with the presence of cat genes [87,99]. Chloramphenicol can occur naturally, produced by soil organisms such as Streptomyces venezuelae. The persistence of decreased susceptibility to this antibiotic may be due to intrinsic mechanisms of resistance as possibly in P. putida and P. stutzeri from our study or co-selection with other antibiotics and/or heavy metals [98,100,101]. On the other hand, florfenicol is widely used in aquaculture [8]. In a review article, Miranda et al. [102] compiled several studies in Chilean salmon farms that revealed a high frequency of decreased susceptibility to florfenicol, such as in our samples. However, there are further studies that described lower rates [103,104].
Another antibiotic class commonly used in aquaculture is quinolones, specifically flumequine and oxolinic acid [6,7]. In this study, we found low frequency of decreased susceptibility to quinolones (7% in muscles and 5% in gills, intestine and skin group). These results are confirmed by other works in S. aurata samples [38] and other fish species [105], while others revealed higher frequencies, also in fish samples [106]. Of the nine strains with decreased susceptibility to quinolones in this study, we found genes that justify that resistance in only two; the others may have untested resistance mechanisms. qnrB genes are frequently found in aquaculture environments [107,108], but to our knowledge, this is the first description of qnrB19 gene in an L. adecarboxylata strain. This strain had decreased susceptibility to ciprofloxacin and was susceptible to flumequine (MIC = 4 mg/L). The qnrB19 gene had already been reported in food-producing animals, such as pigs, poultry and veal calves, sometimes associated with mobile genetic elements, like plasmids and insertion sequences, demonstrating a potential for spreading [26,109]. Moreover, qnrB19 gene was also found in Enterobacteriaceae from human clinical samples [110,111,112]. K. pneumoniae strain with decreased susceptibility to ciprofloxacin and susceptibility to flumequine (MIC = 1 mg/L) revealed two non-synonymous mutations in parC gene within the quinolone-resistance-determining regions (QRDR), one of them (G385T) already described in a K. pneumoniae strain from nosocomial origin [113]. It is known that mutations in QRDR of parC gene can result in structural changes in topoisomerase IV, reducing the affinity of this enzyme to fluoroquinolones [114].
Vancomycin and mupirocin are not used in aquaculture [7]. Decreased susceptibilities to these antibiotics were found only in muscle samples in this study. Bacillus spp. resistance to vancomycin probably does not represent an intrinsic resistance, since several studies indicated the susceptibility of these bacteria to this glycopeptide [67]. The search for vanA, vanB and vanD genes was negative, so this non-susceptibility could be explained by the presence of other genes not studied, like vanC, vanE and vanG, or mutations in walKR, vraRS and graRS genes involved in cell wall metabolism and cellular response to cell wall damage [115]. To our knowledge, this is the first description of Bacillus sp. strains resistant to vancomycin in S. aurata from aquaculture. This resistance was already found in this environment but in Enterococcus species [87]. Acquired reduced susceptibility to mupirocin in S. petrasii could be related to mutations in the ileS gene and, more rarely, to the acquisition of plasmid-mediated mupA gene, like in S. aureus [116]. There are no data available about the frequency of detection of decreased susceptibility to mupirocin in aquaculture.
As we demonstrated, some antibiotics used in food-producing animals are the same, or belong to the same class, as antibiotics used in humans [117]. Several antibiotics for which decreased susceptibility was found in this study are integrated into the WHO list of “critically important antimicrobials” and “highly important antimicrobials” for human medicine. This means that for some bacterial infections, these antibiotics are the only therapy available, and that they are also used in humans to treat infections caused by bacteria/resistance genes that may be transmitted from non-human sources (namely food-producing animals) [118].

5. Conclusions

This study unraveled some information about bacterial diversity and antibiotic resistance genes that circulate in S. aurata raised in aquaculture.
It is noteworthy that the difficulty of characterizing the strains as susceptible or non-susceptible due to be the absence of breakpoints to some of the species found in these aquatic environments and to antibiotics commonly used in aquaculture. Further research is needed in this area, also in relation to intrinsic resistances since opportunistic environmental bacteria can represent a health threat and a reservoir of antibiotic-resistant bacteria/resistance genes.
In the current study, we can observe protective associations in muscle samples, while positive correlations were found in gills, intestine and skin group of samples. Indeed, being part of the gills, intestine and skin group represents a risk factor for the presence of Enterobacter sp. and non-susceptibility to phenicols.
Antibiotics are used in humans and aquaculture to treat infections caused by bacteria. Furthermore, it was already described that antibiotic residues can remain in fish tissues for long periods of time, increasing exposure of commensal bacteria and/or fish pathogens, along with aquatic bacteria, to these antibiotics, enhancing the development of resistance [8]. Therefore, it is fundamentally a “One Health” approach, combining the efforts of human and veterinary medicine, along with agriculture sector, to reduce the spread of bacterial resistance and/or bacterial resistance genes.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2607/8/9/1343/s1, Figure S1: Diagram summarizing the experimental design; Table S1: Odds ratio (OR) and 95% confidence intervals (CI) (p ≤ 0.05) from the analysis of negative and positive correlations between fish samples (muscle versus gills, intestine and skin) and each bacterial species and non-susceptibility to different antibiotic’s class (detailed results).

Author Contributions

Conceptualization, M.C.; methodology, V.S., V.M., E.F., L.R., M.C.; data curation, V.M. and V.S.; formal analysis, V.S., V.M., M.C.; investigation, V.S., V.M., N.M.B., E.F., M.C.; validation, M.C.; writing—original draft preparation, V.S.; visualization, V.M. and M.C.; writing—review and editing, M.C.; supervision, resources, project administration, and funding acquisition, M.C. All authors have read and agreed to the published version of the manuscript.

Funding

Vanessa Salgueiro has her Ph.D. fellowship granted by FCT (Fundação para a Ciência e a Tecnologia) with the reference SFRH/BD/133100/2017 co-financed by European Social Fund and the Operational Program for Human Capital (POCH), Portugal.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ottinger, M.; Clauss, K.; Kuenzer, C. Aquaculture: Relevance, distribution, impacts and spatial assessments—A review. Ocean Coast. Manag. 2016, 119, 244–266. [Google Scholar] [CrossRef]
  2. FAO Fisheries and Aquaculture Departement Fishery and Aquaculture Country Profiles. Portugal (2005). Country Profile Fact Sheets. Available online: http://www.fao.org/fishery/ (accessed on 20 July 2020).
  3. Direção-Geral de Recursos Naturais Segurança e Serviços Marítimos. Plano Estratégico para a Aquicultura Portuguesa 2014-2020; Direção-Geral de Recursos Naturais Segurança e Serviços Marítimos: Lisbon, Portugal, 2013. [Google Scholar]
  4. Martins, R.; Carneiro, M. Manual de Identificação de Peixes Ósseos da costa Continental Portuguesa—Principais Característica Diagnosticantes; Portuguese Institute for the Sea and Atmosphere: Lisbon, Portugal, 2018; ISBN 9789729083198. [Google Scholar]
  5. Heather, F.J.; Childs, D.Z.; Darnaude, A.M.; Blanchard, J.L. Using an integral projection model to assess the effect of temperature on the growth of gilthead seabream Sparus aurata. PLoS ONE 2018, 13, e0196092. [Google Scholar] [CrossRef] [PubMed]
  6. Cabello, F.C.; Godfrey, H.P.; Tomova, A.; Ivanova, L.; Dölz, H.; Millanao, A.; Buschmann, A.H. Antimicrobial use in aquaculture re-examined: Its relevance to antimicrobial resistance and to animal and human health. Environ. Microbiol. 2013, 15, 1917–1942. [Google Scholar] [CrossRef] [PubMed]
  7. Rodgers, C.J.; Furones, M.D. Antimicrobial agents in aquaculture: Practice, needs and issues. Options Méditerranéennes Série A Séminaires Méditerranéens 41–59. [CrossRef]
  8. Santos, L.; Ramos, F. Antimicrobial resistance in aquaculture: Current knowledge and alternatives to tackle the problem. Int. J. Antimicrob. Agents 2018, 52, 135–143. [Google Scholar] [CrossRef]
  9. Adeogun, A.O.; Ibor, O.R.; Onoja, A.B.; Arukwe, A. Fish condition factor, peroxisome proliferator activated receptors and biotransformation responses in Sarotherodon melanotheron from a contaminated freshwater dam (Awba Dam) in Ibadan, Nigeria. Mar. Environ. Res. 2016, 121, 74–86. [Google Scholar] [CrossRef]
  10. International Standard. Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 1: General Rules for the Preparation of the Initial Suspension and Decimal Dilutions, 2nd ed.; ISO copyright office: Geneva, Switzerland, 2017. [Google Scholar]
  11. International Standard. Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 3: Specific Rules for the Preparation of Fish and Fishery Products, 2nd ed.; ISO copyright office: Geneva, Switzerland, 2017. [Google Scholar]
  12. Jones-Dias, D.; Manageiro, V.; Caniça, M. Influence of agricultural practice on mobile bla genes: IncI1-bearing CTX-M, SHV, CMY and TEM in Escherichia coli from intensive farming soils. Environ. Microbiol. 2016, 18, 260–272. [Google Scholar] [CrossRef]
  13. EFSA Panel on Biological Hazards (BIOHAZ). Scientific Opinion on the public health risks of bacterial strains producing extended-spectrum β-lactamases and/or AmpC β-lactamases in food and food-producing animals. EFSA J. 2011, 9, 2322. [Google Scholar] [CrossRef]
  14. EFSA Panel on Biological Hazards (BIOHAZ). Scientific Opinion on Carbapenem resistance in food animal ecosystems. EFSA J. 2013, 11, 3501. [Google Scholar] [CrossRef]
  15. Schwarz, S.; Silley, P.; Simjee, S.; Woodford, N.; van Duijkeren, E.; Johnson, A.P.; Gaastra, W. Assessing the antimicrobial susceptibility of bacteria obtained from animals. Vet. Microbiol. 2010, 141, 1–4. [Google Scholar] [CrossRef]
  16. Dean, A.G.; Sullivan, K.M.; Soe, M.M. OpenEpi: Open Source Epidemiologic Statistics for Public Health. Available online: www.OpenEpi.com (accessed on 29 July 2020).
  17. Dallenne, C.; Da Costa, A.; Decre, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed]
  18. Mendonça, N.; Leitão, J.; Manageiro, V.; Ferreira, E.; Caniça, M. Spread of extended-spectrum β-lactamase CTX-M-producing Escherichia coli clinical isolates in community and nosocomial environments in Portugal. Antimicrob. Agents Chemother. 2007, 51, 1946–1955. [Google Scholar] [CrossRef] [PubMed]
  19. Fallah, F.; Borhan, R.S.; Hashemi, A. Detection of bla(IMP) and bla(VIM) metallo-β-lactamases genes among Pseudomonas aeruginosa strains. Int. J. Burns Trauma 2013, 3, 122–124. [Google Scholar] [PubMed]
  20. Khudhair, A.M.; Saadallah, S.; Al-faham, M. Isolation of Multi Antibiotic Resistance Serratia marcescens and the Detection of AmpC & GESβL Genes by Polymerase Chain Reaction Technique. Int. Assoc. Jungian Stud. 2011, 22, 329–346. [Google Scholar]
  21. Manageiro, V.; Ferreira, E.; Caniça, M.; Manaia, C. GES-5 among the beta-lactamases detected in ubiquitous bacteria isolated from aquatic environment samples. FEMS Microbiol. Lett. 2014, 351, 64–69. [Google Scholar] [CrossRef] [PubMed]
  22. Rodríguez-Martínez, J.-M.; Poirel, L.; Nordmann, P. Molecular Epidemiology and Mechanisms of Carbapenem Resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 2009, 53, 4783–4788. [Google Scholar] [CrossRef]
  23. Shoja, S.; Moosavian, M.; Peymani, A.; Tabatabaiefar, M.A. Genotyping of carbapenem resistant Acinetobacter baumannii isolated from tracheal tube discharge of hospitalized patients in intensive care. Iran. J. Microbiol. 2013, 5, 315–322. [Google Scholar]
  24. Chen, X.; Zhang, W.; Pan, W.; Yin, J.; Pan, Z.; Gao, S.; Jiao, X. Prevalence of qnr, aac(6’)-Ib-cr, qepA, and oqxAB in Escherichia coli Isolates from Humans, Animals, and the Environment. Antimicrob. Agents Chemother. 2012, 56, 3423–3427. [Google Scholar] [CrossRef]
  25. Ellington, M.J.; Hope, R.; Turton, J.F.; Warner, M.; Woodford, N.; Livermore, D.M. Detection of qnrA among Enterobacteriaceae from South-East England with extended-spectrum and high-level AmpC beta-lactamases. J. Antimicrob. Chemother. 2007, 60, 1176–1178. [Google Scholar] [CrossRef][Green Version]
  26. Jones-dias, D.; Manageiro, V.; Francisco, A.P.; Martins, A.P.; Domingues, G.; Louro, D.; Ferreira, E.; Caniça, M. Assessing the molecular basis of transferable quinolone resistance in Escherichia coli and Salmonella spp. from food-producing animals and food products. Vet. Microbiol. 2013, 167, 523–531. [Google Scholar] [CrossRef]
  27. Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.; Hooper, D.C. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [PubMed]
  28. Wu, J.J.; Ko, W.C.; Tsai, S.H.; Yan, J.J. Prevalence of plasmid-mediated quinolone resistance determinants QnrA, QnrB, and QnrS among clinical isolates of Enterobacter cloacae in a Taiwanese hospital. Antimicrob. Agents Chemother. 2007, 51, 1223–1227. [Google Scholar] [CrossRef] [PubMed]
  29. Ahmed, A.M.; Miyoshi, S.; Shinoda, S.; Shimamoto, T. Molecular characterization of a multidrug-resistant strain of enteroinvasive Escherichia coli O164 isolated in Japan. J. Med. Microbiol. 2005, 54, 273–278. [Google Scholar] [CrossRef]
  30. Everett, M.J.; Jin, Y.U.F.; Ricci, V.; Piddock, L.J. V Contributions of Individual Mechanisms to Fluoroquinolone Resistance in 36 Escherichia coli Strains Isolated from Humans and Animals. Antimicrob. Agents Chemother. 1996, 40, 2380–2386. [Google Scholar] [CrossRef] [PubMed]
  31. Mammeri, H.; Van De Loo, M.; Poirel, L.; Martinez-martinez, L.; Nordmann, P. Emergence of Plasmid-Mediated Quinolone Resistance in Escherichia coli in Europe. Antimicrob. Agents Chemother. 2005, 49, 71–76. [Google Scholar] [CrossRef] [PubMed]
  32. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; Guerra, B.; Malorny, B.; Borowiak, M.; Hammerl, J.A. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Eurosurveillance 2018, 23, 1–11. [Google Scholar] [CrossRef]
  33. Pajić, M.J.; Rašić, Z.B.; Velebit, B.M.; Boboš, S.F.; Mihajlović-ukropina, M.M.; Radinović, M.Ž.; Galfi, A.L.; Petković, J.M.; Trojačanec, S.I. The prevalence of methicillin resistance and Panton-Valentine leukocidin synthesis genes in Staphylococcus aureus isolates of bovine and human origin. Vet. Arch. 2014, 84, 205–214. [Google Scholar]
  34. Han, Q.F.; Zhao, S.; Zhang, X.R.; Wang, X.L.; Song, C.; Wang, S.G. Distribution, combined pollution and risk assessment of antibiotics in typical marine aquaculture farms surrounding the Yellow Sea, North China. Environ. Int. 2020, 138, 105551. [Google Scholar] [CrossRef]
  35. Kang, C.; Shin, Y.; Kim, W.; Kim, Y.; Song, K.; Oh, E.; Kim, S.; Yu, H.; So, J. Prevalence and antimicrobial susceptibility of Vibrio parahaemolyticus isolated from oysters in Korea. Environ. Sci. Pollut. Res. 2016, 23, 918–926. [Google Scholar] [CrossRef]
  36. Ng, C.; Chen, H.; Goh, S.G.; Haller, L.; Wu, Z.; Charles, F.R.; Trottet, A.; Gin, K. Microbial water quality and the detection of multidrug resistant E. coli and antibiotic resistance genes in aquaculture sites of Singapore. Mar. Pollut. Bull. 2018, 135, 475–480. [Google Scholar] [CrossRef]
  37. Pereira, A.M.P.T.; Silva, L.J.G.; Meisel, L.M.; Pena, A. Fluoroquinolones and Tetracycline Antibiotics in a Portuguese Aquaculture System and Aquatic Surroundings: Occurrence and Environmental Impact. J. Toxicol. Environ. Heal. Part A Curr. Issues 2015, 78, 959–975. [Google Scholar] [CrossRef] [PubMed]
  38. Scarano, C.; Piras, F.; Virdis, S.; Ziino, G.; Nuvoloni, R.; Dalmasso, A.; De Santis, E.P.L.; Spanu, C. Antibiotic resistance of Aeromonas ssp. strains isolated from Sparus aurata reared in Italian mariculture farms. Int. J. Food Microbiol. 2018, 284, 91–97. [Google Scholar] [CrossRef] [PubMed]
  39. Tajbakhsh, E.; Khamesipour, F.; Ranjbar, R.; Ugwu, I.C. Prevalence of class 1 and 2 integrons in multi—Drug resistant Escherichia coli isolated from aquaculture water in Chaharmahal Va Bakhtiari province, Iran. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 2–6. [Google Scholar] [CrossRef] [PubMed]
  40. de Bruijn, I.; Liu, Y.; Wiegertjes, G.F.; Raaijmakers, J.M. Exploring fish microbial communities to mitigate emerging diseases in aquaculture. FEMS Microbiol. Ecol. 2018, 94, fix161. [Google Scholar] [CrossRef]
  41. Pujalte, M.J.; Sitjà-Bobadilla, A.; Álvarez-Pellitero, P.; Garay, E. Carriage of potentially fish-pathogenic bacteria in Sparus aurata cultured in Mediterranean fish farms. Dis. Aquat. Organ. 2003, 54, 119–126. [Google Scholar] [CrossRef]
  42. Pȩkala-Safińska, A. Contemporary threats of bacterial infections in freshwater fish. J. Vet. Res. 2018, 62, 261–267. [Google Scholar] [CrossRef]
  43. Lalucat, J.; Bennasar, A.; Bosch, R.; Garcia-Valdes, E.; Palleroni, N.J. Biology of Pseudomonas stutzeri. Microbiol. Mol. Biol. Rev. 2006, 70, 510–547. [Google Scholar] [CrossRef]
  44. Cho, C.H.; Lee, S.B. Comparison of clinical characteristics and antibiotic susceptibility between Pseudomonas aeruginosa and P. putida keratitis at a tertiary referral center: A retrospective study. BMC Ophthalmol. 2018, 18, 3–9. [Google Scholar] [CrossRef]
  45. Halabi, Z.; Mocadie, M.; El Zein, S.; Kanj, S.S. Pseudomonas stutzeri prosthetic valve endocarditis: A case report and review of the literature. J. Infect. Public Health 2019, 12, 434–437. [Google Scholar] [CrossRef]
  46. Ouchenir, L.; Renaud, C.; Khan, S.; Bitnun, A.; Boisvert, A.A.; McDonald, J.; Bowes, J.; Brophy, J.; Barton, M.; Ting, J.; et al. The epidemiology, management, and outcomes of bacterial meningitis in infants. Pediatrics 2017, 140. [Google Scholar] [CrossRef]
  47. Raphael, E.; Riley, L.W. Infections caused by antimicrobial drug-resistant saprophytic Gram-negative bacteria in the environment. Front. Med. 2017, 4, 183. [Google Scholar] [CrossRef] [PubMed]
  48. Yoshino, Y.; Kitazawa, T.; Kamimura, M.; Tatsuno, K.; Ota, Y.; Yotsuyanagi, H. Pseudomonas putida bacteremia in adult patients: Five case reports and a review of the literature. J. Infect. Chemother. 2011, 17, 278–282. [Google Scholar] [CrossRef] [PubMed]
  49. Adrian, T.-G.-S.; Tan, P.-W.; Chen, J.-W.; Yin, W.-F.; Chan, K.-G. Draft Genome Sequence of Kocuria rhizophila strain TPW45, an Actinobacterium Isolated from Freshwater. J. Genom. 2016, 4, 16–18. [Google Scholar] [CrossRef] [PubMed]
  50. Purty, S.; Saranathan, R.; Prashanth, K.; Narayanan, K.; Asir, J.; Devi, C.S.; Amarnath, S.K. The expanding spectrum of human infections caused by Kocuria species: A case report and literature review. Emerg. Microbes Infect. 2013, 2, 1–8. [Google Scholar] [CrossRef] [PubMed]
  51. Yuan, M.; Yu, Y.; Li, H.R.; Dong, N.; Zhang, X.H. Phylogenetic diversity and biological activity of actinobacteria isolated from the chukchi shelf marine sediments in the arctic ocean. Mar. Drugs 2014, 12, 1281–1297. [Google Scholar] [CrossRef]
  52. Yun, J.H.; Roh, S.W.; Jung, M.J.; Kim, M.S.; Park, E.J.; Shin, K.S.; Nam, Y.-D.; Bae, J.W. Kocuria salsicia sp. nov., isolated from salt-fermented seafood. Int. J. Syst. Evol. Microbiol. 2011, 61, 286–289. [Google Scholar] [CrossRef]
  53. Mehrabadi, J.F.; Mirzaie, A.; Ahangar, N.; Rahimi, A.; Rokni-zadeh, H. Draft Genome Sequence of Kocuria rhizophila RF, a Radiation-Resistant Soil Isolate. Genome 2016, 4, 4–5. [Google Scholar] [CrossRef]
  54. Moissenet, D.; Becker, K.; Mérens, A.; Ferroni, A.; Dubern, B.; Vu-Thien, H. Persistent bloodstream infection with Kocuria rhizophila related to a damaged central catheter. J. Clin. Microbiol. 2012, 50, 1495–1498. [Google Scholar] [CrossRef]
  55. Das, A.; Behera, B.K.; Acharya, S.; Paria, P.; Chakraborty, H.J.; Parida, P.K.; Das, B.K. Genetic diversity and multiple antibiotic resistance index study of bacterial pathogen, Klebsiella pneumoniae strains isolated from diseased Indian major carps. Folia Microbiol. 2019, 64, 875–887. [Google Scholar] [CrossRef] [PubMed]
  56. Rahman, M.; Rahman, M.; Deb, S.C.; Alam, S. Molecular Identification of Multiple Antibiotic Resistant Fish Pathogenic Enterococcus faecalis and their Control by Medicinal Herbs. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [PubMed]
  57. Regecová, I.; Pipová, M.; Jevinová, P.; Marušková, K.; Kmeť, V.; Popelka, P. Species identification and antimicrobial resistance of coagulase-negative staphylococci isolated from the meat of sea fish. J. Food Sci. 2014, 79, M898–M902. [Google Scholar] [CrossRef] [PubMed]
  58. Thillai Sekar, V.; Santiago, T.C.; Vijayan, K.K.; Alavandi, S.V.; Stalin Raj, V.; Rajan, J.J.S.; Sanjuktha, M.; Kalaimani, N. Involvement of Enterobacter cloacae in the mortality of the fish, Mugil cephalus. Lett. Appl. Microbiol. 2008, 46, 667–672. [Google Scholar] [CrossRef] [PubMed]
  59. Walczak, N.; Puk, K.; Guz, L. Bacterial flora associated with diseased freshwater ornamental fish. J. Vet. Res. 2017, 61, 445–449. [Google Scholar] [CrossRef]
  60. Akbari, M.; Bakhshi, B.; Peerayeh, S.N. Particular Distribution of Enterobacter cloacae Strains Isolated from Urinary Tract Infection within Clonal Complexes. Iran. Biomed. J. 2016, 20, 49–55. [Google Scholar] [CrossRef] [PubMed]
  61. McCoy, E.; Morrison, J.; Cook, V.; Johnston, J.; Eblen, D.; Guo, C. Foodborne Agents Associated with the Consumption of Aquaculture Catfish. J. Food Prot. 2011, 74, 500–516. [Google Scholar] [CrossRef]
  62. Savini, V.; Catavitello, C.; Bianco, A.; Balbinot, A.; Antonio, D.D. Epidemiology, Pathogenicity and Emerging Resistances in Staphylococcus pasteuri: From Mammals and Lampreys, to Man. Recent Pat. Antiinfect. Drug Discov. 2009, 4, 123–129. [Google Scholar] [CrossRef]
  63. Anderson, A.C.; Jonas, D.; Huber, I.; Karygianni, L.; Wölber, J.; Hellwig, E.; Arweiler, N.; Vach, K.; Wittmer, A.; Al-ahmad, A. Enterococcus faecalis from Food, Clinical Specimens, and Oral Sites: Prevalence of Virulence Factors in Association with Biofilm Formation. Front. Microbiol. 2016, 6, 1534. [Google Scholar] [CrossRef]
  64. Delshad, S.T.; Soltanian, S.; Sharifiyazdi, H.; Haghkhah, M.; Bossier, P. Identification of N-acyl homoserine lactone-degrading bacteria isolated from rainbow trout (Oncorhynchus mykiss). J. Appl. Microbiol. 2018, 125, 356–369. [Google Scholar] [CrossRef]
  65. Sousa, M.; Torres, C.; Barros, J.; Somalo, S.; Igrejas, G.; Poeta, P. Gilthead seabream (Sparus aurata) as carriers of SHV-12 and TEM-52 extended-spectrum beta-lactamases-containing Escherichia coli isolates. Foodborne Pathog. Dis. 2011, 8, 1139–1141. [Google Scholar] [CrossRef]
  66. Srisapoome, P.; Areechon, N. Efficacy of viable Bacillus pumilus isolated from farmed fish on immune responses and increased disease resistance in Nile tilapia (Oreochromis niloticus): Laboratory and on-farm trials. Fish Shellfish Immunol. 2017, 67, 199–210. [Google Scholar] [CrossRef]
  67. Bottone, E.J. Bacillus cereus, a Volatile Human Pathogen. Clin. Microbiol. Rev. 2010, 23, 382–398. [Google Scholar] [CrossRef] [PubMed]
  68. Clements, A.; Young, J.C.; Constantinou, N.; Frankel, G. Infection strategies of enteric pathogenic Escherichia coli. Gut Microbes 2012, 3, 71–87. [Google Scholar] [CrossRef] [PubMed]
  69. Dyabi, F.Z.; Bennaoui, F.; Slitine, N.E.I.; Soraa, N.; Maoulainine, F.M. Enterobacter hormaechei: New Neonatal Infection in Morocco. Open Infect. Dis. J. 2018, 10, 147–150. [Google Scholar] [CrossRef]
  70. Interaminense, J.A.; Nascimento, D.C.O.; Ventura, R.F.; Batista, J.E.C.; Souza, M.M.C.; Hazin, F.H.V.; Pontes-Filho, N.T.; Lima-Filho, J. V Recovery and screening for antibiotic susceptibility of potential bacterial pathogens from the oral cavity of shark species involved in attacks on humans in Recife, Brazil. J. Med. Microbiol. 2010, 59, 941–947. [Google Scholar] [CrossRef]
  71. Keren, Y.; Keshet, D.; Eidelman, M.; Geffen, Y.; Raz-pasteur, A.; Hussein, K. Is Leclercia adecarboxylata a New and Unfamiliar Marine Pathogen? J. Clin. Microbiol. 2014, 52, 1775–1776. [Google Scholar] [CrossRef] [PubMed]
  72. Tam, V.; Nayak, S. Isolation of Leclercia adecarboxylata from a wound infection after exposure to hurricane-related floodwater. BMJ Case Rep. 2012, 1–3. [Google Scholar] [CrossRef] [PubMed]
  73. Di Lodovico, S.; Cataldi, V.; Di Campli, E.; Ancarani, E.; Cellini, L.; Giulio, M.D. Enterococcus hirae biofilm formation on hospital material surfaces and effect of new biocides. Environ. Health Prev. Med. 2017, 22, 63. [Google Scholar] [CrossRef]
  74. Ccorahua-Santo, R.; Cervantes, M.; Duran, Y.; Aguirre, M.; Marin, C.; Ramírez, P. Draft genome sequence of Klebsiella michiganensis 3T412C, harboring an arsenic resistance genomic island, isolated from mine tailings in Peru. Genome Announc. 2017, 5, 5–6. [Google Scholar] [CrossRef]
  75. Heinle, C.E.; Junqueira, A.C.M.; Uchida, A.; Purbojati, R.W.; Houghton, J.N.I.; Chénard, C.; Drautz-Moses, D.I.; Wong, A.; Kolundžija, S.; Clare, M.E.; et al. Complete genome sequence of Lelliottia nimipressuralis type strain SGAir0187, isolated from tropical air collected in Singapore. Genome Announc. 2018, 6, 1–2. [Google Scholar] [CrossRef]
  76. Kämpfer, P.; Glaeser, S.P.; Packroff, G.; Behringer, K.; Exner, M.; Chakraborty, T.; Schmithausen, R.M.; Doijad, S. Lelliottia aquatilis sp. Nov., isolated from drinking water. Int. J. Syst. Evol. Microbiol. 2018, 68, 2454–2461. [Google Scholar] [CrossRef]
  77. Mitra, S.; Pramanik, K.; Ghosh, P.K.; Soren, T.; Sarkar, A.; Dey, R.S.; Pandey, S.; Maiti, T.K. Characterization of Cd-resistant Klebsiella michiganensis MCC3089 and its potential for rice seedling growth promotion under Cd stress. Microbiol. Res. 2018, 210, 12–25. [Google Scholar] [CrossRef] [PubMed]
  78. Palmer, M.; de Maayer, P.; Poulsen, M.; Steenkamp, E.T.; van Zyl, E.; Coutinho, T.A.; Venter, S.N. Draft genome sequences of Pantoea agglomerans and Pantoea vagans isolates associated with termites. Stand. Genom. Sci. 2016, 11. [Google Scholar] [CrossRef]
  79. Wang, S.S.; Liu, J.M.; Sun, J.; Sun, Y.F.; Liu, J.N.; Jia, N.; Fan, B.; Dai, X.F. Diversity of culture-independent bacteria and antimicrobial activity of culturable endophytic bacteria isolated from different Dendrobium stems. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [PubMed]
  80. Qiao, Y.; Peng, Q.; Yan, J.; Wang, H.; Ding, H.; Shi, B. Gene cloning and enzymatic characterization of alkali-tolerant type I pullulanase from Exiguobacterium acetylicum. Lett. Appl. Microbiol. 2014, 60, 52–59. [Google Scholar] [CrossRef]
  81. Keynan, Y.; Weber, G.; Sprecher, H. Molecular identification of Exiguobacterium acetylicum as the aetiological agent of bacteraemia. J. Med. Microbiol. 2007, 56, 563–564. [Google Scholar] [CrossRef]
  82. Seiffert, S.N.; Wüthrich, D.; Gerth, Y.; Egli, A. First clinical case of KPC-3—Producing Klebsiella michiganensis in Europe. New Microbes New Infect. 2019, 29, 100516. [Google Scholar] [CrossRef]
  83. Sekyere, J.O.; Amoako, D.G. Genomic and phenotypic characterisation of fluoroquinolone resistance mechanisms in Enterobacteriaceae in Durban, South Africa. PLoS ONE 2017, 12, e0178888. [Google Scholar] [CrossRef]
  84. Zheng, B.; Xu, H.; Yu, X.; Lv, T.; Jiang, X.; Cheng, H.; Zhang, J.; Chen, Y.; Huang, C.; Xiao, Y. Identification and genomic characterization of a KPC-2-, NDM-1- and NDM-5-producing Klebsiella michiganensis isolate. J. Antimicrob. Chemother. 2018, 73, 536–538. [Google Scholar] [CrossRef]
  85. Leal-Negredo, Á.; Castelló-Abietar, C.; Leiva, P.S.; Fernández, J. Infección urinaria por Lelliottia amnigena (Enterobacter amnigenus): Un patógeno infrecuente. Rev. Española Quimioter. 2017, 30, 483–484. [Google Scholar]
  86. Xu, L.; Yin, M.; Zhu, T.; Liu, Y.; Ying, Y.; Lu, J.; Lin, C.; Ying, J.; Xu, T.; Ni, L.; et al. Comparative Genomics Analysis of Plasmid pPV989-94 from a Clinical Isolate of Pantoea vagans PV989. Int. J. Genom. 2018, 2018, 1242819. [Google Scholar] [CrossRef]
  87. Barros, J.; Andrade, M.; Radhouani, H.; López, M.; Igrejas, G.; Poeta, P.; Torres, C. Detection of vanA-containing Enterococcus species in faecal microbiota of gilthead seabream (Sparus aurata). Microbes Environ. 2012, 27, 509–511. [Google Scholar] [CrossRef] [PubMed]
  88. Cardozo, M.V.; Borges, C.A.; Beraldo, L.G.; Maluta, R.P.; Pollo, A.S.; Borzi, M.M.; dos Santos, L.F.; Kariyawasam, S.; Ávila, F.A. de Shigatoxigenic and atypical enteropathogenic Escherichia coli in fish for human consumption. Braz. J. Microbiol. 2018, 49, 936–941. [Google Scholar] [CrossRef]
  89. Adnan, M.; Patel, M.; Hadi, S. Functional and health promoting inherent attributes of Enterococcus hirae F2 as a novel probiotic isolated from the digestive tract of the freshwater fish Catla catla. PeerJ 2017, 2017, e3085. [Google Scholar] [CrossRef] [PubMed]
  90. Jinendiran, S.; Boopathi, S.; Sivakumar, N.; Selvakumar, G. Functional Characterization of Probiotic Potential of Novel Pigmented Bacterial Strains for Aquaculture Applications. Probiotics Antimicrob. Proteins 2019, 11, 186–197. [Google Scholar] [CrossRef] [PubMed]
  91. Adelowo, O.O.; Caucci, S.; Banjo, O.A.; Nnanna, O.C.; Awotipe, E.O.; Peters, F.B.; Fagade, O.E.; Berendonk, T.U. Extended Spectrum Beta-Lactamase (ESBL)-producing bacteria isolated from hospital wastewaters, rivers and aquaculture sources in Nigeria. Environ. Sci. Pollut. Res. 2018, 25, 2744–2755. [Google Scholar] [CrossRef] [PubMed]
  92. Almeida, M.V.A.; Cangussú, Í.M.; Carvalho, A.L.S.; Brito, I.L.P.; Costa, R.A. Drug resistance, AmpC-β-lactamase and ESBL producing Enterobacteriaceae isolated from fish and shrimp. Rev. Inst. Med. Trop. Sao Paulo 2017, 59, 1–7. [Google Scholar] [CrossRef]
  93. Cheng, H.; Jiang, H.; Fang, J.; Zhu, C. Antibiotic Resistance and Characteristics of Integrons in Escherichia coli Isolated from Penaeus vannamei at a Freshwater Shrimp Farm in Zhejiang Province, China. J. Food Prot. 2019, 82, 470–478. [Google Scholar] [CrossRef]
  94. Resende, J.A.; Silva, V.L.; Fontes, C.O.; Souza-Filho, J.A.; Oliveira, T.L.R.; Coelho, C.M.; César, D.E.; Diniz, C.G. Multidrug-Resistance and Toxic Metal Tolerance of Medically Important Bacteria Isolated from an Aquaculture System. Microbes Environ. 2012, 27, 449–455. [Google Scholar] [CrossRef]
  95. Codjoe, F.; Donkor, E. Carbapenem Resistance: A Review. Med. Sci. 2017, 6, 1. [Google Scholar] [CrossRef]
  96. Jacoby, G.A. AmpC Beta-Lactamases. Clin. Microbiol. Rev. 2009, 22, 161–182. [Google Scholar] [CrossRef]
  97. Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, present, and future. Antimicrob. Agents Chemother. 2011, 55, 4943–4960. [Google Scholar] [CrossRef] [PubMed]
  98. Nordkvist, E.; Zuidema, T.; Herbes, R.G.; Berendsen, B.J.A. Occurrence of chloramphenicol in cereal straw in north-western Europe. Food Addit. Contam. Part A Chem. Anal. Control. Expo. Risk Assess. 2016, 33, 798–803. [Google Scholar] [CrossRef]
  99. Nguyen, H.N.K.; Van, T.T.H.; Nguyen, H.T.; Smooker, P.M.; Shimeta, J.; Coloe, P.J. Molecular characterization of antibiotic resistance in Pseudomonas and Aeromonas isolates from catfish of the Mekong Delta, Vietnam. Vet. Microbiol. 2014, 171, 397–405. [Google Scholar] [CrossRef]
  100. Adewoye, L.; Topp, E.; Li, X.-Z. Antimicrobial Drug Efflux Genes and Pumps in Bacteria of Animal and Environmental Origin. In Efflux-Mediated Antimicrobial Resistance in Bacteria; Li, X., Elkins, C., Zgurskaya, H., Eds.; Adis: Cham, Switzerland, 2016; pp. 561–593. ISBN 978-3-319-39658-3. [Google Scholar]
  101. Muziasari, W.I.; Pärnänen, K.; Johnson, T.A.; Lyra, C.; Karkman, A.; Stedtfeld, R.D.; Tamminen, M.; Tiedje, J.M.; Virta, M. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments. FEMS Microbiol. Ecol. 2016, 92, fiw052. [Google Scholar] [CrossRef] [PubMed]
  102. Miranda, C.D.; Godoy, F.A.; Lee, M.R. Current status of the use of antibiotics and the antimicrobial resistance in the chilean salmon farms. Front. Microbiol. 2018, 9, 1284. [Google Scholar] [CrossRef] [PubMed]
  103. Higuera-Llantén, S.; Vásquez-Ponce, F.; Barrientos-Espinoza, B.; Mardones, F.O.; Marshall, S.H.; Olivares-Pacheco, J. Extended antibiotic treatment in salmon farms select multiresistant gut bacteria with a high prevalence of antibiotic resistance genes. PLoS ONE 2018, 13, e0203641. [Google Scholar] [CrossRef]
  104. Syrova, E.; Kohoutova, L.; Dolejska, M.; Papezikova, I.; Kutilova, I.; Cizek, A.; Navratil, S.; Minarova, H.; Palikova, M. Antibiotic resistance and virulence factors in mesophilic Aeromonas spp. from Czech carp fisheries. J. Appl. Microbiol. 2018, 125, 1702–1713. [Google Scholar] [CrossRef]
  105. Mata, W.; Putita, C.; Dong, H.T.; Kayansamruaj, P.; Senapin, S.; Rodkhum, C. Quinolone-resistant phenotype of Flavobacterium columnare isolates harbouring point mutations both in gyrA and parC but not in gyrB or parE. J. Glob. Antimicrob. Resist. 2018, 15, 55–60. [Google Scholar] [CrossRef]
  106. Hossain, S.; De Silva, B.C.J.; Wickramanayake, M.V.K.S.; Dahanayake, P.S.; Wimalasena, S.H.M.P.; Heo, G.J. Incidence of antimicrobial resistance genes and class 1 integron gene cassettes in multidrug-resistant motile Aeromonas sp. isolated from ornamental guppy (Poecilia reticulata). Lett. Appl. Microbiol. 2019, 69, 2–10. [Google Scholar] [CrossRef]
  107. Jiang, H.; Tang, D.; Liu, Y.; Zhang, X.; Zeng, Z.; Xu, L.; Hawkey, P.M. Prevalence and characteristics of beta-lactamase and plasmid-mediated quinolone resistance genes in Escherichia coli isolated from farmed fish in China. J. Antimicrob. Chemother. 2012, 67, 2350–2353. [Google Scholar] [CrossRef] [PubMed]
  108. Chenia, H.Y. Prevalence and characterization of plasmid-mediated quinolone resistance genes in Aeromonas spp. isolated from South African freshwater fish. Int. J. Food Microbiol. 2016, 231, 26–32. [Google Scholar] [CrossRef] [PubMed]
  109. Hordijk, J.; Bosman, A.B.; van Essen-Zandbergen, A.; Veldman, K.; Dierikx, C.; Wagenaar, J.A.; Mevius, D. qnrB19 Gene Bracketed by IS26 on a 40-Kilobase IncR Plasmid from an Escherichia coli Isolate from a Veal Calf. Antimicrob. Agents Chemother. 2011, 55, 453–454. [Google Scholar] [CrossRef] [PubMed]
  110. Martins, W.M.B.S.; Almeida, A.C.S.; Nicoletti, A.G.; Cayô, R.; Gales, A.C.; Alves, L.C.; Brayner, F.B.; Vilela, M.A.; Morais, M.M.C. Coproduction of KPC-2 and QnrB19 in Klebsiella pneumoniae ST340 isolate in Brazil. Diagn. Microbiol. Infect. Dis. 2015, 83, 375–376. [Google Scholar] [CrossRef] [PubMed]
  111. Richter, S.N.; Frasson, I.; Bergo, C.; Manganelli, R.; Cavallaro, A.; Palù, G. Characterisation of qnr plasmid-mediated quinolone resistance in Enterobacteriaceae from Italy: Association of the qnrB19 allele with the integron element ISCR1 in Escherichia coli. Int. J. Antimicrob. Agents 2012, 35, 578–583. [Google Scholar] [CrossRef]
  112. Moreno-Switt, A.I.; Pezoa, D.; Sepúlveda, V.; González, I.; Rivera, D.; Retamal, P.; Navarrete, P.; Reyes-Jara, A.; Toro, M. Transduction as a Potential Dissemination Mechanism of a Clonal qnrB19 -Carrying Plasmid Isolated From Salmonella of Multiple Serotypes and Isolation Sources. Front. Microbiol. 2019, 10, 1–9. [Google Scholar] [CrossRef]
  113. Araújo, B.F.; De Campos, P.A.; Royer, S.; Ferreira, M.L.; Gonçalves, I.R.; Resende, D.S.; De Brito, C.S.; Gontijo-filho, P.P.; Ribas, R.M. High frequency of the combined presence of QRDR mutations and PMQR determinants in multidrug-resistant Klebsiella pneumoniae and Escherichia coli isolates from nosocomial and community-acquired infections. J. Med. Microbiol. 2017, 66, 1144–1150. [Google Scholar] [CrossRef]
  114. Minarini, L.A.R.; Darini, A.L.C. Mutations in the quinolone resistance-determining regions of gyrA and parC in Enterobacteriaceae isolates from Brazil. Braz. J. Microbiol. 2012, 43, 1309–1314. [Google Scholar] [CrossRef]
  115. Bisicchia, P.; Bui, N.K.; Aldridge, C.; Vollmer, W.; Devine, K.M. Acquisition of VanB-type vancomycin resistance by Bacillus subtilis: The impact on gene expression, cell wall composition and morphology. Mol. Microbiol. 2011, 81, 157–178. [Google Scholar] [CrossRef]
  116. Patel, J.B.; Gorwitz, R.J.; Jernigan, J.A. Mupirocin Resistance. Clin. Infect. Dis. 2009, 49, 935–941. [Google Scholar] [CrossRef]
  117. World Health Organization. WHO Guidelines on Use of Medically Important Antimicrobials in Food-Producing Animals; World Health Organization: Geneva, Switzerland, 2017; ISBN 9241550139. [Google Scholar]
  118. World Health Organization. Critically Important Antimicrobials for Human Medicine; World Health Organization: Geneva, Switzerland, 2018; ISBN 978-92-4-151552-8. [Google Scholar]
Table 1. Weight, furcal length, total length and condition index of the five S. aurata collected in March 2018, as well as the water temperature of the land tank from fish farming pilot station in the south of Portugal.
Table 1. Weight, furcal length, total length and condition index of the five S. aurata collected in March 2018, as well as the water temperature of the land tank from fish farming pilot station in the south of Portugal.
S. aurataWeight (g)Furcal Length (cm)Total Length (cm)Condition Index 1Water Temperature
Fish 1130337.742.31.7217.5 °C
Fish 2120134.438.92.04
Fish 397735.639.71.56
Fish 4107636.240.11.67
Fish 5119737.441.11.72
1 Condition index allows one to assess the health of the fish through the relationship between its weight and length (values greater than 1 indicate a good condition of the fish) [9].
Table 2. Antibiotics used for antibiotic susceptibility testing and respective concentrations and breakpoints by bacterial family.
Table 2. Antibiotics used for antibiotic susceptibility testing and respective concentrations and breakpoints by bacterial family.
FamilyMethodAntibiotics Tested (Concentration)Breakpoints
BacillaceaeMIC by E-test®VA (0.016–256 µg/mL)CLSI M45
Enterobacteriaceae
Erwiniaceae
Disk diffusionAMC (20 + 10 µg), AZT (30 µg), FEP (30 µg), CTX (5 µg), FOX (30 µg), CAZ (10 µg), ERT (10 µg), IMP (10 µg), MEM (10 µg), PTZ (36 µg), CIP (5 µg) SXT (25 µg), GEN (10 µg)EUCAST
MIC by broth microdilutionCHL, FLO, OTC
FMQ
CLSI VET08
CASFM VET 2019
EnterococcaceaeDisk diffusionAMP (2 µg), GEN HC (30 µg), STR HC (300 µg)EUCAST
MIC by E-test®LNZ, TP, VA
PseudomonadaceaeDisk diffusionAZT (30 µg), FEP (30 µg), CAZ (10 µg), DOR (10 µg), ERT (10 µg), IMP (10 µg), MEM (10 µg), PTZ (36 µg), CIP (5 µg), LEV (5 µg), AN (30 µg), GEN (10 µg), NET (10 µg), TMN (10 µg)EUCAST
MIC by broth microdilutionCHL, FLO, FMQ, OTCCLSI M100 1
StaphylococcaceaeDisk diffusionFOX (30 µg), CIP (5 µg), LEV (5 µg), MOX (5 µg), RIF (5 µg), MUP (200 µg), FUS (10 µg)EUCAST
MIC by E-test®DPC (0.016–256 µg/mL), LNZ (0.016–256 µg/mL), TP (0.016–256 µg/mL), VA (0.016–256 µg/mL)
1 Breakpoints for CHL were used for FLO as well; breakpoints for CIP were used for FMQ; and breakpoints for tetracycline were used for OTC. Abbreviations—AMC: amoxicillin/clavulanic acid; AZT: aztreonam; FEP: cefepime; CTX: cefotaxime; FOX: cefoxitin; CAZ: ceftazidime; ERT: ertapenem; IPM: imipenem; MEM: meropenem; PTZ: piperacillin/tazobactam; CIP: ciprofloxacin; SXT: trimethoprim/sulfamethoxazole; GEN: gentamicin; CHL: chloramphenicol; FLO: florfenicol; OTC: oxytetracycline; FMQ: flumequine; DOR: doripenem; LEV: levofloxacin; AN: amikacin; NET: netilmicin; TMN: tobramycin; FOX: cefoxitin; MOX: moxifloxacin; RIF: rifampicin; MUP: mupirocin; FUS: fusidic acid; DPC: daptomycin; LNZ: linezolid; TP: teicoplanin; VA: vancomycin; AMP: ampicillin; GEN HC: gentamicin high concentration; STR HC: streptomycin high concentration; EUCAST: European Committee on Antimicrobial Susceptibility Testing; CLSI: Clinical and Laboratory Standards Institute; CASFM VET: Comité de l’antibiogramme de la Société Française de Microbiologie Recommandations Vétérinaires.
Table 3. Primers used in the detection of resistance genes that were described in this study for the first time.
Table 3. Primers used in the detection of resistance genes that were described in this study for the first time.
GeneForward Primer Sequence
(5’ → 3’)
Reverse Primer Sequence
(5’ → 3’)
AT 2PCR 3
blaOXA-48GACTATATTATTCGGGCTAAACCACTTCTAGGGAATAATT58 °C140 pb
blaNDMGTTTGATCGTCAGGGATGGCAACGGTGATATTGTCACTGGT56 °C359 pb
blaGESAAAGCAGCTCAGATCGGTGTTCTCTCCAACAACCCAATC56 °C707 pb
blaSMECAGATGAGCGGTTCCCTTTAAACCCAATCAGCAGGAACAC56 °C509 pb
qnrB1ATGACGCCATTACTGTATAACTAACCAATCACCGCGATGC49 °C697 pb
qnrCAACGTACGATCAAATTGTCCACTTTACGAGGTTCT55 °C560 pb
gyrBGGACAAAGAAGGCTACAGCACGTCGCGTTGTACTCAGATA55 °C880 pb
vanAAAGGTCTGTTTGAATTGTCCGCGACTTCCTGATGAATACGA55 °C417 bp
vanBCCATACTCTCCCCGGATAGGTTGACCTCATTTAGAACGATGC55 °C721 bp
vanDATTGGAATCACAAAATCCGGGCTGTGCTTCCTGATG55 °C626 bp
1 Primers used for sequencing. 2 Annealing temperature. 3 PCR product.
Table 4. Bacterial families of the 136 strains recovered from muscle, gills, intestine and skin samples.
Table 4. Bacterial families of the 136 strains recovered from muscle, gills, intestine and skin samples.
Bacterial FamilyFish Farm
Muscle (n = 5)Gills, Intestine and Skin (n = 1) 1
No. of Strains%No. of Strains%
Bacillaceae910%717%
BacillalesFamily XII. Incertae Sedis11%00%
Comamonadaceae22%00%
Enterobacteriaceae5255%2560%
Enterococcaceae44%25%
Erwiniaceae00%12%
Micrococcaceae44%00%
Pseudomonadaceae77%12%
Staphylococcaceae1516%614%
Total (No. of strains/%)94100%42100%
1 Results from gills, intestine and skin samples were treated jointly.
Table 5. Odds ratio (OR) and 95% confidence intervals (CI) (p ≤ 0.05) from the analysis of negative and positive correlations between fish samples (muscle vs. gills, intestine and skin) and each bacterial species and non-susceptibility to different antibiotics classes.
Table 5. Odds ratio (OR) and 95% confidence intervals (CI) (p ≤ 0.05) from the analysis of negative and positive correlations between fish samples (muscle vs. gills, intestine and skin) and each bacterial species and non-susceptibility to different antibiotics classes.
Fish SampleBacterial Species 1Antibiotic’s Class 2OR 395% CIp Value
MuscleALLPhenicols0.3921 (P)0.1701–0.912≤0.01
Gills, intestine and skinALLPhenicols2.551.096–5.879≤0.01
MuscleEnterobacter sp.-0.1648 (P)0.02645–0.7834≤0.01
Gills, intestine and skinEnterobacter sp.-6.0671.277–37.8≤0.01
Only significant associations are presented: p-values ≤ 0.05 and confidence limits excluding null values (0, 1, or [n]). 1 ALL include all species identified in the study, described in point 3.1. of results. 2 Antibiotic’s class tested was: glycopeptides, mupirocin, phenicols, phenicols, quinolones, β-lactams. 3 (P) indicates an OR value for a protective or negative association; otherwise, values should be interpreted as a positive association.
Table 6. Antibiotic susceptibility testing results of the 136 strains found in this study (these results do not include known intrinsic non-susceptibilities).
Table 6. Antibiotic susceptibility testing results of the 136 strains found in this study (these results do not include known intrinsic non-susceptibilities).
Antibiotic’s ClassFish Farm
Muscle (n = 94)Gills, Intestine and Skin (n = 42)
R/I (%)S (%)R/I (%)S (%)
Aminoglycosides0 (0)94 (100)0 (0)42 (100)
Fusidanes0 (0)94 (100)0 (0)42 (100)
Glycopeptides 13 (3)91 (97)0 (0)42 (100)
Lipopeptides0 (0)94 (100)0 (0)42 (100)
Mupirocin1 (1)93 (99)0 (0)42 (100)
Oxazolidinones0 (0)94 (100)0 (0)42 (100)
Phenicols 223 (24)71 (76)19 (45)23 (55)
Quinolones 37 (7)87 (93)2 (5)40 (95)
Rifampicin0 (0)94 (100)0 (0)42 (100)
Tetracyclines0 (0)94 (100)0 (0)42 (100)
Trimethoprim/sulfamethoxazole0 (0)94 (100)0 (0)42 (100)
β-lactams 412 (13)82 (87)4 (10)38 (90)
1 Vancomycin; 2 chloramphenicol and florfenicol; 3 ciprofloxacin, flumequine and levofloxacin; 4 amoxicillin/clavulanic acid, aztreonam, cefepime, cefotaxime, cefoxitin, ceftazidime, ertapenem, meropenem and piperacillin/tazobactam.
Table 7. MIC50 and MIC90 for Enterobacteriaceae strains (n = 77).
Table 7. MIC50 and MIC90 for Enterobacteriaceae strains (n = 77).
AntibioticEnterobacteriaceae
Muscle (n = 52)Gills, Intestine and Skin (n = 25)
MIC50MIC90RangeS%I%R%MIC50MIC90RangeS%I%R%
Flumequine0.510.125–2100NA00.510.25–4100NA0
Chloramphenicol481–329622482–329244
Florfenicol8161–32563778161–32246016
Oxytetracycline240.5–410000240.5–410000
NA: not applicable, because intermediate category does not exist for flumequine.
Table 8. Phenotype profile of the 61 strains that revealed decreased susceptibility to at least one antibiotic, including intrinsic non-susceptibility.
Table 8. Phenotype profile of the 61 strains that revealed decreased susceptibility to at least one antibiotic, including intrinsic non-susceptibility.
FamilySpeciesDecreased Susceptibility ProfileNo. of Strains
BacillaceaeBacillus cereusVA1
Bacillus sp.VA2
EnterobacteriaceaeCitrobacter freundiiAMC, FOX, FLO1
Citrobacter freundii complexAMC, FOX, FLO1
Enterobacter cloacaeAMC, FOX, CHL, FLO2
AMC, FOX, FLO4
AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ1
AMC, AZT, CAZ, ERT, FOX1
Enterobacter hormaecheiAMC, FOX, FLO12
AMC, FOX5
AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ1
AMC, AZT, FEP, CTX, FOX, CAZ, ERT, FLO, PTZ1
Enterobacter sp.AMC, FOX, FLO6
AMC, FOX, FLO, ERT1
AMC, FOX, CAZ1
AMC, AZT, FEP, CTX, FOX, CAZ, CHL, ERT, FLO, PTZ1
AMC, AZT, CTX, FOX, CAZ, ERT, FLO1
Escherichia coliAMC, CHL, FLO1
AMC, FLO2
Klebsiella pneumoniaeCIP, FLO1
FLO5
Leclercia adecarboxylataCIP, FLO1
PseudomonadaceaePseudomonas putidaAZT, ERT, MEM2
AZT, CHL, ERT, FLO, FMQ, MEM2
Pseudomonas stutzeriAZT, CHL, ERT, FLO, FMQ3
AZT, CIP, ERT, FLO, FMQ, MEM1
StaphylococcaceaeStaphylococcus petrasiiCIP, LEV, MUP1
Total 61
AMC: amoxicillin/clavulanic acid; AZT: aztreonam; FEP: cefepime; CTX: cefotaxime; FOX: cefoxitin; CAZ: ceftazidime; CHL: chloramphenicol; CIP: ciprofloxacin; ERT: ertapenem; FLO: florfenicol; FMQ: flumequine; LEV: levofloxacin; MEM: meropenem; MUP: mupirocin; PTZ: piperacillin/tazobactam; VA: vancomycin.

Share and Cite

MDPI and ACS Style

Salgueiro, V.; Manageiro, V.; Bandarra, N.M.; Reis, L.; Ferreira, E.; Caniça, M. Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms 2020, 8, 1343. https://doi.org/10.3390/microorganisms8091343

AMA Style

Salgueiro V, Manageiro V, Bandarra NM, Reis L, Ferreira E, Caniça M. Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms. 2020; 8(9):1343. https://doi.org/10.3390/microorganisms8091343

Chicago/Turabian Style

Salgueiro, Vanessa, Vera Manageiro, Narcisa M. Bandarra, Lígia Reis, Eugénia Ferreira, and Manuela Caniça. 2020. "Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture" Microorganisms 8, no. 9: 1343. https://doi.org/10.3390/microorganisms8091343

APA Style

Salgueiro, V., Manageiro, V., Bandarra, N. M., Reis, L., Ferreira, E., & Caniça, M. (2020). Bacterial Diversity and Antibiotic Susceptibility of Sparus aurata from Aquaculture. Microorganisms, 8(9), 1343. https://doi.org/10.3390/microorganisms8091343

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop