An Intranuclear Sodalis-Like Symbiont and Spiroplasma Coinfect the Carrot Psyllid, Bactericera trigonica (Hemiptera, Psylloidea)
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Collection and Culture
2.2. PCR-RFLP and Denaturing Gradient Gel Electrophoresis (DGGE) of 16S rDNA
2.3. Prevalence of Symbionts in Field Collected B. trigonica
2.4. Relative Quantification of Symbionts in CLso-Infected/Uninfected Psyllids
2.5. Fluorescent in Situ Hybridization (FISH) and Immunostaining for Bacteria Localization
2.6. Immunolocalization of Sodalis and CLso
2.7. Sequencing and Genome Assembly of the Sodalis-Like Symbiont
3. Results
3.1. Identification and Prevalence of Symbionts Associated with B. Trigonica
3.2. Relative Quantification of Symbionts in CLso-Infected/Uninfected Psyllids
3.3. Tissue Localization of Sodalis, Spiroplasma and CLso within B. trigonica
3.4. Sequence of the Sodalis-Like Endosymbiont of Bactericera trigonica
4. Discussion
- Sodalis draft genome - GCA_003668825.1
- Sodalis 16S rDNA - MH973240, MH973241
- Sodalis partial GroEL - MH987777
- Spiroplasma 16S rDNA - MH973257
- CLso 16S rDNA - MH986752
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Moran, N.A.; Baumann, P. Bacterial endosymbionts in animals. Curr. Opin. Microbiol. 2000, 3, 270–275. [Google Scholar] [CrossRef]
- Baumann, P. Biology of bacteriocyte-associated endosymbionts of plant sap-sucking insects. Annu. Rev. Microbiol. 2005, 59, 155–189. [Google Scholar] [CrossRef] [PubMed]
- Wilson, A.C.C.; Duncan, R.P. Signatures of host/symbiont genome coevolution in insect nutritional endosymbioses. Proc. Natl. Acad. Sci. USA 2015, 112, 10255–10261. [Google Scholar] [CrossRef] [PubMed]
- Baumann, P.; Moran, N.A.; Baumann, L.; Dworkin, M. Bacteriocyte-associated endosymbionts of insects. Prokaryotes 2006, 1, 403–438. [Google Scholar]
- Montllor, C.B.; Maxmen, A.; Purcell, A.H. Facultative bacterial endosymbionts benefit pea aphids Acyrthosiphon pisum under heat stress. Ecol. Entomol. 2002, 27, 189–195. [Google Scholar] [CrossRef]
- Brumin, M.; Kontsedalov, S.; Ghanim, M. Rickettsia influences thermotolerance in the whitefly Bemisia tabaci B biotype. Insect Sci. 2011, 18, 57–66. [Google Scholar] [CrossRef]
- Łukasik, P.; Guo, H.; Asch, M.; Ferrari, J.; Godfray, H.C.J. Protection against a fungal pathogen conferred by the aphid facultative endosymbionts Rickettsia and Spiroplasma is expressed in multiple host genotypes and species and is not influenced by co-infection with another symbiont. J. Evol. Biol. 2013, 26, 2654–2661. [Google Scholar] [CrossRef]
- Hendry, T.A.; Hunter, M.S.; Baltrus, D.A. The Facultative Symbiont Rickettsia Protects an Invasive Whitefly against Entomopathogenic Pseudomonas syringae Strains. Appl. Environ. Microbiol. 2014, 80, 7161–7168. [Google Scholar] [CrossRef]
- Oliver, K.M.; Russell, J.A.; Moran, N.A.; Hunter, M.S. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl. Acad. Sci. 2003, 100, 1803–1807. [Google Scholar] [CrossRef]
- Kontsedalov, S.; Zchori-Fein, E.; Chiel, E.; Gottlieb, Y.; Inbar, M.; Ghanim, M. The presence of Rickettsia is associated with increased susceptibility of Bemisia tabaci (Homoptera: Aleyrodidae) to insecticides. Pest Manag. Sci. 2008, 64, 789–792. [Google Scholar] [CrossRef]
- Himler, A.G.; Adachi-Hagimori, T.; Bergen, J.E.; Kozuch, A.; Kelly, S.E.; Tabashnik, B.E.; Chiel, E.; Duckworth, V.E.; Dennehy, T.J.; Zchori-Fein, E.; et al. Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias. Science 2011, 332, 254–256. [Google Scholar] [CrossRef] [PubMed]
- Gottlieb, Y.; Zchori-Fein, E.; Mozes-Daube, N.; Kontsedalov, S.; Skaljac, M.; Brumin, M.; Sobol, I.; Czosnek, H.; Vavre, F.; Fleury, F. The transmission efficiency of tomato yellow leaf curl virus by the whitefly Bemisia tabaci is correlated with the presence of a specific symbiotic bacterium species. J. Virol. 2010, 84, 9310–9317. [Google Scholar] [CrossRef] [PubMed]
- Kliot, A.; Cilia, M.; Czosnek, H.; Ghanim, M. Implication of the bacterial endosymbiont Rickettsia spp. in interactions of the whitefly Bemisia tabaci with Tomato yellow leaf curl virus. J. Virol. 2014, 88, 5652–5660. [Google Scholar] [CrossRef] [PubMed]
- Thao, M.L.; Clark, M.A.; Baumann, L.; Brennan, E.B.; Moran, N.A.; Baumann, P. Secondary endosymbionts of psyllids have been acquired multiple times. Curr. Microbiol. 2000, 41, 300–304. [Google Scholar] [CrossRef] [PubMed]
- Nakabachi, A.; Ueoka, R.; Oshima, K.; Teta, R.; Mangoni, A.; Gurgui, M.; Oldham, N.J.; van Echten-Deckert, G.; Okamura, K.; Yamamoto, K. Defensive bacteriome symbiont with a drastically reduced genome. Curr. Biol. 2013, 23, 478–1484. [Google Scholar] [CrossRef] [PubMed]
- Subandiyah, S.; Nikoh, N.; Tsuyumu, S.; Somowiyarjo, S.; Fukatsu, T. Complex endosymbiotic microbiota of the citrus psyllid Diaphorina citri (Homoptera: Psylloidea). Zoolog. Sci. 2000, 17, 983–989. [Google Scholar] [CrossRef]
- Spaulding, A.W.; von Dohlen, C.D. Psyllid endosymbionts exhibit patterns of co-speciation with hosts and destabilizing substitutions in ribosomal RNA. Insect Mol. Biol. 2001, 10, 57–67. [Google Scholar] [CrossRef]
- Arp, A.; Munyaneza, J.E.; Crosslin, J.M.; Trumble, J.; Bextine, B. A global comparison of Bactericera cockerelli (Hemiptera: Triozidae) microbial communities. Environ. Entomol. 2014, 43, 344–352. [Google Scholar] [CrossRef]
- Antolínez, C.A.; Fereres, A.; Moreno, A. Sex-specific probing behaviour of the carrot psyllid Bactericera trigonica and its implication in the transmission of ‘Candidatus Liberibacter solanacearum’. Eur. J. Plant Pathol. 2017, 147, 627–637. [Google Scholar]
- Antolinez, C.A.; Fereres, A.; Moreno, A. Risk assessment of ‘Candidatus Liberibacter solanacearum’transmission by the psyllids Bactericera trigonica and B. tremblayi from Apiaceae crops to potato. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef]
- Ghanim, M.; Achor, D.; Ghosh, S.; Kontsedalov, S.; Lebedev, G.; Levy, A. ‘Candidatus Liberibacter asiaticus’ Accumulates inside Endoplasmic Reticulum Associated Vacuoles in the Gut Cells of Diaphorina citri. Sci. Rep. 2017, 7, 16945. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Jassar, O.; Kontsedalov, S.; Lebedev, G.; Wang, C.; Donielle, T.; Levi, A.; Ghanim, M. A transcriptomics approach reveals putative interaction of Candidatus Liberibacter solanacearum with the Endoplasmic Reticulum of its psyllid vector. Insects 2019, 10, 279. [Google Scholar] [CrossRef] [PubMed]
- Mawassi, M.; Dror, O.; Bar-Joseph, M.; Piasetzky, A.; Sjölund, J.; Levitzky, N.; Shoshana, N.; Meslenin, L.; Haviv, S.; Porat, C. ’Candidatus Liberibacter solanacearum’ is Tightly Associated with Carrot Yellows Symptoms in Israel and Transmitted by the Prevalent Psyllid Vector Bactericera trigonica. Phytopathology 2018, 108, 1056–1066. [Google Scholar] [CrossRef] [PubMed]
- Van den Heuvel, J.F.; Bruyere, A.; Hogenhout, S.A.; Ziegler-Graff, V.; Brault, V.; Verbeek, M.; Van Der Wilk, F.; Richards, K. The N-terminal region of the luteovirus readthrough domain determines virus binding to Buchnera GroEL and is essential for virus persistence in the aphid. J. Virol. 1997, 71, 7258–7265. [Google Scholar] [CrossRef]
- Walker, T.; Johnson, P.H.; Moreira, L.A.; Iturbe-Ormaetxe, I.; Frentiu, F.D.; McMeniman, C.J.; Leong, Y.S.; Dong, Y.; Axford, J.; Kriesner, P. The wMel Wolbachia strain blocks dengue and invades caged Aedes aegypti populations. Nature 2011, 476, 450–453. [Google Scholar] [CrossRef]
- McMeniman, C.J.; O’Neill, S.L. A virulent Wolbachia infection decreases the viability of the dengue vector Aedes aegypti during periods of embryonic quiescence. PLoS Negl. Trop Dis. 2010, 4, e748. [Google Scholar] [CrossRef]
- Ghosh, S.; Sela, N.; Ghanim, M. Complete Genome Sequence of a Putative Densovirus Infecting the Carrot Psyllid Bactericera trigonica. Microbiol. Resour. Announc. 2019. [Google Scholar] [CrossRef]
- Shahjahan, R.; Hughes, K.; Leopold, R.; Devault, J. Lower incubation temperatures increase yield of insect genomic DNA isolated by the CTAB method. Biotechniques 1995, 19, 332–334. [Google Scholar]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef]
- Ishii, K.; Takii, S. Comparison of microbial communities in four different composting processes as evaluated by denaturing gradient gel electrophoresis analysis. J. Appl. Microbiol. 2003, 95, 109–119. [Google Scholar] [CrossRef]
- Greuter, D.; Loy, A.; Horn, M.; Rattei, T. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016. Nucleic. Acids Res. 2016, 44, D586–D589. [Google Scholar] [CrossRef] [PubMed]
- Ghanim, M.; Fattah-Hosseini, S.; Levy, A.; Cilia, M. Morphological abnormalities and cell death in the Asian citrus psyllid (Diaphorina citri) midgut associated with Candidatus Liberibacter asiaticus. Sci. Rep. 2016, 6, 33418. [Google Scholar] [CrossRef] [PubMed]
- Rose, C.; Belmonte, R.; Armstrong, S.D.; Molyneux, G.; Haines, L.R.; Lehane, M.J.; Wastling, J.; Acosta-Serrano, A. An investigation into the protein composition of the teneral Glossina morsitans morsitans peritrophic matrix. PLoS Negl. Trop Dis. 2014, 8, e2691. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Tritt, A.; Eisen, J.A.; Facciotti, M.T.; Darling, A.E. An integrated pipeline for de novo assembly of microbial genomes. PLoS ONE 2012, 7, e42304. [Google Scholar] [CrossRef]
- Lu, C.L.; Chen, K.-T.; Huang, S.-Y.; Chiu, H.-T. CAR: contig assembly of prokaryotic draft genomes using rearrangements. BMC Bioinform. 2014, 15, 381. [Google Scholar] [CrossRef]
- Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M. The RAST Server: rapid annotations using subsystems technology. BMC Genom. 2008, 9, 75. [Google Scholar] [CrossRef]
- Emms, D.M.; Kelly, S. OrthoFinder: solving fundamental biases in whole genome comparisons dramatically improves orthogroup inference accuracy. Genome Biol. 2015, 16, 157. [Google Scholar] [CrossRef]
- Guindon, S.; Dufayard, J.-F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef]
- Dale, C.; Maudlin, I. Sodalis gen. nov. and Sodalis glossinidius sp. nov., a microaerophilic secondary endosymbiont of the tsetse fly Glossina morsitans morsitans. Int. J. Syst. Evol. Microbiol. 1999, 49, 267–275. [Google Scholar] [CrossRef]
- Toju, H.; Tanabe, A.S.; Notsu, Y.; Sota, T.; Fukatsu, T. Diversification of endosymbiosis: replacements, co-speciation and promiscuity of bacteriocyte symbionts in weevils. ISME J. 2013, 7, 1378. [Google Scholar] [CrossRef] [PubMed]
- Hosokawa, T.; Kaiwa, N.; Matsuura, Y.; Kikuchi, Y.; Fukatsu, T. Infection prevalence of Sodalis symbionts among stinkbugs. Zool. Lett. 2015, 1, 5. [Google Scholar] [CrossRef] [PubMed]
- Grünwald, S.; Pilhofer, M.; Höll, W. Microbial associations in gut systems of wood-and bark-inhabiting longhorned beetles [Coleoptera: Cerambycidae]. Syst. Appl. Microbiol. 2010, 33, 25–34. [Google Scholar] [CrossRef] [PubMed]
- Burke, G.R.; Normark, B.B.; Favret, C.; Moran, N.A. Evolution and diversity of facultative symbionts from the aphid subfamily Lachninae. Appl. Environ Microbiol. 2009, 75, 5328–5335. [Google Scholar] [CrossRef]
- Nováková, E.; Husník, F.; Šochová, E.; Hypša, V. Arsenophonus and Sodalis symbionts in louse flies: an analogy to the Wigglesworthia and Sodalis system in tsetse flies. Appl. Environ. Microbiol. 2015, 81, 6189–6199. [Google Scholar]
- Matthew, C.Z.; Darby, A.C.; Young, S.A.; Hume, L.H.; Welburn, S.C. The rapid isolation and growth dynamics of the tsetse symbiont Sodalis glossinidius. FEMS Microbiol. Lett. 2005, 248, 69–74. [Google Scholar] [CrossRef]
- Clayton, A.L.; Oakeson, K.F.; Gutin, M.; Pontes, A.; Dunn, D.M.; von Niederhausern, A.C.; Weiss, R.B.; Fisher, M.; Dale, C. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect–bacterial symbioses. PLoS Genet. 2012, 8, e1002990. [Google Scholar] [CrossRef]
- Jiggins, F.M.; Hurst, G.D.D.; Jiggins, C.D.; vd Schulenburg, J.H.G.; Majerus, M.E.N. The butterfly Danaus chrysippus is infected by a male-killing Spiroplasma bacterium. Parasitology 2000, 120, 439–446. [Google Scholar] [CrossRef]
- Pinheiro, P.V.; Wilson, J.R.; Xu, Y.; Zheng, Y.; Rebelo, A.R.; Fattah-Hosseini, S.; Kruse, A.; Dos Silva, R.S.; Xu, Y.; Kramer, M. Plant Viruses Transmitted in Two Different Modes Produce Differing Effects on Small RNA-Mediated Processes in Their Aphid Vector. Phytobiomes J. 2019, 3, 71–81. [Google Scholar] [CrossRef]
- Parry, R.; Bishop, C.; De Hayr, L.; Asgari, S. Density-dependent enhanced replication of a densovirus in Wolbachia-infected Aedes cells is associated with production of piRNAs and higher virus-derived siRNAs. Virology 2019, 528, 89–100. [Google Scholar] [CrossRef]
- Schulz, F.; Horn, M. Intranuclear bacteria: inside the cellular control center of eukaryotes. Trends Cell. Biol. 2015, 25, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Perotti, M.A.; Clarke, H.K.; Turner, B.D.; Braig, H.R. Rickettsia as obligate and mycetomic bacteria. FASEB J. 2006, 20, 2372–2374. [Google Scholar] [CrossRef] [PubMed]
- Kuechler, S.M.; Gibbs, G.; Burckhardt, D.; Dettner, K.; Hartung, V. Diversity of bacterial endosymbionts and bacteria–host co-evolution in Gondwanan relict moss bugs (Hemiptera: Coleorrhyncha: Peloridiidae). Environ. Microbiol. 2013, 15, 2031–2042. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, K.; Yukuhiro, F.; Matsuura, Y.; Fukatsu, T.; Noda, H. Intrasperm vertical symbiont transmission. Proc. Natl. Acad. Sci. USA 2014, 111, 7433–7437. [Google Scholar] [CrossRef] [PubMed]
- Bierne, H.; Cossart, P. When bacteria target the nucleus: The emerging family of nucleomodulins. Cell Microbiol. 2012, 14, 622–633. [Google Scholar] [CrossRef] [PubMed]
- Welburn, S.C.; Arnold, K.; Maudlin, I.; Gooday, G.W. Rickettsia-like organisms and chitinase production in relation to transmission of trypanosomes by tsetse flies. Parasitology 1993, 107, 141–145. [Google Scholar] [CrossRef]
- O’brochta, D.A.; Handler, A.M. Perspectives on the state of insect transgenics. In Transgenesis and the Management of Vector-Borne Diseas; Springer: New York, NY, USA, 2008; pp. 1–18. [Google Scholar]
- De Vooght, L.; Caljon, G.; Stijlemans, B.; De Baetselier, P.; Coosemans, M.; Van Den Abbeele, J. Expression and extracellular release of a functional anti-trypanosome Nanobody® in Sodalis glossinidius, a bacterial symbiont of the tsetse fly. Microb. Cell Fact. 2012, 11, 23. [Google Scholar] [CrossRef]
- De Vooght, L.; Caljon, G.; De Ridder, K.; Van Den Abbeele, J. Delivery of a functional anti-trypanosome nanobody in different tsetse fly tissues via a bacterial symbiont, Sodalis glossinidius. Microb. Cell Fact. 2014, 13, 156. [Google Scholar] [CrossRef]
Primer | Target | Sequence (5′-3′) | Product Size |
---|---|---|---|
Actin-F Actin-R | B. trigonica actin gene | AGATGACCCAGATCATGTTTGA AGGGCGTAACCTTCATAGATG | 160 bp |
Lso-F Lso-R | CLso omp A gene | CCATATCCAAATTTCAAAGAACC ATGCCACGTGAAGGTTTGAT | 152 bp |
Sod-F1 Sod-qR2 | Sodalis GroEL gene | CCAAAGACGGCGTATCAGTT GCCTTCGTTGACGATAGACT | 160 bp |
Spir-F Spir-R | Spiroplasma 16S rDNA | CTGCCTCATGGCAACACTTA TTTCATGTGTAGCGGTGGAA | 170 bp |
Denso-qF Denso-qR | BtDNV VP4 gene | CACCGAGAACACGCACTTTG GACCAAAACTCTGGAGGGCA | 149 bp |
Probe | Target | Sequence (5′ -3′) | Reference |
Carsonella | 16S rDNA | Cy3-CGCGACATAGCTGGATCAAG | [31] (pB-1664) |
CLso | 16S rDNA | Cy3-GCCTCGCGACTTCGCAACCAAT | This study |
Sodalis | 16S rDNA | Cy3/Cy5-GTTACCCGCAGAAGAAGCAC | This study |
Spiroplasma | 16S rDNA | Cy5-TTTCATGTGTAGGGGTGGAA | This study |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ghosh, S.; Sela, N.; Kontsedalov, S.; Lebedev, G.; Haines, L.R.; Ghanim, M. An Intranuclear Sodalis-Like Symbiont and Spiroplasma Coinfect the Carrot Psyllid, Bactericera trigonica (Hemiptera, Psylloidea). Microorganisms 2020, 8, 692. https://doi.org/10.3390/microorganisms8050692
Ghosh S, Sela N, Kontsedalov S, Lebedev G, Haines LR, Ghanim M. An Intranuclear Sodalis-Like Symbiont and Spiroplasma Coinfect the Carrot Psyllid, Bactericera trigonica (Hemiptera, Psylloidea). Microorganisms. 2020; 8(5):692. https://doi.org/10.3390/microorganisms8050692
Chicago/Turabian StyleGhosh, Saptarshi, Noa Sela, Svetlana Kontsedalov, Galina Lebedev, Lee R. Haines, and Murad Ghanim. 2020. "An Intranuclear Sodalis-Like Symbiont and Spiroplasma Coinfect the Carrot Psyllid, Bactericera trigonica (Hemiptera, Psylloidea)" Microorganisms 8, no. 5: 692. https://doi.org/10.3390/microorganisms8050692
APA StyleGhosh, S., Sela, N., Kontsedalov, S., Lebedev, G., Haines, L. R., & Ghanim, M. (2020). An Intranuclear Sodalis-Like Symbiont and Spiroplasma Coinfect the Carrot Psyllid, Bactericera trigonica (Hemiptera, Psylloidea). Microorganisms, 8(5), 692. https://doi.org/10.3390/microorganisms8050692