Rapid Microscopic Detection of Bacillus anthracis by Fluorescent Receptor Binding Proteins of Bacteriophages
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Culture and Inactivation
2.2. Spore Preparation
2.3. Isolation of DNA
2.4. Cloning of RBP-Fusion Constructs
2.5. Expression and Purification of Strep-Tagged mCherry-RBP Fusion Reporters
2.6. SDS-PAGE and Western Blot
2.7. RBP Testing for Binding to Host Cells
3. Results
3.1. Cloning of Phage RBP Genes and Production of Recombinant RBP-Fusion Reporters in E. coli
3.2. (Pro)-Phage RBP Bind to Bacillus anthracis Cells
3.3. Binding of (Pro)-Phage RBP to B. anthracis Cells Is Growth Phase Dependent
3.4. Inactivated Cells of B. anthracis Can Be Labeled With (Pro)-Phage RBP Reporters
3.5. Encapsulated Cells of Bacillus anthracis Can Be Labeled with (Pro)-Phage RBP Reporters
3.6. Binding of (Pro)-Phage RBP Is Specific to B. anthracis Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Patino-Navarrete, R.; Sanchis, V. Evolutionary processes and environmental factors underlying the genetic diversity and lifestyles of Bacillus cereus group bacteria. Res. Microbiol. 2017, 168, 309–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ash, C.; Farrow, J.A.; Dorsch, M.; Stackebrandt, E.; Collins, M.D. Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 1991, 41, 343–346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ehling-Schulz, M.; Fricker, M.; Grallert, H.; Rieck, P.; Wagner, M.; Scherer, S. Cereulide synthetase gene cluster from emetic Bacillus cereus: Structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1. BMC Microbiol. 2006, 6, 20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okinaka, R.T.; Cloud, K.; Hampton, O.; Hoffmaster, A.R.; Hill, K.K.; Keim, P.; Koehler, T.M.; Lamke, G.; Kumano, S.; Mahillon, J.; et al. Sequence and organization of pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 1999, 181, 6509–6515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wielinga, P.R.; Hamidjaja, R.A.; Agren, J.; Knutsson, R.; Segerman, B.; Fricker, M.; Ehling-Schulz, M.; de Groot, A.; Burton, J.; Brooks, T.; et al. A multiplex real-time PCR for identifying and differentiating B. anthracis virulent types. Int. J. Food. Microbiol. 2011, 145 (Suppl. 1), S137–S144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antwerpen, M.H.; Zimmermann, P.; Bewley, K.; Frangoulidis, D.; Meyer, H. Real-time PCR system targeting a chromosomal marker specific for Bacillus anthracis. Mol. Cell. Probes 2008, 22, 313–315. [Google Scholar] [CrossRef] [Scilit]
- Easterday, W.R.; Van Ert, M.N.; Simonson, T.S.; Wagner, D.M.; Kenefic, L.J.; Allender, C.J.; Keim, P. Use of single nucleotide polymorphisms in the plcR gene for specific identification of Bacillus anthracis. J. Clin. Microbiol. 2005, 43, 1995–1997. [Google Scholar] [CrossRef] [Scilit]
- Ellerbrok, H.; Nattermann, H.; Ozel, M.; Beutin, L.; Appel, B.; Pauli, G. Rapid and sensitive identification of pathogenic and apathogenic Bacillus anthracis by real-time PCR. FEMS Microbiol. Lett. 2002, 214, 51–59. [Google Scholar] [CrossRef]
- Ramisse, V.; Patra, G.; Garrigue, H.; Guesdon, J.L.; Mock, M. Identification and characterization of Bacillus anthracis by multiplex PCR analysis of sequences on plasmids pXO1 and pXO2 and chromosomal DNA. FEMS Microbiol. Lett. 1996, 145, 9–16. [Google Scholar] [CrossRef]
- Kozel, T.R.; Murphy, W.J.; Brandt, S.; Blazar, B.R.; Lovchik, J.A.; Thorkildson, P.; Percival, A.; Lyons, C.R. mAbs to Bacillus anthracis capsular antigen for immunoprotection in anthrax and detection of antigenemia. Proc. Natl. Acad. Sci. USA 2004, 101, 5042–5047. [Google Scholar] [CrossRef] [Scilit]
- Sastry, K.S.R.; Tuteja, U.; Santhosh, P.K.; Lalitha, M.K.; Batra, H.V. Identification of Bacillus anthracis by a simple protective antigen-specific mAb dot-ELISA. J. Med. Microbiol. 2003, 52, 47–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pauker, V.I.; Thoma, B.R.; Grass, G.; Bleichert, P.; Hanczaruk, M.; Zoller, L.; Zange, S. Improved discrimination of Bacillus anthracis from closely related species in the Bacillus cereus sensu lato group based on Matrix-Assisted Laser Desorption Ionization-Time of Flight mass spectrometry. J. Clin. Microbiol. 2018, 56, e01900-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunne, M.; Hupfeld, M.; Klumpp, J.; Loessner, M.J. Molecular basis of bacterial host interactions by Gram-positive targeting bacteriophages. Viruses 2018, 10, 397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Jonge, P.A.; Nobrega, F.L.; Brouns, S.J.J.; Dutilh, B.E. Molecular and evolutionary determinants of bacteriophage host range. Trends Microbiol. 2019, 27, 51–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolton, C.B.; Podnecky, N.L.; Shadomy, S.V.; Gee, J.E.; Hoffmaster, A.R. Bacillus anthracis gamma phage lysis among soil bacteria: An update on test specificity. BMC Res. Notes 2017, 10, 598. [Google Scholar] [CrossRef] [Scilit]
- Brown, E.R.; Cherry, W.B. Specific identification of Bacillus anthracis by means of a variant bacteriophage. J. Infect. Dis. 1955, 96, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Sozhamannan, S.; McKinstry, M.; Lentz, S.M.; Jalasvuori, M.; McAfee, F.; Smith, A.; Dabbs, J.; Ackermann, H.W.; Bamford, J.K.; Mateczun, A.; et al. Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity. Appl. Environ. Microbiol. 2008, 74, 6792–6796. [Google Scholar] [CrossRef] [Scilit]
- Kan, S.; Fornelos, N.; Schuch, R.; Fischetti, V.A. Identification of a ligand on the Wip1 bacteriophage highly specific for a receptor on Bacillus anthracis. J. Bacteriol. 2013, 195, 4355–4364. [Google Scholar] [CrossRef] [Scilit]
- Turnbull, P.C.; World Health Organization. Anthrax in Humans and Animals; Turnbull, P.C.B., Ed.; WHO Press: Geneva, Switzerland, 2008. [Google Scholar]
- Abshire, T.G.; Brown, J.E.; Ezzell, J.W. Production and validation of the use of gamma phage for identification of Bacillus anthracis. J. Clin. Microbiol. 2005, 43, 4780–4788. [Google Scholar] [CrossRef] [Scilit]
- Popovic, T.; Hoffmaster, A.; Ezzell, J.W.; Abshire, T.G.; Brown, J.E. Validation of methods for confirmatory identification of presumptive isolates of Bacillus anthracis. J. AOAC Int. 2005, 88, 175–177. [Google Scholar] [CrossRef] [Scilit]
- Schuch, R.; Pelzek, A.J.; Kan, S.; Fischetti, V.A. Prevalence of Bacillus anthracis-like organisms and bacteriophages in the intestinal tract of the earthworm Eisenia fetida. Appl. Environ. Microbiol. 2010, 76, 2286–2294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagy, E. A highly specific phage attacking Bacillus anthracis strain Sterne. Acta Microbiol. Acad. Sci. Hung. 1974, 21, 257–263. [Google Scholar] [PubMed]
- Sozhamannan, S.; Chute, M.D.; McAfee, F.D.; Fouts, D.E.; Akmal, A.; Galloway, D.R.; Mateczun, A.; Baillie, L.W.; Read, T.D. The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages. BMC Microbiol. 2006, 6, 34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dowah, A.S.A.; Clokie, M.R.J. Review of the nature, diversity and structure of bacteriophage receptor binding proteins that target Gram-positive bacteria. Biophys. Rev. 2018, 10, 535–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuch, R.; Fischetti, V.A. Detailed genomic analysis of the Wß and ß phages infecting Bacillus anthracis: Implications for evolution of environmental fitness and antibiotic resistance. J. Bacteriol. 2006, 188, 3037–3051. [Google Scholar] [CrossRef] [Scilit]
- Mitraki, A.; Miller, S.; van Raaij, M.J. Review: Conformation and folding of novel beta-structural elements in viral fiber proteins: The triple beta-spiral and triple beta-helix. J. Struct. Biol. 2002, 137, 236–247. [Google Scholar] [CrossRef] [Scilit]
- Simpson, D.J.; Sacher, J.C.; Szymanski, C.M. Development of an assay for the Identification of receptor binding proteins from bacteriophages. Viruses 2016, 8, 17. [Google Scholar] [CrossRef] [Scilit]
- Davison, S.; Couture-Tosi, E.; Candela, T.; Mock, M.; Fouet, A. Identification of the Bacillus anthracis (gamma) phage receptor. J. Bacteriol. 2005, 187, 6742–6749. [Google Scholar] [CrossRef] [Scilit]
- Bishop-Lilly, K.A.; Plaut, R.D.; Chen, P.E.; Akmal, A.; Willner, K.M.; Butani, A.; Dorsey, S.; Mokashi, V.; Mateczun, A.J.; Chapman, C.; et al. Whole genome sequencing of phage resistant Bacillus anthracis mutants reveals an essential role for cell surface anchoring protein CsaB in phage AP50c adsorption. Virol. J. 2012, 9, 246. [Google Scholar] [CrossRef] [Scilit]
- Plaut, R.D.; Beaber, J.W.; Zemansky, J.; Kaur, A.P.; George, M.; Biswas, B.; Henry, M.; Bishop-Lilly, K.A.; Mokashi, V.; Hannah, R.M.; et al. Genetic evidence for the involvement of the S-layer protein gene sap and the sporulation genes spo0A, spo0B, and spo0F in phage AP50c infection of Bacillus anthracis. J. Bacteriol. 2014, 196, 1143–1154. [Google Scholar] [CrossRef] [Scilit]
- Braun, P.; Grass, G.; Aceti, A.; Serrecchia, L.; Affuso, A.; Marino, L.; Grimaldi, S.; Pagano, S.; Hanczaruk, M.; Georgi, E.; et al. Microevolution of anthrax from a young ancestor (M.A.Y.A.) suggests a soil-borne life cycle of Bacillus anthracis. PLoS ONE 2015, 10, e0135346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cote, C.K.; Buhr, T.; Bernhards, C.B.; Bohmke, M.D.; Calm, A.M.; Esteban-Trexler, J.S.; Hunter, M.; Katoski, S.E.; Kennihan, N.; Klimko, C.P.; et al. A standard method to inactivate Bacillus anthracis spores to sterility via gamma irradiation. Appl. Environ. Microbiol. 2018, 84, e00106-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malvar, T.; Gawron-Burke, C.; Baum, J.A. Overexpression of Bacillus thuringiensis HknA, a histidine protein kinase homology, bypasses early Spo mutations that result in CryIIIA overproduction. J. Bacteriol. 1994, 176, 4742–4749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaner, N.C.; Campbell, R.E.; Steinbach, P.A.; Giepmans, B.N.; Palmer, A.E.; Tsien, R.Y. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol. 2004, 22, 1567–1572. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Van Ert, M.N.; Easterday, W.R.; Huynh, L.Y.; Okinaka, R.T.; Hugh-Jones, M.E.; Ravel, J.; Zanecki, S.R.; Pearson, T.; Simonson, T.S.; U’Ren, J.M.; et al. Global genetic population structure of Bacillus anthracis. PLoS ONE 2007, 2, e461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Walper, S.A.; Anderson, G.P.; Brozozog Lee, P.A.; Glaven, R.H.; Liu, J.L.; Bernstein, R.D.; Zabetakis, D.; Johnson, L.; Czarnecki, J.M.; Goldman, E.R. Rugged single domain antibody detection elements for Bacillus anthracis spores and vegetative cells. PLoS ONE 2012, 7, e32801. [Google Scholar] [CrossRef] [Scilit]
- Ramage, J.G.; Prentice, K.W.; DePalma, L.; Venkateswaran, K.S.; Chivukula, S.; Chapman, C.; Bell, M.; Datta, S.; Singh, A.; Hoffmaster, A.; et al. Comprehensive laboratory evaluation of a highly specific lateral flow assay for the presumptive identification of Bacillus anthracis spores in suspicious white powders and environmental samples. Health Secur. 2016, 14, 351–365. [Google Scholar] [CrossRef] [Scilit]
- Kolton, C.B.; Marston, C.K.; Stoddard, R.A.; Cossaboom, C.; Salzer, J.S.; Kozel, T.R.; Gates-Hollingsworth, M.A.; Cleveland, C.A.; Thompson, A.T.; Dalton, M.F.; et al. Detection of Bacillus anthracis in animal tissues using InBios active anthrax detect rapid test lateral flow immunoassay. Lett. Appl. Microbiol. 2019, 68, 480–484. [Google Scholar] [CrossRef] [Scilit]
- De, B.K.; Bragg, S.L.; Sanden, G.N.; Wilson, K.E.; Diem, L.A.; Marston, C.K.; Hoffmaster, A.R.; Barnett, G.A.; Weyant, R.S.; Abshire, T.G.; et al. A two-component direct fluorescent-antibody assay for rapid identification of Bacillus anthracis. Emerg. Infect. Dis. 2002, 8, 1060–1065. [Google Scholar] [CrossRef] [Scilit]
- Zasada, A.A. Detection and identification of Bacillus anthracis: From conventional to molecular microbiology methods. Microorganisms 2020, 8, 125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dams, D.; Brondsted, L.; Drulis-Kawa, Z.; Briers, Y. Engineering of receptor-binding proteins in bacteriophages and phage tail-like bacteriocins. Biochem. Soc. Trans. 2019, 47, 449–460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A.; Arutyunov, D.; Szymanski, C.M.; Evoy, S. Bacteriophage based probes for pathogen detection. Analyst 2012, 137, 3405–3421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sumrall, E.T.; Rohrig, C.; Hupfeld, M.; Selvakumar, L.; Du, J.; Dunne, M.; Schmelcher, M.; Shen, Y.; Loessner, M.J. Glycotyping and specific separation of Listeria monocytogenes with a novel bacteriophage protein toolkit. Appl. Environ. Microbiol. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carroll, L.M.; Wiedmann, M.; Kovac, J. Proposal of a taxonomic nomenclature for the Bacillus cereus group which reconciles genomic definitions of bacterial species with clinical and industrial phenotypes. MBio 2020, 11, e00034-20. [Google Scholar] [CrossRef] [Scilit]
- Marston, C.K.; Gee, J.E.; Popovic, T.; Hoffmaster, A.R. Molecular approaches to identify and differentiate Bacillus anthracis from phenotypically similar Bacillus species isolates. BMC Microbiol. 2006, 6, 22. [Google Scholar] [CrossRef] [Scilit]
- Han, C.S.; Xie, G.; Challacombe, J.F.; Altherr, M.R.; Bhotika, S.S.; Bruce, D.; Campbell, C.S.; Campbell, M.L.; Chen, J.; Chertkov, O.; et al. Pathogenomic sequence analysis of Bacillus cereus and Bacillus thuringiensis isolates closely related to Bacillus anthracis. J. Bacteriol. 2006, 188, 3382–3390. [Google Scholar] [CrossRef] [Scilit]
- Kern, V.J.; Kern, J.W.; Theriot, J.A.; Schneewind, O.; Missiakas, D. Surface-Layer (S-Layer) proteins Sap and EA1 govern the binding of the S-layer-associated protein BslO at the cell septa of Bacillus anthracis. J. Bacteriol. 2012, 194, 3833–3840. [Google Scholar] [CrossRef] [Scilit]
- Mignot, T.; Mesnage, S.; Couture-Tosi, E.; Mock, M.; Fouet, A. Developmental switch of S-layer protein synthesis in Bacillus anthracis. Mol. Microbiol. 2002, 43, 1615–1627. [Google Scholar] [CrossRef] [Scilit]
- Berjon-Otero, M.; Lechuga, A.; Mehla, J.; Uetz, P.; Salas, M.; Redrejo-Rodriguez, M. Bam35 tectivirus intraviral interaction map unveils new function and localization of phage ORFan proteins. J. Virol. 2017, 91, e00870-17. [Google Scholar] [CrossRef] [Scilit]
- Gaidelyte, A.; Cvirkaite-Krupovic, V.; Daugelavicius, R.; Bamford, J.K.; Bamford, D.H. The entry mechanism of membrane-containing phage Bam35 infecting Bacillus thuringiensis. J. Bacteriol. 2006, 188, 5925–5934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schuch, R.; Nelson, D.; Fischetti, V.A. A bacteriolytic agent that detects and kills Bacillus anthracis. Nature 2002, 418, 884–889. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schmelcher, M.; Donovan, D.M.; Loessner, M.J. Bacteriophage endolysins as novel antimicrobials. Future Microbiol. 2012, 7, 1147–1171. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujinami, Y.; Hirai, Y.; Sakai, I.; Yoshino, M.; Yasuda, J. Sensitive detection of Bacillus anthracis using a binding protein originating from gamma-phage. Microbiol. Immunol. 2007, 51, 163–169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sainathrao, S.; Mohan, K.V.; Atreya, C. Gamma-phage lysin PlyG sequence-based synthetic peptides coupled with Qdot-nanocrystals are useful for developing detection methods for Bacillus anthracis by using its surrogates, B. anthracis-Sterne and B. cereus-4342. BMC Biotechnol. 2009, 9, 67. [Google Scholar] [CrossRef] [Scilit]
- Reiman, R.W.; Atchley, D.H.; Voorhees, K.J. Indirect detection of Bacillus anthracis using real-time PCR to detect amplified gamma phage DNA. J. Microbiol. Methods 2007, 68, 651–653. [Google Scholar] [CrossRef] [Scilit]
- Malagon, F.; Estrella, L.A.; Stockelman, M.G.; Hamilton, T.; Teneza-Mora, N.; Biswas, B. Phage-mediated molecular detection (PMMD): A novel rapid method for phage-specific bacterial detection. Viruses 2020, 12, 435. [Google Scholar] [CrossRef] [Scilit]
- Kong, M.; Shin, J.H.; Heu, S.; Park, J.K.; Ryu, S. Lateral flow assay-based bacterial detection using engineered cell wall binding domains of a phage endolysin. Biosens. Bioelectron. 2017, 96, 173–177. [Google Scholar] [CrossRef] [Scilit]







| Oligonucleotide | Sequence (5′–3′) |
|---|---|
| BA4079 forward | AAACTCGAGATGAGTTCTTTTTCATTTAATGGGGAAC |
| BA4079 reverse | AAACGTACGTCTGTATCTCTCCCTATAACTGATTGTTG |
| BA4079λ03Δ1-120 forward | AAACTCGAGATGAGTTCTTTTTCATTTAATGGGGAAC |
| gp14 forward | AAACTCGAGTTGGGGAAACTTAGTTTTACTTTTAATAATATTAG |
| gp14 reverse | AAACGTACGTCTATATCTCTCCCTATAACTGATTGTTGC |
| p23 forward | AAACTCGAGATGGGACTTAAGAAACCTGCGG |
| p23 reverse | AAACGTACGTTCATAAGCAACCCACGGTTG |
| p23+p24 reverse | AAACGTACGCATTCCTCCTAGTAATATATCGTTAATTGCAC |
| p28 forward | AAACTCGAGATGGGACTGAAAAAACCTAGCGG |
| p28 reverse | AAACGTACGGAATGGTTTTTCCGCTTCCTCTTTTAC |
| p28+p29 reverse | AAACGTACGCATTCCTCCTAATAGAATATCGTTAATTGTAC |
| mCherry forward | AGCGCGTCTCCAATGGTCGACGGTGAATTCGGCTGTACAGTTAGTAAAGGAGAAGAAAATAACATGGC |
| mCherry reverse | AGCGCGTCTCCTCCCCGTACGGCCCTGCAGACCCTCGAGTTTGTATAGTTCATCCATGCCACCAG |
| Cultures of Peracetic Acid-Inactivated B. anthracis Strains RG-3 (RG-2) | Phylogenetic Group | RBPAP50 | RBPλ03Δ1-120 | RBPWip |
|---|---|---|---|---|
| (CDC 1014) | A.Br.WNA | +++ | +++ | +++ |
| (Sterne 34F2) | A.Br.001/002 | +++ | +++ | +++ |
| Vollum | A.Br.Vollum | ++ | +++ | ++ |
| 188678-1 | A.Br.Aust94 | +++ | +++ | +++ |
| Ames | A.Br.Ames | +++ | +++ | +++ |
| A0777 | A.Br.WNA | ++ | +++ | +++ |
| BF-1 | B.Br.CNEVA | ++ | +++ | ++ |
| SA020 | B.Br.Kruger | ++ | +++ | ++ |
| A1074 | C.Br. | + | ++ | + |
| Species Strain | RBPAP50 | RBPλ03Δ1-120 | RBPWip |
|---|---|---|---|
| B. anthracis Sterne 34F2 | +++ | +++ | +++ |
| B. anthracis A1074 | + | ++ | + |
| B. cereus 3094 | + | ++ | + |
| B. cereus 2700, 3093 | + | −* | + |
| B. cereus ATCC 706, ATCC 4342 2, ATCC 10987, DSM 2302, 2832 | − | + | – |
| B. cereus ATCC 312 | − | −* | − |
| B. cereus ATCC 14579, ATCC 2787, ATCC 3301, DSM 345, 288, 1356, 2690, 2698, 2815, 2830, 2856, 2866, 2868, 2892, 2893, 2894, 2895, 2896, 2897, 2899, 2900, 2901, 2902, 2903, 2904, 2905, 3045, 3068, 3080, 3090, 3092, 3095, 3096, 3097, 3098, 3109 | − | − | − |
| B. thuringiensis ATCC 10792, DSM 2046 | − | + | + |
| B. thuringiensis ATCC 336, ATCC 33679 | − | −* | − |
| B. thuringiensis Berliner 1915, sv. Tolworthi | − | − | − |
| B. paranthracis 2002 | − | ++ | − |
| B. weihenstephanensis B0293 | − | ++ | − |
| B. mycoides NCTC 2603, B 732 | − | − | − |
| B. megaterium ATCC 14581, MS941 | − | − | − |
| B. subtilis ATCC 6091 | − | − | − |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Braun, P.; Wolfschläger, I.; Reetz, L.; Bachstein, L.; Jacinto, A.C.; Tocantins, C.; Poppe, J.; Grass, G. Rapid Microscopic Detection of Bacillus anthracis by Fluorescent Receptor Binding Proteins of Bacteriophages. Microorganisms 2020, 8, 934. https://doi.org/10.3390/microorganisms8060934
Braun P, Wolfschläger I, Reetz L, Bachstein L, Jacinto AC, Tocantins C, Poppe J, Grass G. Rapid Microscopic Detection of Bacillus anthracis by Fluorescent Receptor Binding Proteins of Bacteriophages. Microorganisms. 2020; 8(6):934. https://doi.org/10.3390/microorganisms8060934
Chicago/Turabian StyleBraun, Peter, Immanuel Wolfschläger, Leonie Reetz, Lilia Bachstein, Ana Clara Jacinto, Carolina Tocantins, Johannes Poppe, and Gregor Grass. 2020. "Rapid Microscopic Detection of Bacillus anthracis by Fluorescent Receptor Binding Proteins of Bacteriophages" Microorganisms 8, no. 6: 934. https://doi.org/10.3390/microorganisms8060934
APA StyleBraun, P., Wolfschläger, I., Reetz, L., Bachstein, L., Jacinto, A. C., Tocantins, C., Poppe, J., & Grass, G. (2020). Rapid Microscopic Detection of Bacillus anthracis by Fluorescent Receptor Binding Proteins of Bacteriophages. Microorganisms, 8(6), 934. https://doi.org/10.3390/microorganisms8060934

