Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Design and Location
2.3. Selection of Farms
Development of Good Practice Farm
2.4. Sample Collection and Processing
2.5. Isolation, Identification and Molecular Detection
2.5.1. Culture and Biochemical Tests
2.5.2. Molecular Detection
2.6. Antimicrobial Susceptibility Test
2.7. Data Management and Statistical Evaluation
3. Results
3.1. Occurrence of Campylobacter spp.
3.2. Molecular Detection by Polymerase Chain Reaction (PCR)
3.3. Antimicrobial Susceptibility Test
3.4. Antimicrobial Resistance Pattern
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Kabir, S.M.L.; Kikuchi, K.; Asakura, M.; Shiramaru, S.; Tsuruoka, N.; Goto, A.; Hinenoya, A.; Yamasaki, S. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from diarrheal patients in Japan. Jpn. J. Infect. Dis. 2011, 64, 19–27. [Google Scholar] [PubMed]
- Shane, S. Campylobacter infection of commercial poultry. Rev. Sci. Tech. Off. Int. Epiz. 2000, 19, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Sahin, O.; Morishita, T.Y.; Zhang, Q. Campylobacter colonization in poultry: Sources of infection and modes of transmission. Anim. Health Res. Rev. 2002, 3, 95–105. [Google Scholar] [CrossRef] [PubMed]
- Kaakoush, N.O.; Castaño-Rodríguez, N.; Mitchell, H.M.; Man, S.M. Global epidemiology of Campylobacter infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef]
- European Food Safety Authority and European Centre for Disease Prevention and Control. EU Summary Report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2016. EFSA J. 2017, 12, e05077. [Google Scholar] [CrossRef]
- Hansson, I.; Sandberg, M.; Habib, I.; Lowman, R.; Engvall, E. Knowledge gaps in control of Campylobacter for prevention of campylobacteriosis. Transbound. Emerg. Dis. 2018, 65 (Suppl. 1), 30–48. [Google Scholar] [CrossRef]
- Nyati, K.K.; Nyati, R. Role of Campylobacter jejuni infection in the pathogenesis of Guillain-Barré syndrome: An update. BioMed Res. Int. 2013, 2013, 852195. [Google Scholar] [CrossRef]
- Skarp, C.; Hänninen, M.-L.; Rautelin, H. Campylobacteriosis: The role of poultry meat. Clin. Microbiol. Infect. 2016, 22, 103–109. [Google Scholar] [CrossRef]
- European Food Safety Authority (EFSA). Analysis of the baseline survey on the prevalence of Campylobacter in broiler batches and of Campylobacter and Salmonella on broiler carcasses, in the EU, 2008—Part B: Analysis of factors associated with Campylobacter colonisation of broiler batches and with Campylobacter contamination of broiler carcasses; and investigation of the culture method diagnostic characteristics used to analyse broiler carcass samples. EFSA J. 2010, 8. [Google Scholar] [CrossRef]
- Ridley, A.; Morris, V.; Gittins, J.; Cawthraw, S.; Harris, J.; Edge, S.; Allen, V. Potential sources of Campylobacter infection on chicken farms: Contamination and control of broiler-harvesting equipment, vehicles and personnel. J. Appl. Microbiol. 2011, 111, 233–244. [Google Scholar] [CrossRef]
- Agyare, C.; Boamah, V.E.; Zumbi, C.N.; Osei, F.B. Antibiotic Use in Poultry Production and Its Effects on Bacterial Resistance. In Antimicrobial Resistance-A Global Threat; IntechOpen: Rijeka, Croatia, 2018; Available online: https://www.intechopen.com/books/antimicrobial-resistance-a-global-threat/antibiotic-use-in-poultry-production-and-its-effects-on-bacterial-resistance (accessed on 11 November 2020).
- Iovine, N.M.; Blaser, M.J. Antibiotics in animal feed and spread of resistant Campylobacter from poultry to humans. Emerg. Infect. Dis. 2004, 10, 1158–1159. [Google Scholar] [CrossRef] [PubMed]
- Kabir, S.M.L.; Sumon, M.; Amin, M.M.; Yamasaki, S. Isolation, identification and antimicrobial resistance patterns of Campylobacter species from broiler meat sold at KR Market of Bangladesh Agricultural University Campus, Mymensingh. J. Agric. Food Technol. 2014, 4, 15–21. [Google Scholar]
- Englen, M.D.; Ladely, S.R.; Fedorka-Cray, P.J. Isolation of Campylobacter and Identification by PCR. In PCR Detection of Microbial Pathogens; Springer: Berlin/Heidelberg, Germany, 2003; pp. 109–121. [Google Scholar]
- Fraser, R.W.; Williams, N.T.; Powell, L.F.; Cook, A.J.C. Reducing Campylobacter and salmonella infection: Two studies of the economic cost and attitude to adoption of on-farm biosecurity measures. Zoonoses Public Health 2010, 57, e109–e115. [Google Scholar] [CrossRef] [PubMed]
- Yap, T. Guidelines on Improving Food Safety in Poultry Value Chain in Bangladesh; Department of Livestock Services (DLS) & Food and Agriculture Organization, Food Safety Program (FAO-FSP): Dhaka, Bangladesh, 2015. [Google Scholar]
- Dolberg, F. Poultry Sector Country Review, Bangladesh. 2008. Available online: http://www.fao.org/3/a-ak069e.pdf (accessed on 29 September 2020).
- Kabir, S.M.L.; Islam, J.; Suman, M.H.; Khan, M.S.R.; Yamasaki, S. Isolation, identification and antimicrobial susceptibility profiles of Campylobacter species with assessment of their risk factors in broiler flocks of Bangladesh Agricultural University Poultry Farm. J. Basic Appl. Sci. Res. 2014, 4, 160–168. [Google Scholar]
- Islam, M.K.; Kabir, S.M.L.; Haque, A.K.M.Z.; Sarker, Y.A.; Sikder, M.H. Molecular detection and characterization of Escherichia coli, Salmonella spp. and Campylobacter spp. isolated from broiler meat in Jamalpur, Tangail, Netrokona and Kishoreganj districts of Bangladesh. Afr. J. Microbiol. Res. 2018, 12, 761–770. [Google Scholar] [CrossRef][Green Version]
- Hasan, M.M.; Talukder, S.; Mandal, A.K.; Tasmim, S.T.; Parvin, M.S.; Ali, M.Y.; Sikder, M.H.; Islam, M.T. Prevalence and risk factors of Campylobacter infection in broiler and cockerel flocks in Mymensingh and Gazipur districts of Bangladesh. Prev. Vet. Med. 2020, 180, 105034. [Google Scholar] [CrossRef]
- Neogi, S.B.; Islam, M.M.; Islam, S.K.S.; Akhter, A.H.M.T.; Sikder, M.M.H.; Yamasaki, S.; Kabir, S.M.L. Risk of multi-drug resistant Campylobacter spp. and residual antimicrobials at poultry farms and live bird markets in Bangladesh. BMC Infect. Dis. 2020, 20, 278. [Google Scholar] [CrossRef]
- Shiramaru, S.; Asakura, M.; Inoue, H.; Nagita, A.; Matsuhisa, A.; Yamasaki, S. A cytolethal distending toxin gene-based multiplex PCR assay for detection of Campylobacter spp. in stool specimens and comparison with culture method. J. Vet. Med. Sci. 2012, 74, 857–862. [Google Scholar] [CrossRef]
- Jamshidi, A.; Bassami, M.; Farkhondeh, T. Isolation and identification of Campylobacter spp. and Campylobacter coli from poultry carcasses by conventional culture method and multiplex PCR in Mashhad, Iran. Iran. J. Vet. Res. 2008, 9, 132–137. [Google Scholar]
- Nachamkin, I. Campylobacter and Arcobacter. In Manual of Clinical Microbiology; Murray, P.R., Baron, E.J., Jorgensen, J.H., Pfaller, M.A., Yolken, R.H., Eds.; American Society for Microbiology: Washington, DC, USA, 2003; pp. 902–914. [Google Scholar]
- Hoshino, K.; Yamasaki, S.; Mukhopadhyay, A.K.; Chakraborty, S.; Basu, A.; Bhattacharya, S.K.; Nair, G.B.; Shimada, T.; Takeda, Y. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139. FEMS Immunol. Med. Microbiol. 1998, 20, 201–207. [Google Scholar] [CrossRef]
- Samosornsuk, W.; Asakura, M.; Yoshida, E.; Taguchi, T.; Nishimura, K.; Eampokalap, B.; Phongsisay, V.; Chaicumpa, W.; Yamasaki, S. Evaluation of a cytolethal distending toxin (cdt) gene-based species-specific multiplex PCR assay for the identification of Campylobacter strains isolated from poultry in Thailand. Microbiol. Immunol. 2007, 51, 909–917. [Google Scholar] [CrossRef] [PubMed]
- Linton, D.; Lawson, A.; Owen, R.; Stanley, J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J. Clin. Microbiol. 1997, 35, 2568–2572. [Google Scholar] [CrossRef] [PubMed]
- Asakura, M.; Samosornsuk, W.; Taguchi, M.; Kobayashi, K.; Misawa, N.; Kusumoto, M.; Nishimura, K.; Matsuhisa, A.; Yamasaki, S. Comparative analysis of cytolethal distending toxin (cdt) genes among Campylobacter jejuni, C. coli and C. fetus strains. Microb. Pathog. 2007, 42, 174–183. [Google Scholar] [CrossRef] [PubMed]
- Luangtongkum, T.; Morishita, T.Y.; El-Tayeb, A.B.; Ison, A.J.; Zhang, Q. Comparison of antimicrobial susceptibility testing of Campylobacter spp. by the agar dilution and the agar disk diffusion methods. J. Clin. Microbiol. 2007, 45, 590–594. [Google Scholar] [CrossRef] [PubMed]
- Clinical & Laboratory Standards Institute (CLSI). Performance Standards for Antimicrobial Susceptibility Testing, 26th ed.; CLSI Supplement M100S: Wayne, PA, USA, 2016; pp. 1–256. [Google Scholar]
- Centers for Disease Control and Prevention (CDC). Epi Info™ 7. User Guide. Available online: https://www.cdc.gov/epiinfo/support/userguide.html (accessed on 29 September 2020).
- Livestock Economy at a Glance 2019, 20. Department of Livestock Services, Ministry of Fisheries and Livestock, Government of the People’s Republic of Bangladesh. 2020. Available online: http://dls.portal.gov.bd/sites/default/files/files/dls.portal.gov.bd/page/ee5f4621_fa3a_40ac_8bd9_898fb8ee4700/2020-07-22-19-34-e4cd5ed65f45419ee038e00b8939c1a0.pdf (accessed on 29 September 2020).
- Hamid, M.; Rahman, M.; Ahmed, S.; Hossain, K. Status of poultry industry in Bangladesh and the role of private sector for its development. Asian J. Poult. Sci. 2017, 11, 1–13. [Google Scholar] [CrossRef]
- Rahman, M.A.; Rahman, M.M.; Moonmoon, M.; Alam, K.J.; Islam, M.Z. Prevalence of common diseases of broiler and layer at Gazipur district in Bangladesh. Asian J. Med. Biol. Res. 2017, 3, 290–293. [Google Scholar] [CrossRef]
- Malik, H.; Kumar, A.; Rajagunalan, S.; Kataria, J.; Sachan, S. Prevalence of Campylobacter jejuni and Campylobacter coli among broilers in Bareilly region. Vet. World 2014, 7. [Google Scholar] [CrossRef]
- Nisar, M.; Mushtaq, M.H.; Shehzad, W.; Hussain, A.; Nasar, M.; Nagaraja, K.V.; Goyal, S.M. Occurrence of Campylobacter in retail meat in Lahore, Pakistan. Acta Trop. 2018, 185, 42–45. [Google Scholar] [CrossRef]
- Hussain, I.; Mahmood, M.S.; Akhtar, M.; Khan, A. Prevalence of Campylobacter species in meat, milk and other food commodities in Pakistan. Food Microbiol. 2007, 24, 219–222. [Google Scholar] [CrossRef]
- Kottawatta, K.S.; Van Bergen, M.A.; Abeynayake, P.; Wagenaar, J.A.; Veldman, K.T.; Kalupahana, R.S. Campylobacter in broiler chicken and broiler meat in Sri Lanka: Influence of semi-automated vs. wet market processing on Campylobacter contamination of broiler neck skin samples. Foods 2017, 6, 105. [Google Scholar] [CrossRef]
- Stern, N.; Cox, N.; Bailey, J.; Berrang, M.; Musgrove, M. Comparison of mucosal competitive exclusion and competitive exclusion treatment to reduce Salmonella and Campylobacter spp. colonization in broiler chickens. Poult. Sci. 2001, 80, 156–160. [Google Scholar] [CrossRef] [PubMed]
- Maćkiw, E.; Korsak, D.; Rzewuska, K.; Tomczuk, K.; Rożynek, E. Antibiotic resistance in Campylobacter jejuni and Campylobacter coli isolated from food in Poland. Food Control 2012, 23, 297–301. [Google Scholar] [CrossRef]
- Zhu, J.; Yao, B.; Song, X.; Wang, Y.; Cui, S.; Xu, H.; Yang, B.; Huang, J.; Liu, G.; Yang, X. Prevalence and quantification of Campylobacter contamination on raw chicken carcasses for retail sale in China. Food Control 2017, 75, 196–202. [Google Scholar] [CrossRef]
- Vindigni, S.M.; Srijan, A.; Wongstitwilairoong, B.; Marcus, R.; Meek, J.; Riley, P.L.; Mason, C. Prevalence of foodborne microorganisms in retail foods in Thailand. Foodborne Pathog. Dis. 2007, 4, 208–215. [Google Scholar] [CrossRef]
- Huong, L.Q.; Hanh, T.T.; Cam, P.D.; Be, N.T. Study on the prevalence of Campylobacter spp. from chicken meat in Hanoi, Vietnam. Ann. N. Y. Acad. Sci. 2006, 1081, 273–275. [Google Scholar] [CrossRef]
- Lay, K.S.; Vuthy, Y.; Song, P.; Phol, K.; Sarthou, J.L. Prevalence, numbers and antimicrobial susceptibilities of Salmonella serovars and Campylobacter spp. in retail poultry in Phnom Penh, Cambodia. J. Vet. Med. Sci. 2011, 73, 325–329. [Google Scholar] [CrossRef]
- Coates, D.; Hutchinson, D.; Bolton, F. Survival of thermophilic Campylobacters on fingertips and their elimination by washing and disinfection. Epidemiol. Infect. 1987, 99, 265–274. [Google Scholar] [CrossRef]
- Griffiths, P.; Park, R. Campylobacters associated with human diarrhoeal disease. J. Appl. Bacteriol. 1990, 69, 281–301. [Google Scholar] [CrossRef]
- United Nations Children’s Emergency Fund (UNICEF). Evaluation of Avian Influenza Communication for Development Initiative—Improving Biosecurity in Live Bird Markets: Lessons Learned Report; United Nations Children’s Emergency Fund (UNICEF): Dhaka, Bangladesh, 2013; Available online: https://www.unicef.org/cbsc/files/Avian_Campaign_Eval-Bangladesh-2014.pdf (accessed on 30 September 2020).
- Nasreen, S.; Khan, S.U.; Luby, S.P.; Gurley, E.S.; Abedin, J.; Zaman, R.U.; Sohel, B.M.; Rahman, M.; Hancock, K.; Levine, M.Z. Highly pathogenic avian influenza A (H5N1) virus infection among workers at live bird markets, Bangladesh, 2009–2010. Emerg. Infect. Dis. 2015, 21, 629–637. [Google Scholar] [CrossRef]
- Smith, S.; Messam, L.L.M.; Meade, J.; Gibbons, J.; McGill, K.; Bolton, D.; Whyte, P. The impact of biosecurity and partial depopulation on Campylobacter prevalence in Irish broiler flocks with differing levels of hygiene and economic performance. Infect. Ecol. Epidemiol. 2016, 6, 1. [Google Scholar] [CrossRef]
- Battersby, T.; Whyte, P.; Bolton, D. The pattern of Campylobacter contamination on broiler farms; external and internal sources. J. Appl. Microbiol. 2016, 120, 1108–1118. [Google Scholar] [CrossRef] [PubMed]
- Newell, D.; Fearnley, C. Sources of Campylobacter colonization in broiler chickens. Appl. Environ. Microbiol. 2003, 69, 4343–4351. [Google Scholar] [CrossRef] [PubMed]
- Ratananakorn, L.; Wilson, D. Zoning and compartmentalisation as risk mitigation measures: An example from poultry production. Rev. Sci. Tech. 2011, 30, 297–307. [Google Scholar] [CrossRef] [PubMed]
- Mridha, D.; Uddin, M.N.; Alam, B.; Akhter, A.H.M.T.; Islam, S.S.; Islam, S.; Khan, M.S.R.; Kabir, S.M.L. Identification and characterization of Salmonella spp. from samples of broiler farms in selected districts of Bangladesh. Vet. World 2020, 13, 275–283. [Google Scholar] [CrossRef]
- Perdoncini, G.; Sierra-Arguello, Y.M.; Lima, L.M.; Trindade, M.M.; Gomes, M.J.P.; Santos, L.R.D.; Schmidt, V.; Nascimento, V.P.D. Occurrence of Campylobacter jejuni and C. coli on broiler carcasses after chilling in southern Brazil. Pesqui. Vet. Bras. 2015, 35, 349–352. [Google Scholar] [CrossRef]
- Zhang, T.; Luo, Q.; Chen, Y.; Li, T.; Wen, G.; Zhang, R.; Luo, L.; Lu, Q.; Ai, D.; Wang, H. Molecular epidemiology, virulence determinants and antimicrobial resistance of Campylobacter spreading in retail chicken meat in Central China. Gut Pathog. 2016, 8, 48. [Google Scholar] [CrossRef]
- Padungtod, P.; Kaneene, J.B. Campylobacter in food animals and humans in northern Thailand. J. Food Prot. 2005, 68, 2519–2526. [Google Scholar] [CrossRef]
- Animal Feed. Act. Department of Livestock Services, Ministry of Fisheries and Livestock, Government of the Peoples’ Republic of Bangladesh. 2010; pp. 1–9. Available online: https://mofl.gov.bd/sites/default/files/files/mofl.portal.gov.bd/law/61eacebb_edf0_483c_a09f_f9c2fa5de36b/Animal%20Feed%20rule-2013.pdf (accessed on 11 November 2020).
- Singer, R.S.; Finch, R.; Wegener, H.C.; Bywater, R.; Walters, J.; Lipsitch, M. Antibiotic resistance—The interplay between antibiotic use in animals and human beings. Lancet Infect. Dis. 2003, 3, 47–51. [Google Scholar] [CrossRef]
- Babapour, A.; Azami, L.; Fartashmehr, J. Overview of antibiotic residues in beef and mutton in Ardebil, North West of Iran. World Appl. Sci. J. 2012, 19, 1417–1422. [Google Scholar] [CrossRef]
- Moyane, J.; Jideani, A.; Aiyegoro, O. Antibiotics usage in food-producing animals in South Africa and impact on human: Antibiotic resistance. Afr. J. Microbiol. Res. 2013, 7, 2990–2997. [Google Scholar] [CrossRef]
- Guetiya Wadoum, R.E.; Zambou, N.F.; Anyangwe, F.F.; Njimou, J.R.; Coman, M.M.; Verdenelli, M.C.; Cecchini, C.; Silvi, S.; Orpianesi, C.; Cresci, A. Abusive use of antibiotics in poultry farming in Cameroon and the public health implications. Br. Poult. Sci. 2016, 57, 483–493. [Google Scholar] [CrossRef] [PubMed]



| Key Control Measures | Areas of Intervention |
|---|---|
| Protect poultry flock with good biosecurity practices | Perimeter fencing, netting at poultry sheds; poultry trucks & cages are cleaned & disinfected before entry into farm; footwear are cleaned and disinfected before entry and provision of quarantine facilities for suspected/possibly infected poultry. |
| Use safe production inputs that free of biological hazards | Commercial day-old-chicks or pullets reliable sources; veterinary health certificate for free from infectious diseases e.g., Salmonella, Campylobacter etc, and with certificate of origin, and water are free of biological hazards e.g., Salmonella, Campylobacter. |
| Apply good animal husbandry practices (part of good agriculture practices) | Vaccination against poultry diseases; age group separation e.g., buffer zones of >30 m, and practice all-in-all-out, appropriate stocking density (1.6 to 2.0 sq.ft./bird depending on size of broiler); use probiotics for preventing the pathogens; veterinary inspection before selling on good health status, and keep proper records and documentation of farm. |
| Practice good personal hygiene | Ensure workers’ health, wash hands after visiting toilet and handling live poultry or poultry waste, and before entering poultry sheds; use PPE (boots & gloves) when working in poultry sheds or cleaning poultry sheds; workers who are sick, with cuts or wounds or immunologically compromised should not work in the farm. |
| Practice good poultry waste management and environmental control (part of good agriculture practices) | Good poultry waste management (bury poultry waste with lime, compost), good pest control, Keep farm environment clean with good drainage in the farm and free from disused equipment and construction material in the farm. |
| Primers | Sequence (5′-3′) | Target Gene | Amplicon Size (bp) | PCR Condition (30 Cycle) | Reference | ||
|---|---|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | |||||
| 16S9F 16S1540R | GAGTTTGATCCTGGCTC AAGGAGGTGATCCAGCC | 16S rRNA | 1530 | 94 °C, 30 s | 47 °C, 30 s | 72 °C, 90 s | [26] |
| HIP400F HIP1134R | GAAGAGGGTTTGGGTGGTG AGCTAGCTTCGCATAATAACTTG | hipO gene | 735 | 94 °C, 30 s | 55 °C, 30 s | 72 °C, 45 s | [27] |
| CjspAU2 CjspAR2 | AGGACTTGAACCTACTTTTC AGGTGGAGTAGTTAAAAACC | Cj cdtA | 631 | 94 °C, 30 s | 53 °C, 30 s | 72 °C, 30 s | [28] |
| CcspAU1 CcspAR1 | ATTGCCAAGGCTAAAATCTC GATAAAGTCTCCAAAACTGC | Cc cdtA | 329 | ||||
| CfspAU1 CfspAR1 | AACGACAAATGTAAGCACTC TATTTATGCAAGTCGTGCGA | Cf cdtA | 489 | ||||
| District/Sub-District (Upazila) | No. of Sample a | No. of Positive Samples | Occurrence (%) | 95% CI | p Value (Pearson’s Chi-Squared Test) |
|---|---|---|---|---|---|
| District | |||||
| Gazipur | 264 | 70 | 26.5 | 21.3–32.3 | 0.76 |
| Tangail | 44 | 13 | 29.5 | 16.8–45.2 | |
| Dhaka | 44 | 10 | 22.7 | 11.5–37.8 | |
| Sub-District (Upazila) | |||||
| Sadar, Gazipur | 88 | 18 | 20.4 | 12.6–30.4 | 0.014 |
| Sreepur, Gazipur | 88 | 17 | 19.3 | 11.7–29.1 | |
| Kapasia, Gazipur | 88 | 35 | 39.8 | 29.4–50.8 | |
| Sadar, Tangail | 44 | 13 | 29.6 | 16.8–45.2 | |
| Savar, Dhaka | 44 | 10 | 22.7 | 11.4–37.8 | |
| Overall | 352 | 93 | 26.4 | 21.9–31.3 | |
| Sample Type/Parameters | Farm Type (n) | No. of Positive Samples | Occurrence (%) | 95% Confidence Interval | p Value (Pearson’s Chi-Squared Test) |
|---|---|---|---|---|---|
| Cloacal swab | Conventional farms (n = 64) | 31 | 48.4 | 35.7–61.3 | 0.001 |
| Good practice farms (n = 64) | 13 | 20.3 | 11.3–32.2 | ||
| Both farms (n = 128) | 44 | 34.4 | 26.2–43.3 | ||
| Feed | Conventional farms (n = 32) | 8 | 25 | 11.5–43.4 | 0.35 |
| Good practice farms (n = 32) | 5 | 15.6 | 5.3–32.8 | ||
| Both farms (n = 64) | 13 | 20.3 | 11.3–32.2 | ||
| Drinking water for poultry | Conventional farms (n = 32) | 8 | 25 | 11.5–43.4 | 0.20 |
| Good practice farms (n = 32) | 4 | 12.5 | 3.5–29 | ||
| Both farms (n = 64) | 12 | 18.8 | 10.1–30.5 | ||
| Attendants’ hand rinsed | Conventional farms (n = 32) | 8 | 25 | 11.5–43.4 | 0.20 |
| Good practice farms (n = 32) | 4 | 12.5 | 3.5–29 | ||
| Both farms (n = 64) | 12 | 18.8 | 10.1–30.5 | ||
| Whole carcass | Conventional farms (n = 16) | 9 | 56.3 | 29.9–80.2 | 0.02 |
| Good practice farms (n = 16) | 3 | 18.8 | 4–45.6 | ||
| Both farms (n = 32) | 12 | 37.50 | 21.1–56.3 | ||
| All samples | Conventional farms (n = 176) | 64 | 36.4 | 29.3–43.9 | 0.000 |
| Good practice farms (n = 176) | 29 | 16.5 | 11.3–22.8 | ||
| Both farms (N = 352) | 93 | 26.4 | 21.9–31.3 |
| Resistance against Antimicrobials | Resistance Patterns | C. jejuni (n = 63) | C. coli (n = 30) | ||
|---|---|---|---|---|---|
| No. (%) of Strains | Subtotal [No. (%)] | No. (%) of Strains | Subtotal [No. (%)] | ||
| Against One to Two Antimicrobial Agents | |||||
| Against one | AMX | 5 (6.4) | 32 (50.8) | 3 (10) | 17 (56.7) |
| E | 5 (7.9) | 4 (13.3) | |||
| AZM | 5 (7.9) | 3 (10) | |||
| S | 5 (7.9) | 1 (3.3) | |||
| E | 4 (6.4) | 3 (10) | |||
| GEN | 4 (6.4) | 2 (6.7) | |||
| NOR | 5 (7.9) | 1 (3.3) | |||
| Against two | AMX-TE | 4 (6.4) | 9 (14.3) | 2 (6.7) | 4 (13.4) |
| AMX-S | 5 (7.9) | 2 (6.7) | |||
| Against Three or More Antimicrobial Agents | |||||
| Against three | AMX-S-TE | 5 (7.9) | 12 (19) | 2 (6.7) | 5 (16.7) |
| E-S-CIP | 7 (11.1) | 3 (10) | |||
| Against four | AMX-NOR-AZM-TE | 10 (15.9) | 10 (15.9) | 4 (13.3) | 4 (13.3) |
| Total against three or more antimicrobials | 22 (34.9) | 9 (30) | |||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alam, B.; Uddin, M.N.; Mridha, D.; Akhter, A.H.M.T.; Islam, S.S.; Haque, A.K.M.Z.; Kabir, S.M.L. Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices. Microorganisms 2020, 8, 1778. https://doi.org/10.3390/microorganisms8111778
Alam B, Uddin MN, Mridha D, Akhter AHMT, Islam SS, Haque AKMZ, Kabir SML. Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices. Microorganisms. 2020; 8(11):1778. https://doi.org/10.3390/microorganisms8111778
Chicago/Turabian StyleAlam, Badrul, Md. Nasir Uddin, Debashish Mridha, A. H. M. Taslima Akhter, SK Shaheenur Islam, A. K. M. Ziaul Haque, and S. M. Lutful Kabir. 2020. "Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices" Microorganisms 8, no. 11: 1778. https://doi.org/10.3390/microorganisms8111778
APA StyleAlam, B., Uddin, M. N., Mridha, D., Akhter, A. H. M. T., Islam, S. S., Haque, A. K. M. Z., & Kabir, S. M. L. (2020). Occurrence of Campylobacter spp. in Selected Small Scale Commercial Broiler Farms of Bangladesh Related to Good Farm Practices. Microorganisms, 8(11), 1778. https://doi.org/10.3390/microorganisms8111778

