Bacteriomic Profiling of Branchial Lesions Induced by Neoparamoeba perurans Challenge Reveals Commensal Dysbiosis and an Association with Tenacibaculum dicentrarchi in AGD-Affected Atlantic Salmon (Salmo salar L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Amoebic Challenge and 16S rRNA Bacterial Community Analysis
2.1.1. Experimental Challenge with Neoparamoeba Perurans
2.1.2. Tissue Biopsy Sampling
2.1.3. Gill Mucosal Swabs
2.1.4. Gill Histology
2.1.5. Water Sample Collection
2.1.6. DNA Extraction and Purification
2.1.7. 16S Amplicon Sequencing
2.1.8. Bioinformatic and Statistical Analyses
2.1.9. Statistical Analysis
2.1.10. Quantitative PCR
3. Results
3.1. AGD Pathology
3.2. 16S Amplicon Sequencing
3.3. Alpha and Beta Diversity
3.4. Taxonomic Assignment and Composition
3.5. Quantitative PCR
4. Discussion
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Cabillon, N.; Lazado, C. Mucosal barrier functions of fish under changing environmental conditions. Fishes 2019, 4, 2. [Google Scholar] [CrossRef]
- Llewellyn, M.S.; Boutin, S.; Hoseinifar, S.H.; Derome, N. Teleost microbiomes: The state of the art in their characterization, manipulation and importance in aquaculture and fisheries. Front. Microbiol. 2014, 5. [Google Scholar] [CrossRef] [PubMed]
- Whitman, W.B.; Coleman, D.C.; Wiebe, W.J. Prokaryotes: The unseen majority. Proc. Natl. Acad. Sci. USA 1998, 95, 6578–6583. [Google Scholar] [CrossRef]
- Derome, N.; Gauthier, J.; Boutin, S.; Llewellyn, M. Bacterial opportunistic pathogens of fish. In The Rasputin Effect: When Commensals and Symbionts Become Parasitic; Springer International Publishing: Cham, Switzerland, 2016; pp. 81–108. [Google Scholar]
- Miyake, S.; Soh, M.; Azman, M.; Ngoh, S.; Orbán, L.; Seedorf, H. Insights into the microbiota of Asian seabass (Lates calcarifer) with tenacibaculosis symptoms and description of sp. nov. Tenacibaculum singaporense. bioRxiv 2018, 47, 2001. [Google Scholar] [CrossRef]
- Li, T.; Long, M.; Ji, C.; Shen, Z.; Gatesoupe, F.; Zhang, X.; Zhang, Q.; Zhang, L.; Zhao, Y.; Liu, X.; et al. Alterations of the gut microbiome of largemouth bronze gudgeon (Coreius guichenoti) suffering from furunculosis. Sci. Rep. 2016, 6, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Llewellyn, M.S.; Leadbeater, S.; Garcia, C.; Sylvain, F.-E.; Custodio, M.; Ang, K.P.; Powell, F.; Carvalho, G.R.; Creer, S.; Elliot, J.; et al. Parasitism perturbs the mucosal microbiome of Atlantic Salmon. Sci. Rep. 2017, 7, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Reveco, F.E.; Øverland, M.; Romarheim, O.H.; Mydland, L.T. Intestinal bacterial community structure differs between healthy and inflamed intestines in Atlantic salmon (Salmo salar L.). Aquaculture 2014, 420–421, 262–269. [Google Scholar] [CrossRef]
- Lokesh, J.; Kiron, V. Transition from freshwater to seawater reshapes the skin-associated microbiota of Atlantic salmon. Sci. Rep. 2016, 6, 1–10. [Google Scholar] [CrossRef]
- Minniti, G.; Hagen, L.H.; Porcellato, D.; Jørgensen, S.M.; Pope, P.B.; Vaaje-Kolstad, G. The skin-mucus microbial community of farmed Atlantic salmon (Salmo salar). Front. Microbiol. 2017, 8, 1–11. [Google Scholar] [CrossRef]
- Schmidt, V.; Gomez-Chiarri, M.; Roy, C.; Smith, K.; Amaral-Zettler, L. Crossm probiotics reduces antibiotic-associated mortality in fish. Am. Soc. Microbiol. 2017, 2, 1–13. [Google Scholar]
- Boutin, S.; Audet, C.; Derome, N. Probiotic treatment by indigenous bacteria decreases mortality without disturbing the natural microbiota of Salvelinus fontinalis. Can. J. Microbiol. 2013, 59, 662–670. [Google Scholar] [CrossRef] [PubMed]
- Crosbie, P.B.B.; Bridle, A.R.; Cadoret, K.; Nowak, B.F. In vitro cultured Neoparamoeba perurans causes amoebic gill disease in Atlantic salmon and fulfils Koch’s postulates. Int. J. Parasitol. 2012, 42, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Munday, B.L. Disease of salmonids. In Proceedings of the Workshop on Diseases in Australian Fish and Shellfish, Benalla, Australia, 27–30 May 1985; Humphrey, J.D., Langdon, J.S., Eds.; Victoria Department of Agriculture: Melbourne, Australia; Australian Fish Health Reference Laboratory: Benalla, Australia; Regional Veterinary Laboratory: Benalla, Australia, 1986; pp. 127–141. [Google Scholar]
- Zilberg, D.; Munday, B.L. Pathology of experimental amoebic gill disease in Atlantic salmon, Salmo salar L., and the effect of pre-maintenance of fish in sea water on the infection. J. Fish Dis. 2000, 23, 401–407. [Google Scholar] [CrossRef]
- Pennacchi, Y.; Adams, M.B.; Nowak, B.F.; Bridle, A.R. Immune gene expression in the gills of Atlantic salmon (Salmo salar L.) following experimental reinfection with Neoparamoeba perurans. Aquaculture 2016, 464, 410–419. [Google Scholar] [CrossRef]
- Nowak, B.; Valdenegro-Vega, V.; Crosbie, P.; Bridle, A. Immunity to Amoeba. Dev. Comp. Immunol. 2014, 43, 257–267. [Google Scholar] [CrossRef] [PubMed]
- Morrison, R.N.; Koppang, E.O.; Hordvik, I.; Nowak, B.F. MHC class II+ cells in the gills of Atlantic salmon (Salmo salar L.) affected by amoebic gill disease. Vet. Immunol. Immunopathol. 2006, 109, 297–303. [Google Scholar] [CrossRef]
- Wynne, J.W.; O’Sullivan, M.G.; Stone, G.; Cook, M.T.; Nowak, B.F.; Lovell, D.R.; Taylor, R.S.; Elliott, N.G. Resistance to amoebic gill disease (AGD) is characterised by the transcriptional dysregulation of immune and cell cycle pathways. Dev. Comp. Immunol. 2008, 32, 1539–1560. [Google Scholar] [CrossRef]
- Bridle, A.R.; Morrison, R.N.; Cupit Cunningham, P.M.; Nowak, B.F. Quantitation of immune response gene expression and cellular localisation of interleukin-1beta mRNA in Atlantic salmon, Salmo salar L., affected by amoebic gill disease (AGD). Vet. Immunol. Immunopathol. 2006, 114, 121–134. [Google Scholar] [CrossRef]
- Morrison, R.N.; Zou, J.; Secombes, C.J.; Scapigliati, G.; Adams, M.B.; Nowak, B.F. Molecular cloning and expression analysis of tumour necrosis factor-α in amoebic gill disease (AGD)-affected Atlantic salmon (Salmo salar L.). Fish Shellfish Immunol. 2007, 23, 1015–1031. [Google Scholar] [CrossRef]
- Marcos-López, M.; Rodger, H. Amoebic gill disease and host response in Atlantic salmon (Salmo salar L.): A review. Parasite Immunol. 2020, e12766. [Google Scholar] [CrossRef]
- Bowman, J.P.; Nowak, B. Salmonid gill bacteria and their relationship to amoebic gill disease. J. Fish Dis. 2004, 27, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Embar-Gopinath, S.; Butler, R.; Nowak, B. Influence of salmonid gill bacteria on development and severity of amoebic gill disease. Dis. Aquat. Organ. 2005, 67, 55–60. [Google Scholar] [CrossRef] [PubMed]
- Bridle, A.R.; Davenport, D.L.; Crosbie, P.B.B.; Polinski, M.; Nowak, B.F. Neoparamoeba perurans loses virulence during clonal culture. Int. J. Parasitol. 2015, 45, 575–578. [Google Scholar] [CrossRef] [PubMed]
- Cano, I.; Taylor, N.G.; Bayley, A.; SusieGunning; McCullough, R.; Bateman, K.; Nowak, B.F.; Paleya, R.K. In vitro gill cell monolayer successfully reproduces in vivo Atlantic salmon host responses to Neoparamoeba perurans infection. Fish Shellfish Immunol. 2019, 86, 287–300. [Google Scholar] [CrossRef] [PubMed]
- Roubal, F.R.; Lester, R.J.G.; Foster, C.K. Studies on cultured and gill-attached Paramoeba sp. (Gymnamoebae: Paramoebidae) and the cytopathology of paramoebic gill disease in Atlantic salmon, Salmo salar L., from Tasmania. J. Fish Dis. 1989, 12, 481–492. [Google Scholar] [CrossRef]
- Wiik-Nielsen, J.; Mo, T.A.; Kolstad, H.; Mohammad, S.N.; Hytterød, S.; Powell, M.D. Morphological diversity of Paramoeba perurans trophozoites and their interaction with Atlantic salmon, Salmo salar L., gills. J. Fish Dis. 2016, 39, 1113–1123. [Google Scholar] [CrossRef]
- Butler, R.; Nowak, B.F. In vitro interactions between Neoparamoeba sp. and Atlantic salmon epithelial cells. J. Fish Dis. 2004, 27, 343–349. [Google Scholar] [CrossRef]
- Mirelman, D. Ameba-bacterium relationship in amebiasis. Microbiol. Rev. 1987, 51, 272–284. [Google Scholar] [CrossRef]
- Galván-Moroyoqui, J.M.; Domínguez-Robles, M.d.C.; Franco, E.; Meza, I. The interplay between Entamoeba and enteropathogenic bacteria modulates epithelial cell damage. PLoS Negl. Trop. Dis. 2008, 2. [Google Scholar] [CrossRef]
- Neelam, S.; Niederkorn, J.Y. Pathobiology and immunobiology of Acanthamoeba keratitis: Insights from animal models. Yale J. Biol. Med. 2017, 90, 261–268. [Google Scholar]
- Wynne, J.W.; Stratford, C.; Slinger, J.; Samsing, F.; Rigby, M.; McCulloch, R.; Quezada-Rodriguez, P.; Taylor, R.S. The interaction between temperature and dose on the efficacy and biochemical response of Atlantic salmon to hydrogen peroxide treatment for amoebic gill disease. J. Fish Dis. 2020, 43, 39–48. [Google Scholar] [CrossRef]
- Pennacchi, Y.; Leef, M.J.; Crosbie, P.B.B.; Nowak, B.F.; Bridle, A.R. Evidence of immune and inflammatory processes in the gills of AGD-affected Atlantic salmon, Salmo salar L. Fish Shellfish Immunol. 2014, 36, 563–570. [Google Scholar] [CrossRef]
- Lane, D.J.; Pace, B.; Olsen, G.J.; Stahl, D.A.; Sogin, M.L.; Pace, N.R. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci. USA 1985, 82, 6955–6959. [Google Scholar] [CrossRef] [PubMed]
- Lane, D.J. rRNA Sequencing; John Wiley & Sons: New York, NK, USA, 1991. [Google Scholar]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Bokulich, N.A.; Kaehler, B.D.; Rideout, J.R.; Dillon, M.; Bolyen, E.; Knight, R.; Huttley, G.A.; Caporaso, J.G. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2′s q2-feature-classifier plugin. Microbiome 2018, 6, 90. [Google Scholar] [CrossRef] [PubMed]
- Quast, C.; Pruesse, E.; Yilmaz, P.; Gerken, J.; Schweer, T.; Yarza, P.; Peplies, J.; Glöckner, F.O. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res. 2012, 41, D590–D596. [Google Scholar] [CrossRef] [PubMed]
- R Core Team. R: A Language and Environment for Statistical Computing, Vienna, Austria. Available online: https://www.R-project.org. (accessed on 15 June 2020).
- Quensen, J. QsRutils: R Functions Useful for Community Ecology. 2020. Available online: https://github.com/jfq3/QsRutils (accessed on 15 June 2020).
- McMurdie, P.J.; Holmes, S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 2013, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Oksanen, J.; Kindt, R.; Legendre, P.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; Stevens, M.H.H. Vegan: Community Ecology Package. R Packag Version 118-28/r1577. Available online: http://R-Forge.R-project.org/projects/vegan/ (accessed on 15 June 2020).
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016. [Google Scholar]
- Downes, J.; Henshilwood, K.; Collins, E.; Ryan, A.; O’Connor, I.; Rodger, H.; MacCarthy, E.; Ruane, N. A longitudinal study of amoebic gill disease on a marine Atlantic salmon farm utilising a real-time PCR assay for the detection of Neoparamoeba perurans. Aquac. Environ. Interact. 2015, 7, 239–251. [Google Scholar] [CrossRef]
- Staroscik, A. dsDNA Copy Number Calculator. Available online: https://cels.uri.edu/gsc/cndna.html (accessed on 15 June 2020).
- English, C.J.; Tyml, T.; Botwright, N.A.; Barnes, A.C.; Wynne, J.W.; Lima, P.C.; Cook, M.T. A diversity of amoebae colonise the gills of farmed Atlantic salmon (Salmo salar) with amoebic gill disease (AGD). Eur. J. Protistol. 2019, 67, 27–45. [Google Scholar] [CrossRef]
- Reid, K.M.; Patel, S.; Robinson, A.J.; Bu, L.; Jarungsriapisit, J.; Moore, L.J.; Salinas, I. Salmonid alphavirus infection causes skin dysbiosis in Atlantic salmon (Salmo salar L.) post-smolts. PLoS ONE 2017, 12, e0172856. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, H.H.; Arias, C.R. Potassium permanganate elicits a shift of the external fish microbiome and increases host susceptibility to columnaris disease. Vet. Res. 2015, 46, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Gjessing, M.C.; Steinum, T.; Olsen, A.B.; Lie, K.I.; Tavornpanich, S.; Colquhoun, D.J.; Gjevre, A. Histopathological investigation of complex gill disease in sea farmed Atlantic salmon. PLoS ONE 2019, 14, e0222926. [Google Scholar] [CrossRef] [PubMed]
- Herrero, A.; Thompson, K.D.; Ashby, A.; Rodger, H.D.; Dagleish, M.P. Complex Gill Disease: An emerging syndrome in farmed atlantic salmon (Salmo salar L.). J. Comp. Pathol. 2018, 163, 23–28. [Google Scholar] [CrossRef] [PubMed]
- Rozas-Serri, M. Gill diseases in marine salmon aquaculture with an emphasis on amoebic gill disease. CAB Rev. Perspect. Agric. Vet. Sci Nutr. Nat. Resour 2019, 14, 1–15. [Google Scholar] [CrossRef]
- Young, N.D.; Cooper, G.A.; Nowak, B.F.; Koop, B.F.; Morrisona, R.N. Coordinated down-regulation of the antigen processing machinery in the gills of amoebic gill disease-affected Atlantic salmon (Salmo salar L.). Mol. Immunol. 2008, 45, 2581–2597. [Google Scholar] [CrossRef]
- Hvas, M.; Karlsbakk, E.; Mæhle, S.; Wright, D.W.; Oppedal, F. The gill parasite Paramoeba perurans compromises aerobic scope, swimming capacity and ion balance in Atlantic salmon. Conserv. Physiol. 2017, 5, 1–12. [Google Scholar] [CrossRef]
- Munday, B.L.; Zilberg, D.; Findlay, V. Gill disease of marine fish caused by infection with Neoparamoeba pemaquidensis. J. Fish Dis. 2001, 24, 497–507. [Google Scholar] [CrossRef]
- Legrand, T.P.R.A.; Wynne, J.W.; Weyrich, L.S.; Oxley, A.P.A. A microbial sea of possibilities: Current knowledge and prospects for an improved understanding of the fish microbiome. Rev. Aquac. 2019, 12, 1101–1134. [Google Scholar] [CrossRef]
- van Kessel, M.A.H.J.; Mesman, R.J.; Arshad, A.; Metz, J.R.; Spanings, F.A.T.; van Dalen, S.C.M.; van Niftrik, L.; Flik, G.; Bonga, S.E.W.; Jetten, M.S.M.; et al. Branchial nitrogen cycle symbionts can remove ammonia in fish gills. Environ. Microbiol. Rep. 2016, 8, 590–594. [Google Scholar] [CrossRef] [PubMed]
- Abdelsalam, M. Potential role of anaerobic bacteria as fish pathogens. J. Aquac. Res. Dev. 2017, 8. [Google Scholar] [CrossRef]
- Roy, D. Probiotics, Comprehensive Biotechnology, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2011; pp. 591–602. [Google Scholar]
- Wilson, T.K.; Douglas, M.; Dunn, V. First identification in Tasmania of fish pathogens Tenacibaculum dicentrarchi and T. soleae and multiplex PCR for these organisms and T. maritimum. Dis. Aquat. Organ. 2019, 136, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Avendaño-Herrera, R.; Toranzo, A.E.; Magariños, B. Tenacibaculosis infection in marine fish caused by Tenacibaculum maritimum: A review. Dis. Aquat. Organ. 2006, 71, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Avendaño-Herrera, R.; Irgang, R.; Sandoval, C.; Moreno-Lira, P.; Houel, A.; Duchaud, E.; Poblete-Morales, M.; Nicolas, P.; Ilardi, P. Isolation, characterization and virulence potential of tenacibaculum dicentrarchi in salmonid cultures in chile. Transbound. Emerg. Dis. 2016, 63, 121–126. [Google Scholar]
- Frisch, K.; Småge, S.B.; Brevik, J.; Duesund, H.; Nylund, A. Genotyping of Tenacibaculum maritimum isolates from farmed Atlantic salmon in Western Canada. J. Fish Dis. 2018, 41, 131–137. [Google Scholar] [CrossRef]
- Småge, S.B.; Frisch, K.; Vold, V.; Duesund, H.; Brevik, J.; Olsen, R.H.; Sjaatil, S.T.; Klevan, A.; Brudeseth, B.; Watanabe, K.; et al. Induction of tenacibaculosis in Atlantic salmon smolts using Tenacibaculum finnmarkense and the evaluation of a whole cell inactivated vaccine. Aquaculture 2018, 495, 858–864. [Google Scholar] [CrossRef]
- Suzuki, M.; Nakagawa, Y.; Harayama, S.; Yamamoto, S. Phylogenetic analysis and taxonomic study of marine Cytophaga-like bacteria: Proposal for Tenacibaculum gen. nov. with Tenacibaculum maritimum comb. nov. and Tenacibaculum ovolyticum comb. nov., and description of Tenacibaculum mesophilum sp. nov. and Tenacibaculum amylolyticum sp. nov. Int. J. Syst. Evol. Microbiol. 2001, 51, 1639–1652. [Google Scholar]
- Fringuelli, E.; Savage, P.D.; Gordon, A.; Baxter, E.J.; Rodger, H.; Graham, D.A. Development of a quantitative real-time PCR for the detection of Tenacibaculum maritimum and its application to field samples. J. Fish Dis. 2012, 35, 579–590. [Google Scholar] [CrossRef]
- Speare, D.J. Nodular gill disease (amoebic gill infestation) in Arctic char, Salvelinus alpinus. J. Comp. Pathol. 1999, 121, 277–282. [Google Scholar] [CrossRef]
- Powell, M.D.; Harris, J.O.; Carson, J.; Hill, J.V. Effects of gill abrasion and experimental infection with Tenacibaculum maritimum on the respiratory physiology of Atlantic salmon Salmo salar affected by amoebic gill disease. Dis. Aquat. Organ. 2005, 63, 169–174. [Google Scholar] [CrossRef] [PubMed]
- Downes, J.K.; Yatabe, T.; Marcos-Lopez, M.; Rodger, H.D.; MacCarthy, E.; O’Connor, I.; Collins, E.; Ruane, N.M. Investigation of co-infections with pathogens associated with gill disease in Atlantic salmon during an amoebic gill disease outbreak. J. Fish Dis. 2018, 41. [Google Scholar] [CrossRef] [PubMed]
- Taylor, R.S.; Muller, W.J.; Cook, M.T.; Kube, P.D.; Elliott, N.G. Gill observations in Atlantic salmon (Salmo salar, L.) during repeated amoebic gill disease (AGD) field exposure and survival challenge. Aquaculture 2009, 290, 1–8. [Google Scholar] [CrossRef]
- Ferguson, H.W.; Delannoy, C.M.J.; Hay, S.; Nicolson, J.; Sutherland, D.; Crumlish, M. Jellyfish as vectors of bacterial disease for farmed salmon (Salmo salar). J. Vet. Diagn. Investig. 2010, 22, 376–382. [Google Scholar] [CrossRef]
- Småge, S.B.; Frisch, K.; Brevik, Ø.J.; Watanabe, K.; Nylund, A. First isolation, identification and characterisation of Tenacibaculum maritimum in Norway, isolated from diseased farmed sea lice cleaner fish Cyclopterus lumpus L. Aquaculture 2016, 464, 178–184. [Google Scholar] [CrossRef]
- Tosetti, N.; Croxatto, A.; Greub, G. Amoebae as a tool to isolate new bacterial species, to discover new virulence factors and to study the host-pathogen interactions. Microb. Pathog. 2014, 77, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Van Gelderen, R.; Carson, J.; Nowak, B. Effect of extracellular products of tenacibaculum maritimum in atlantic salmon, salmo salar L. J. Fish. Dis. 2009, 32, 727–731. [Google Scholar] [CrossRef] [PubMed]
- Nasser, W.; Santhanam, B.; Roshan Miranda, E.; Parikh, A.; Juneja, K.; Rot, G.; Dinh, C.; Chen, R.; Zupan, B.; Shaulsky, G.; et al. Bacterial discrimination by Dictyostelid amoebae reveals the complexity of ancient interspecies interactions. Curr. Biol. 2014, 23, 862–872. [Google Scholar] [CrossRef] [PubMed]
- Fritsche, T.R.; Sobek, D.; Gautom, R.K. Enhancement of in vitro cytopathogenicity by Acanthamoeba spp. following acquisition of bacterial endosymbionts. FEMS Microbiol. Lett. 1998, 166, 231–236. [Google Scholar] [CrossRef] [PubMed]
Assay (Gene) | Primer | Sequence (5′-3′) | Length | Ref |
---|---|---|---|---|
T. dicentrarchi (16S rRNA) | FWD | TAACATTATGCTTGCATAGATGACGA | 26 bp | Current study |
REV | AGCCTTGTGATAATTTGTAAATACCCATG | 29 bp | ||
Probe | FAM-CCTTTAGAAATGAAGATTAATACTCCATAATGTAGTGATTCGG-MGB | 43 bp | ||
N. perurans (18S rRNA) | FWD | AAAAGACCATGCGATTCGTAAAGT | 24 bp | Downes et al. [47] |
REV | CATTCTTTTCGGAGAGTGGAAATT | 24 bp | ||
Probe | FAM-ATCATGATTCACCATATGTT-MGB | 20 bp |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Slinger, J.; Adams, M.B.; Wynne, J.W. Bacteriomic Profiling of Branchial Lesions Induced by Neoparamoeba perurans Challenge Reveals Commensal Dysbiosis and an Association with Tenacibaculum dicentrarchi in AGD-Affected Atlantic Salmon (Salmo salar L.). Microorganisms 2020, 8, 1189. https://doi.org/10.3390/microorganisms8081189
Slinger J, Adams MB, Wynne JW. Bacteriomic Profiling of Branchial Lesions Induced by Neoparamoeba perurans Challenge Reveals Commensal Dysbiosis and an Association with Tenacibaculum dicentrarchi in AGD-Affected Atlantic Salmon (Salmo salar L.). Microorganisms. 2020; 8(8):1189. https://doi.org/10.3390/microorganisms8081189
Chicago/Turabian StyleSlinger, Joel, Mark B. Adams, and James W. Wynne. 2020. "Bacteriomic Profiling of Branchial Lesions Induced by Neoparamoeba perurans Challenge Reveals Commensal Dysbiosis and an Association with Tenacibaculum dicentrarchi in AGD-Affected Atlantic Salmon (Salmo salar L.)" Microorganisms 8, no. 8: 1189. https://doi.org/10.3390/microorganisms8081189
APA StyleSlinger, J., Adams, M. B., & Wynne, J. W. (2020). Bacteriomic Profiling of Branchial Lesions Induced by Neoparamoeba perurans Challenge Reveals Commensal Dysbiosis and an Association with Tenacibaculum dicentrarchi in AGD-Affected Atlantic Salmon (Salmo salar L.). Microorganisms, 8(8), 1189. https://doi.org/10.3390/microorganisms8081189