Assessment of ISO Method 15216 to Quantify Hepatitis E Virus in Bottled Water
Abstract
:1. Introduction
2. Materials and Methods
2.1. Virus Strains
2.2. Detection Limit and Efficiency of the Procedure to Concentrate HEV in Bottled Water according to ISO 15216-1:2017
2.3. RNA Extraction and RT-qPCR Assays
2.4. Statistical Analysis
3. Results and Discussion
Limit of Detection and Efficiency of HEV Concentration Procedure in Bottled Water Based on ISO 15216-1:2017
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Wang, Y.; Zhao, C.; Qi, Y.; Geng, Y. Hepatitis E virus. In Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2016; Volume 948, pp. 1–16. [Google Scholar]
- World Health Orgnization. Waterborne Outbreaks of Hepatitis E: Recognition, Investigation and Control; World Health Orgnization: Geneva, Switzerland, 2014; ISBN 9789-2415-07608. [Google Scholar]
- Ricci, A.; Allende, A.; Bolton, D.; Chemaly, M.; Davies, R.; Fernandez Escamez, P.S.; Herman, L.; Koutsoumanis, K.; Lindqvist, R.; Nørrung, B.; et al. Public health risks associated with hepatitis E virus (HEV) as a food-borne pathogen. EFSA J. 2017, 15, e04886. [Google Scholar]
- Fenaux, H.; Chassaing, M.; Berger, S.; Gantzer, C.; Bertrand, I.; Schvoerer, E. Transmission of hepatitis E virus by water: An issue still pending in industrialized countries. Water Res. 2019, 151, 144–157. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Li, C.; Hagedorn, C.H. Phylogenetic analysis of global hepatitis E virus sequences: Genetic diversity, subtypes and zoonosis. Rev. Med. Virol. 2006, 16, 5–36. [Google Scholar] [CrossRef] [PubMed]
- Ruggeri, F.M.; Di Bartolo, I.; Ostanello, F.; Trevisani, M. Hepatitis E Virus: An Emerging Zoonotic and Foodborne Pathogen; Springer: Amsterdam, The Netherlands, 2013; pp. 1–88. [Google Scholar]
- Van der Poel, W. Food and environmental routes of Hepatitis E virus transmission. Curr. Opin. Virol. 2014, 4, 91–96. [Google Scholar] [CrossRef] [PubMed]
- Van der Poel, W.; Rzezutka, A.; Hepatitis, E. Global Water Pathogen Project; Meschke, J.S., Girones, R., Eds.; Michigan State University: East Lansing, Michigan, 2019. [Google Scholar]
- Boccia, D.; Guthmann, J.-P.; Klovstad, H.; Hamid, N.; Tatay, M.; Ciglenecki, I.; Nizou, J.-Y.; Nicand, E.; Guerin, P.J. High Mortality Associated with an Outbreak of Hepatitis E among Displaced Persons in Darfur, Sudan. Clin. Infect. Dis. 2006, 42, 1679–1684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guerrero-Latorre, L.; Carratala, A.; Rodriguez-Manzano, J.; Calgua, B.; Hundesa, A.; Girones, R. Occurrence of water-borne enteric viruses in two settlements based in Eastern Chad: Analysis of hepatitis E virus, hepatitis A virus and human adenovirus in water sources. J. Water Health 2011, 9, 515–524. [Google Scholar] [CrossRef] [PubMed]
- UNHCR UNHCR steps up measures to rein in Hepatitis E among South Sudanese refugees in Ethiopia. Available online: https://www.unhcr.org/news/ (accessed on 12 May 2020).
- Givens, C.E.; Kolpin, D.W.; Borchardt, M.A.; Duris, J.W.; Moorman, T.B.; Spencer, S.K. Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams. Sci. Total Environ. 2016, 566–567, 1042–1051. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Girones, R.; Carratalà, A.; Calgua, B.; Calvo, M.; Rodriguez-Manzano, J.; Emerson, S. Chlorine inactivation of hepatitis e virus and human adenovirus 2 in water. J. Water Health 2014, 12, 436–442. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guerrero-Latorre, L.; Gonzales-Gustavson, E.; Hundesa, A.; Sommer, R.; Rosina, G. UV disinfection and flocculation-chlorination sachets to reduce hepatitis E virus in drinking water. Int. J. Hyg. Environ. Health 2016, 219, 405–411. [Google Scholar] [CrossRef] [PubMed]
- ISO 15216-1. ISO 15216-1:2017—Microbiology of the Food Chain—Horizontal Method for Determination of Hepatitis A Virus and Norovirus Using Real-Time RT-PCR—Part 1: Method for Quantification; ISO: Geneva, Switzerland, 2017. [Google Scholar]
- Lowther, J.A.; Bosch, A.; Butot, S.; Ollivier, J.; Mäde, D.; Rutjes, S.A.; Hardouin, G.; Lombard, B.; In’t Veld, P.; Leclercq, A. Validation of EN ISO method 15216—Part 1—Quantification of hepatitis A virus and norovirus in food matrices. Int. J. Food Microbiol. 2019, 288, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Bronzwaer, S.; Kass, G.; Robinson, T.; Tarazona, J.; Verhagen, H.; Verloo, D.; Vrbos, D.; Hugas, M. Food Safety Regulatory Research Needs 2030. EFSA J. 2019, 17, e170622. [Google Scholar]
- Baylis, S.A.; Sakata, H.; Okada, Y.; Mizusawa, S.; Hanschmann, K.-M.O.; Nübling, C.M.; Matsubayashi, K.; Blümel, J.; Mizusawa, S.; Matsubayashi, K.; et al. World Health Organization International Standard to Harmonize Assays for Detection of Hepatitis E Virus RNA. Emerg. Infect. Dis. 2013, 19, 729–735. [Google Scholar] [CrossRef] [PubMed]
- Gerba, C.P.; Betancourt, W.Q.; Kitajima, M.; Rock, C.M. Reducing uncertainty in estimating virus reduction by advanced water treatment processes. Water Res. 2018, 133, 282–288. [Google Scholar] [CrossRef] [PubMed]
- Schlosser, J.; Eiden, M.; Vina-Rodriguez, A.; Fast, C.; Dremsek, P.; Lange, E.; Ulrich, R.G.; Groschup, M.H. Natural and experimental hepatitis E virus genotype 3-infection in European wild boar is transmissible to domestic pigs. Vet. Res. 2014, 45, 121. [Google Scholar] [CrossRef]
- Jothikumar, N.; Cromeans, T.L.; Robertson, B.H.; Meng, X.J.; Hill, V.R. A broadly reactive one-step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J. Virol. Methods 2006, 131, 65–71. [Google Scholar] [CrossRef]
- Girón-Callejas, A.; Clark, G.; Irving, W.L.; McClure, C.P. In silico and in vitro interrogation of a widely used HEV RT-qPCR assay for detection of the species Orthohepevirus A. J. Virol. Methods 2015, 214, 25–28. [Google Scholar] [CrossRef] [PubMed]
- Randazzo, W.; Vásquez-García, A.; Bracho, M.A.; Alcaraz, M.J.; Aznar, R.; Sánchez, G. Hepatitis E virus in lettuce and water samples: A method-comparison study. Int. J. Food Microbiol. 2018, 277, 34–40. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wilrich, C.; Wilrich, P.-T. Estimation of the POD function and the LOD of a qualitative microbiological measurement method. J. AOAC Int. 2009, 92, 1763–1772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuevas-Ferrando, E.; Randazzo, W.; Pérez-Cataluña, A.; Sánchez, G. HEV Occurrence in Waste and Drinking Water Treatment Plants. Front. Microbiol. 2020, 10, 2937. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.B.; Simmonds, P.; Izopet, J.; Oliveira-Filho, E.F.; Ulrich, R.G.; Johne, R.; Koenig, M.; Jameel, S.; Harrison, T.J.; Meng, X.-J.; et al. Proposed reference sequences for hepatitis E virus subtypes. J. Gen. Virol. 2016, 97, 537–542. [Google Scholar] [CrossRef] [PubMed]
Assay | Amplification Region | Primers and Probe | Sequence 5’-3’ | RT-qPCR Conditions | Location * | Reference |
---|---|---|---|---|---|---|
RT-qPCR1 | ORF3 | HEV.Fa | GTGCCGGCGGTGGTTTC | RT 50 °C for 30’ | 5296–5377 (81 nt) | [20] |
Hev.Fb | GTGCCGGCGGTGGTTTCTG | 95 °C for 15’ | ||||
HEV.R | GCGAAGGGGTTGGTTGGATG | PCR (45x) | ||||
HEV.P | FAM-TGACMGGGT/ZEN/TGATTCTCAGCC/3IABkFQ | 95 °C for 10’’ | ||||
55 °C for 20’’ | ||||||
72 °C for 15’’ | ||||||
RT-qPCR2 | ORF3 | N/A | N/A | RT 45 °C for 10’ | N/A | Ceeram (hepatitis@ceeramTools) |
95 °C for 10’ | ||||||
PCR (40x) | ||||||
95 °C for 15’’ | ||||||
60 °C for 45’’ | ||||||
RT-qPCR3 | ORF3 | JVHEVF | GGTGGTTTCTGGGGTGAC | RT 50 °C for 30’ | 5304–5373 (69 nt) | [21,22] |
JVHEVRmod | AGGGGTTGGTTGGRTGRA | 95 °C for 2’ | ||||
JVHEVPmod | TGATTCTCAGCCCTTCGC | PCR (45x) | ||||
95 °C for 15’’ | ||||||
60 °C for 40’’ |
Extraction Method | RT-qPCR | Levels of Inoculated HEV (IU/L) | LoD95%a (IU/L) | ||
---|---|---|---|---|---|
1 × 105 | 1 × 104 | 1 × 103 | |||
MN | RT-qPCR1 | 4/4 b | 4/4 | 0/4 | 1.25 × 104 |
RT-qPCR2 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
RT-qPCR3 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
NS | RT-qPCR1 | 4/4 | 4/4 | 2/4 | 4.26 × 103 |
RT-qPCR2 | 4/4 | 4/4 | 0/4 | 1.25 × 104 | |
RT-qPCR3 | 4/4 | 4/4 | 0/4 | 1.25 × 104 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cuevas-Ferrando, E.; Martínez-Murcia, A.; Pérez-Cataluña, A.; Sánchez, G.; Randazzo, W. Assessment of ISO Method 15216 to Quantify Hepatitis E Virus in Bottled Water. Microorganisms 2020, 8, 730. https://doi.org/10.3390/microorganisms8050730
Cuevas-Ferrando E, Martínez-Murcia A, Pérez-Cataluña A, Sánchez G, Randazzo W. Assessment of ISO Method 15216 to Quantify Hepatitis E Virus in Bottled Water. Microorganisms. 2020; 8(5):730. https://doi.org/10.3390/microorganisms8050730
Chicago/Turabian StyleCuevas-Ferrando, Enric, Antonio Martínez-Murcia, Alba Pérez-Cataluña, Gloria Sánchez, and Walter Randazzo. 2020. "Assessment of ISO Method 15216 to Quantify Hepatitis E Virus in Bottled Water" Microorganisms 8, no. 5: 730. https://doi.org/10.3390/microorganisms8050730
APA StyleCuevas-Ferrando, E., Martínez-Murcia, A., Pérez-Cataluña, A., Sánchez, G., & Randazzo, W. (2020). Assessment of ISO Method 15216 to Quantify Hepatitis E Virus in Bottled Water. Microorganisms, 8(5), 730. https://doi.org/10.3390/microorganisms8050730