Characterization of the Role of a Non-GPCR Membrane-Bound CFEM Protein in the Pathogenicity and Germination of Botrytis cinerea
Abstract
:1. Introduction
2. Material and Methods
2.1. Fungal and Plant Material
2.2. Identification of a Non-GPCR Membrane-Bound CFEM-Containing Protein
2.3. Infection Assay
2.4. DNA and RNA Isolation
2.5. Quantitative RT-PCR
2.6. Construction of CFEM-Bcin07g03260 Mutants
2.7. Saprophytic Growth and Conidiation Assay
2.8. Conidial Germination Assay
2.9. Statistical Analysis
3. Results
3.1. Identification of Bcin07g03260, a Non-GPCR Membrane-Bound CFEM-Containing Protein
3.2. Study of ΔCFEM-Bcin07g03260 Mutants
3.3. CFEM-Bcin07g03260 is not Required for Growth, and Conidiation of B. cinerea
3.4. CFEM-Bcin07g03260 is Required for Pathogenicity of B. cinerea
3.5. CFEM-Bcin07g03260 is Required for Conidial Germination and Germ Tube Elongation
3.6. CFEM-Bcin07g03260 is Upregulated in the Course of Germination
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Romanazzi, G.; Droby, S. Control Strategies for postharvest grey mould on fruit crops. In Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer: Cham, Switzerland, 2016; pp. 217–228. [Google Scholar] [CrossRef]
- Droby, A.; Lichter, A. Post-harvest Botrytis infection: Etiology, development and management. In Botrytis: Biology, Pathology and Control; Elad, Y., Williamson, B., Tudzynski, P., Delen, N., Eds.; Kluwer Academic Press: Dordrecht, The Netherlands, 2004; pp. 349–367. [Google Scholar]
- Romanazzi, G.; Feliziani, E. Botrytis cinerea. In Postharvest Decay: Control Strategies; Bautista-Baños, S., Ed.; Elsevier/AP; Academic Press is an imprint of Elsevier: Amsterdam, The Netherlands; Boston, MA, USA, 2014; pp. 131–146. [Google Scholar] [CrossRef]
- Elad, Y.; Pertot, I.; Cotes Prado, A.M.; Stewart, A. Plant hosts of Botrytis spp. In Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer: Cham, Switzerland, 2016; pp. 413–486. [Google Scholar] [CrossRef]
- Williamson, B.; Tudzynski, B.; Tudzynski, P.; Van Kan, J.A. Botrytis cinerea: The cause of grey mould disease. Mol. Plant Pathol. 2007, 8, 561–580. [Google Scholar] [CrossRef] [PubMed]
- Elad, Y.; Vivier, M.; Fillinger, S. Botrytis, the good, the bad and the ugly. In Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer: Cham, Switzerland, 2016; pp. 1–15. [Google Scholar] [CrossRef]
- Srivastava, D.A.; Yakubov, M.; Feldbaum, R.; Tish, N.; Shoyhet, H.; Manasherova, E.; Pandaranayaka, E.P.J.; Rav-David, D.; Elad, Y.; Harel, A. Multiparametric analysis of diversity in Botrytis cinerea isolates from Israel. Phytoparasitica 2018, 46, 569–581. [Google Scholar] [CrossRef]
- Schumacher, J. Tools for Botrytis cinerea: New expression vectors make the gray mold fungus more accessible to cell biology approaches. Fungal Genet. Biol. 2012, 49, 483–497. [Google Scholar] [CrossRef] [PubMed]
- Van Kan, J.A.L.; Stassen, J.H.M.; Mosbach, A.; Van Der Lee, T.A.J.; Faino, L.; Farmer, A.D.; Papasotiriou, D.G.; Zhou, S.; Seidl, M.F.; Cottam, E.; et al. A gapless genome sequence of the fungus Botrytis cinerea. Mol. Plant Pathol. 2017, 18, 75–89. [Google Scholar] [CrossRef] [Green Version]
- Kulkarni, R.D.; Kelkar, H.S.; Dean, R.A. An eight-cysteine-containing CFEM domain unique to a group of fungal membrane proteins. Trends Biochem. Sci. 2003, 28, 118–121. [Google Scholar] [CrossRef]
- Ding, C.; Vidanes, G.M.; Maguire, S.L.; Guida, A.; Synnott, J.M.; Andes, D.R.; Butler, G. Conserved and divergent roles of Bcr1 and CFEM proteins in Candida parapsilosis and Candida albicans. PLoS ONE 2011, 6, e28151. [Google Scholar] [CrossRef] [Green Version]
- Pérez, A.; Ramage, G.; Blanes, R.; Murgui, A.; Casanova, M.; Martínez, J.P. Some biological features of Candida albicans mutants for genes coding fungal proteins containing the CFEM domain. FEMS Yeast Res. 2011, 11, 273–284. [Google Scholar] [CrossRef] [Green Version]
- Srivastava, V.K.; Suneetha, K.J.; Kaur, R. A systematic analysis reveals an essential role for high-affinity iron uptake system, haemolysin and CFEM domain-containing protein in iron homoeostasis and virulence in Candida glabrata. Biochem. J. 2014, 463, 103–114. [Google Scholar] [CrossRef]
- Zhang, Z.-N.; Wu, Q.-Y.; Zhang, G.-Z.; Zhu, Y.-Y.; Murphy, R.W.; Liu, Z.; Zou, C.-G. Systematic analyses reveal uniqueness and origin of the CFEM domain in fungi. Sci. Rep. 2015, 5, 13032. [Google Scholar] [CrossRef] [Green Version]
- Moukadiri, I.; Armero, J.; Abad, A.; Sentandreu, R.; Zueco, J. Identification of a mannoprotein present in the inner layer of the cell wall of Saccharomyces cerevisiae. J. Bacteriol. 1997, 179, 2154–2162. [Google Scholar] [CrossRef] [Green Version]
- Vaknin, Y.; Shadkchan, Y.; Levdansky, E.; Morozov, M.; Romano, J.; Osherov, N. The three Aspergillus fumigatus CFEM-domain GPI-anchored proteins (CfmA-C) affect cell-wall stability but do not play a role in fungal virulence. Fungal Genet. Biol. 2014, 63, 55–64. [Google Scholar] [CrossRef]
- Dvir, H.; Kornitzer, D. CFEM protein Csa2. In Encyclopedia of Inorganic and Bioinorganic Chemistry; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2018; pp. 1–9. [Google Scholar] [CrossRef]
- Sabnam, N.; Roy-Barman, S. WISH, a novel CFEM GPCR is indispensable for surface sensing, asexual and pathogenic differentiation in rice blast fungus. Fungal Genet. Biol. 2017, 105, 37–51. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Wei, W.; Wu, Y.; Zhou, Y.; Peng, F.; Zhang, S.; Chen, P.; Xu, X. BcCFEM1, a CFEM domain-containing protein with putative GPI-anchored site, is involved in pathogenicity, conidial production, and stress tolerance in Botrytis cinerea. Front. Microbiol. 2017, 8, 1807. [Google Scholar] [CrossRef] [PubMed]
- Weissman, Z.; Kornitzer, D. A family of Candida cell surface haem-binding proteins involved in haemin and haemoglobin-iron utilization. Mol. Microbiol. 2004, 53, 1209–1220. [Google Scholar] [CrossRef] [PubMed]
- Weissman, Z.; Shemer, R.; Kornitzer, D. Deletion of the copper transporter CaCCC2 reveals two distinct pathways for iron acquisition in Candida albicans. Mol. Microbiol. 2002, 44, 1551–1560. [Google Scholar] [CrossRef] [PubMed]
- Kuznets, G.; Vigonsky, E.; Weissman, Z.; Lalli, D.; Gildor, T.; Kauffman, S.J.; Turano, P.; Becker, J.; Lewinson, O.; Kornitzer, D. A relay network of extracellular heme-binding proteins drives C. albicans iron acquisition from hemoglobin. PLoS Pathog. 2014, 10, e1004407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nasser, L.; Weissman, Z.; Pinsky, M.; Amartely, H.; Dvir, H.; Kornitzer, D. Structural basis of haem-iron acquisition by fungal pathogens. Nat. Microbiol. 2016, 1, 16156. [Google Scholar] [CrossRef]
- Weis, W.I.; Kobilka, B.K. The Molecular Basis of G Protein-Coupled Receptor Activation. Annu. Rev. Biochem. 2018, 87, 897–919. [Google Scholar] [CrossRef]
- Dilks, T.; Halsey, K.; De Vos, R.P.; Hammond-Kosack, K.E.; Brown, N.A. Non-canonical fungal G-protein coupled receptors promote Fusarium head blight on wheat. PLoS Pathog. 2019, 15, e1007666. [Google Scholar] [CrossRef] [Green Version]
- Kou, Y.; Tan, Y.H.; Ramanujam, R.; Naqvi, N.I. Structure-function analyses of the Pth11 receptor reveal an important role for CFEM motif and redox regulation in rice blast. New Phytol. 2017, 214, 330–342. [Google Scholar] [CrossRef]
- Choi, W.; Dean, R.A. The adenylate cyclase gene MAC1 of Magnaporthe grisea controls appressorium formation and other aspects of growth and development. Plant Cell 1997, 9, 1973–1983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Kan, J.A.; Van’t Klooster, J.W.; Wagemakers, C.A.; Dees, D.C.; Van der Vlugt-Bergmans, C.J. Cutinase A of Botrytis cinerea is expressed, but not essential, during penetration of gerbera and tomato. Mol. Plant-Microbe Interact. 1997, 10, 30–38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, P.; Binns, D.; Chang, H.Y.; Fraser, M.; Li, W.; McAnulla, C.; McWilliam, H.; Maslen, J.; Mitchell, A.; Nuka, G.; et al. InterProScan 5: Genome-scale protein function classification. Bioinformatics 2014, 30, 1236–1240. [Google Scholar] [CrossRef] [Green Version]
- Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [Green Version]
- Möller, S.; Croning, M.D.; Apweiler, R. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 2001, 17, 646–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pierleoni, A.; Martelli, P.; Casadio, R. PredGPI: A GPI-anchor predictor. BMC Bioinform. 2008, 9, 392. [Google Scholar] [CrossRef] [Green Version]
- Caccia, D.; Dugo, M.; Callari, M.; Bongarzone, I. Bioinformatics tools for secretome analysis. Biochim. Biophys. Acta (BBA) Proteins Proteom. 2013, 1834, 2442–2453. [Google Scholar] [CrossRef]
- Katoh, K.; Standley, D.M. A simple method to control over-alignment in the MAFFT multiple sequence alignment program. Bioinformatics 2016, 32, 1933–1942. [Google Scholar] [CrossRef]
- Mitchell, A.L.; Attwood, T.K.; Babbitt, P.C.; Blum, M.; Bork, P.; Bridge, A.; Brown, S.D.; Chang, H.Y.; El-Gebali, S.; Fraser, M.I.; et al. InterPro in 2019: Improving coverage, classification and access to protein sequence annotations. Nucleic Acids Res. 2019, 47, D351–D360. [Google Scholar] [CrossRef] [Green Version]
- Wilson, D.; Tutulan-Cunita, A.; Jung, W.; Hauser, N.C.; Hernandez, R.; Williamson, T.; Piekarska, K.; Rupp, S.; Young, T.; Stateva, L. Deletion of the high-affinity cAMP phosphodiesterase encoded by PDE2 affects stress responses and virulence in Candida albicans. Mol. Microbiol. 2007, 65, 841–856. [Google Scholar] [CrossRef]
- Elad, Y.; Köhl, J.; Fokkema, N.J. Control of infection and sporulation of Botrytis cinerea on bean and tomato by saprophytic bacteria and fungi. Eur. J. Plant Pathol. 1994, 100, 315–336. [Google Scholar] [CrossRef]
- Ren, H.; Wu, X.; Lyu, Y.; Zhou, H.; Xie, X.; Zhang, X.; Yang, H. Selection of reliable reference genes for gene expression studies in Botrytis cinerea. J. Microbiol. Methods 2017, 142, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Carisse, O. Epidemiology and Aerobiology of Botrytis spp. In Botrytis—The Fungus, The Pathogen and Its Management in Agricultural Systems; Fillinger, S., Elad, Y., Eds.; Springer: Cham, Switzerland, 2016; pp. 127–148. [Google Scholar] [CrossRef]
- Schamber, A.; Leroch, M.; Diwo, J.; Mendgen, K.; Hahn, M. The role of mitogen-activated protein (MAP) kinase signalling components and the Ste12 transcription factor in germination and pathogenicity of Botrytis cinerea. Mol. Plant Pathol. 2010, 11, 105–119. [Google Scholar] [CrossRef]
- Doehlemann, G.; Berndt, P.; Hahn, M. Different signalling pathways involving a Galpha protein, cAMP and a MAP kinase control germination of Botrytis cinerea conidia. Mol. Microbiol. 2006, 59, 821–835. [Google Scholar] [CrossRef] [PubMed]
- Schumacher, J.; Kokkelink, L.; Huesmann, C.; Jimenez-Teja, D.; Collado, I.G.; Barakat, R.; Tudzynski, P.; Tudzynski, B. The cAMP-dependent signaling pathway and its role in conidial germination, growth, and virulence of the gray mold Botrytis cinerea. Mol. Plant Microbe Interact. 2008, 21, 1443–1459. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leroch, M.; Mueller, N.; Hinsenkamp, I.; Hahn, M. The signalling mucin Msb2 regulates surface sensing and host penetration via BMP1 MAP kinase signalling in Botrytis cinerea. Mol. Plant Pathol. 2015, 16, 787–798. [Google Scholar] [CrossRef] [PubMed]
- Leroch, M.; Kleber, A.; Silva, E.; Coenen, T.; Koppenhofer, D.; Shmaryahu, A.; Valenzuela, P.D.; Hahn, M. Transcriptome profiling of Botrytis cinerea conidial germination reveals upregulation of infection-related genes during the prepenetration stage. Eukaryot. Cell 2013, 12, 614–626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pandaranayaka, E.P.; Frenkel, O.; Elad, Y.; Prusky, D.; Harel, A. Network analysis exposes core functions in major lifestyles of fungal and oomycete plant pathogens. BMC Genom. 2019, 20, 1020. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene ID (Ensembl) | TM 1 | Sub-Cellularlocations 2 | GPI Anchor Site Prediction [32] | Presence of Eight Cys Consensus Pattern | Contains Asp Aligned with Csa2′s Axial Asp | Final Location Prediction 3 | Potential Non-GPCR |
---|---|---|---|---|---|---|---|
Bcin05g02420 | 6 TM domains | PM | No | Yes | Yes | MP | Medium |
Bcin07g03260 s | 1 TM domain | PM | No | Yes | Yes | MP | Best |
Bcin15g02580 | 7–8 TM domain 4 | PM | No | Yes | Yes | MP | Worst |
Name of Primer (FP, Forward Primer; RP, Reverse Primer) | Purpose | Sequence (5′→3′) |
---|---|---|
P131FP | 5′ flank Integration | TACTGTGCAGTAGGTCGAGC |
P126 RP | 5′ flank Integration | CTTGCTTGACAAACGCACCA |
P124FP | 3′ flank Integration | CTCGGAGGGCGAAGAATCTC |
P138RP | 3′ flank Integration | GGGGAAGGTTTGGAAGGTGG |
BcActin FP | Positive control for PCR | TGCTCCAGAAGCTTTGTTCCAA |
BcActin RP | Positive control for PCR | TCGGAGATACCTGGGTACATAG |
CFEM RT FP | CFEM qRT-PCR | AAGAGGAGGATGTGGGGTCA |
CFEM RT RP | CFEM qRT-PCR | CTAGCACATCGACGTCCTCC |
BcUBQ RT FP | Control for qRT-PCR | CAAGGTTACCGACAACAATA |
BcUBQ RT RP | Control for qRT-PCR | GCATCCATCAACTTCTTCAA |
BcUCE RT FP | Control for qRT-PCR | ATCACCCAAACATCAACT |
BcUCE RT RP | Control for qRT-PCR | CATAGAGCAGATGGACAA |
CFEM 5′Flank (BamHI) FP | To amplify 5′ Flank | CGCGGATCCCCGTGCTGGAGCATGTTGGCAC |
CFEM 5′Flank (KpnI) RP | To amplify 5′ Flank | CGGGGTACCCCCCGGTCAGAATATGACATGG |
CFEM 3′Flank (MscI) FP | To amplify 3′ Flank | TCGCGATGGCCAACACCTCGAACTCCAACCAC |
CFEM 3′Flank (PstI) RP | To amplify 3′ Flank | AAAACTGCAGCAAACGCCACCATGATACAC |
Isolate | Average Colony Area cm2 ± SE (p Value, Student’s T-test Against W) | Conidiation per Plate (i.e., per 19.6 cm2) | ||
---|---|---|---|---|
24 hpi | 48 hpi | 72 hpi | 14 dpi | |
BO5 WT | 4.49 ± 1.54 | 15.72 ± 0.28 | 36.07 ± 0.29 | 42.8 ± 5.17 |
∆CFEM-T4 | 3.52 ± 1.58 (p ≤ 0.58) | 15.54 ± 3.02 (p ≤ 0.94) | 3 ± 0.25 (p ≤ 0.54) | 36.39 ± 3.34 (p ≤ 0.45) |
∆CFEM-T8 | 3.36 ± 1.90 (p ≤ 0.57) | 14.28 ± 3.14 (p ≤ 0.57) | 34.12 ± 3.82 (p ≤ 0.53) | 39.37 ± 7.73 (p ≤ 0.73) |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arya, G.C.; Srivastava, D.A.; Pandaranayaka, E.P.J.; Manasherova, E.; Prusky, D.B.; Elad, Y.; Frenkel, O.; Dvir, H.; Harel, A. Characterization of the Role of a Non-GPCR Membrane-Bound CFEM Protein in the Pathogenicity and Germination of Botrytis cinerea. Microorganisms 2020, 8, 1043. https://doi.org/10.3390/microorganisms8071043
Arya GC, Srivastava DA, Pandaranayaka EPJ, Manasherova E, Prusky DB, Elad Y, Frenkel O, Dvir H, Harel A. Characterization of the Role of a Non-GPCR Membrane-Bound CFEM Protein in the Pathogenicity and Germination of Botrytis cinerea. Microorganisms. 2020; 8(7):1043. https://doi.org/10.3390/microorganisms8071043
Chicago/Turabian StyleArya, Gulab Chand, Dhruv Aditya Srivastava, Eswari P. J. Pandaranayaka, Ekaterina Manasherova, Dov Bernard Prusky, Yigal Elad, Omer Frenkel, Hay Dvir, and Arye Harel. 2020. "Characterization of the Role of a Non-GPCR Membrane-Bound CFEM Protein in the Pathogenicity and Germination of Botrytis cinerea" Microorganisms 8, no. 7: 1043. https://doi.org/10.3390/microorganisms8071043