Arabinogalactan Utilization by Bifidobacterium longum subsp. longum NCC 2705 and Bacteroides caccae ATCC 43185 in Monoculture and Coculture
Abstract
1. Introduction
2. Materials and Methods
2.1. Carbohydrate Substrates
2.2. Media, Strains and Growth Conditions
2.3. Analysis of Carbohydrate Degradation
2.4. Analysis of Enzyme Activity and Substrate Specificity
2.5. PMA Treatment and Droplet Digital PCR (ddPCR) Analysis
2.6. Quantification of SCFAs and Other Metabolites
2.7. Analysis of Nucleotide Sequences
2.8. Statistical Analysis
3. Results
3.1. Analysis of Genes Coding for Potential AG-Degrading Enzymes
3.2. Growth in Pure Culture on Seven Carbon Sources
3.3. AG Degradation Profiles after Fermentation
3.4. AG-Degrading Enzyme Activities
3.5. Growth in Mono- and Co-Culture on AG
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Cockburn, D.W.; Koropatkin, N.M. Polysaccharide degradation by the intestinal microbiota and its influence on human health and disease. J. Mol. Biol. 2016, 428, 3230–3252. [Google Scholar] [CrossRef] [Scilit]
- Flint, H.J.; Duncan, S.H.; Scott, K.P.; Louis, P. Links between diet, gut microbiota composition and gut metabolism. Proc. Nutr. Soc. 2015, 74, 13–22. [Google Scholar] [CrossRef] [Scilit]
- Duncan, S.H.; Louis, P.; Thomson, J.M.; Flint, H.J. The role of pH in determining the species composition of the human colonic microbiota. Environ. Microbiol. 2009, 11, 2112–2122. [Google Scholar] [CrossRef] [Scilit]
- Kelly, G.S. Larch arabinogalactan: Clinical relevance of a novel immune-enhancing polysaccharide. Altern. Med. Rev. 1999, 4, 96–103. [Google Scholar]
- Terpend, K.; Possemiers, S.; Daguet, D.; Marzorati, M. Arabinogalactan and fructo-oligosaccharides have a different fermentation profile in the Simulator of the Human Intestinal Microbial Ecosystem (SHIME®). Environ. Microbiol. Rep. 2013, 5, 595–603. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.-C.; Lu, T.-J.; Lin, W.-C. The prebiotic arabinogalactan of Anoectochilus formosanus prevents ovariectomy-induced osteoporosis in mice. J. Funct. Foods 2013, 5, 1642–1653. [Google Scholar] [CrossRef] [Scilit]
- Sakamoto, T.; Tanaka, H.; Nishimura, Y.; Ishimaru, M.; Kasai, N. Characterization of an exo-β-1,3-d-galactanase from Sphingomonas sp. 24T and its application to structural analysis of larch wood arabinogalactan. Appl. Microbiol. Biotechnol. 2011, 90, 1701–1710. [Google Scholar] [CrossRef] [Scilit]
- Fujita, K.; Sakaguchi, T.; Sakamoto, A.; Shimokawa, M.; Kitahara, K. Bifidobacterium longum subsp. longum exo-β-1,3-galactanase, an enzyme for the degradation of type II arabinogalactan. Appl. Environ. Microbiol. 2014, 80, 4577–4584. [Google Scholar] [CrossRef] [Scilit]
- Hinz, S.W.A.; Verhoef, R.; Schols, H.A.; Vincken, J.-P.; Voragen, A.G.J. Type I arabinogalactan contains β-d-Galp-(1→3)-β-d-Galp structural elements. Carbohydr. Res. 2005, 340, 2135–2143. [Google Scholar] [CrossRef] [Scilit]
- Cartmell, A.; Muñoz-Muñoz, J.; Briggs, J.A.; Ndeh, D.A.; Lowe, E.C.; Baslé, A.; Terrapon, N.; Stott, K.; Heunis, T.; Gray, J.; et al. A surface endogalactanase in Bacteroides thetaiotaomicron confers keystone status for arabinogalactan degradation. Nat. Microbiol. 2018, 3, 1314–1326. [Google Scholar] [CrossRef] [Scilit]
- Fujita, K.; Sasaki, Y.; Kitahara, K. Degradation of plant arabinogalactan proteins by intestinal bacteria: Characteristics and functions of the enzymes involved. Appl. Microbiol. Biotechnol. 2019, 103, 7451–7457. [Google Scholar] [CrossRef] [Scilit]
- Ndeh, D.; Gilbert, H.J. Biochemistry of complex glycan depolymerisation by the human gut microbiota. FEMS Microbiol. Rev. 2018, 42, 146–164. [Google Scholar] [CrossRef] [Scilit]
- Pokusaeva, K.; Fitzgerald, G.F.; van Sinderen, D. Carbohydrate metabolism in bifidobacteria. Genes Nutr. 2011, 6, 285–306. [Google Scholar] [CrossRef] [Scilit]
- Rivière, A.; Moens, F.; Selak, M.; Maes, D.; Weckx, S.; Vuyst, L.D. The ability of bifidobacteria to degrade arabinoxylan oligosaccharide constituents and derived oligosaccharides is strain dependent. Appl. Environ. Microbiol. 2014, 80, 204–217. [Google Scholar] [CrossRef] [Scilit]
- Hugenholtz, F.; Mullaney, J.A.; Kleerebezem, M.; Smidt, H.; Rosendale, D.I. Modulation of the microbial fermentation in the gut by fermentable carbohydrates. Bioact. Carbohydr. Diet. Fibre 2013, 2, 133–142. [Google Scholar] [CrossRef] [Scilit]
- Flint, H.J.; Duncan, S.H.; Scott, K.P.; Louis, P. Interactions and competition within the microbial community of the human colon: Links between diet and health. Environ. Microbiol. 2007, 9, 1101–1111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hinz, S.W.A.; Pastink, M.I.; van den Broek, L.A.M.; Vincken, J.-P.; Voragen, A.G.J. Bifidobacterium longum endogalactanase liberates galactotriose from type I galactans. Appl. Environ. Microbiol. 2005, 71, 5501–5510. [Google Scholar] [CrossRef] [Scilit]
- Böger, M.; Hekelaar, J.; van Leeuwen, S.S.; Dijkhuizen, L.; Lammerts van Bueren, A. Structural and functional characterization of a family GH53 β-1,4-galactanase from Bacteroides thetaiotaomicron that facilitates degradation of prebiotic galactooligosaccharides. J. Struct. Biol. 2019, 205, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Rivière, A.; Gagnon, M.; Weckx, S.; Roy, D.; Vuyst, L.D. Mutual cross-feeding interactions between Bifidobacterium longum subsp. longum NCC2705 and Eubacterium rectale ATCC 33656 explain the bifidogenic and butyrogenic effects of arabinoxylan oligosaccharides. Appl. Environ. Microbiol. 2015, 81, 7767–7781. [Google Scholar] [CrossRef] [Scilit]
- Shimokawa, M.; Kitahara, K.; Fujita, K. Characterization of a β-L-arabinopyranosidase from Bifidobacterium longum subsp. longum. J. Appl. Glycosci. 2015, 62, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Bakir, M.A.; Kitahara, M.; Sakamoto, M.; Matsumoto, M.; Benno, Y. Bacteroides intestinalis sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 2006, 56, 151–154. [Google Scholar] [CrossRef] [Scilit]
- Kitahara, M.; Sakamoto, M.; Ike, M.; Sakata, S.; Benno, Y. Bacteroides plebeius sp. nov. and Bacteroides coprocola sp. nov., isolated from human faeces. Int. J. Syst. Evol. Microbiol. 2005, 55, 2143–2147. [Google Scholar] [CrossRef] [Scilit]
- Lan, P.T.N.; Sakamoto, M.; Sakata, S.; Benno, Y. Bacteroides barnesiae sp. nov., Bacteroides salanitronis sp. nov. and Bacteroides gallinarum sp. nov., isolated from chicken caecum. Int. J. Syst. Evol. Microbiol. 2006, 56, 2853–2859. [Google Scholar] [CrossRef] [Scilit]
- O’Connell Motherway, M.; Fitzgerald, G.F.; van Sinderen, D. Metabolism of a plant derived galactose-containing polysaccharide by Bifidobacterium breve UCC2003. Microb. Biotechnol. 2011, 4, 403–416. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goulas, T.K.; Goulas, A.K.; Tzortzis, G.; Gibson, G.R. Molecular cloning and comparative analysis of four β-galactosidase genes from Bifidobacterium bifidum NCIMB41171. Appl. Microbiol. Biotechnol. 2007, 76, 1365–1372. [Google Scholar] [CrossRef] [Scilit]
- Møller, P.L.; Jørgensen, F.; Hansen, O.C.; Madsen, S.M.; Stougaard, P. Intra- and extracellular β-galactosidases from Bifidobacterium bifidum and B. infantis: Molecular cloning, heterologous expression, and comparative characterization. Appl. Environ. Microbiol. 2001, 67, 2276–2283. [Google Scholar] [CrossRef] [Scilit]
- Patel, G.B.; Mackenzie, C.R.; Agnew, B.J. Properties and potential advantages of β-galactosidase from Bacteroides polypraymatus. Appl. Microbiol. Biotechnol. 1985, 22, 114–120. [Google Scholar] [CrossRef] [Scilit]
- Scudder, P.; Uemura, K.; Dolby, J.; Fukuda, M.N.; Feizi, T. Isolation and characterization of an endo-β-galactosidase from Bacteroides fragilis. Biochem. J. 1983, 213, 485–494. [Google Scholar] [CrossRef] [Scilit]
- Tsai, H.H.; Hart, C.A.; Rhodes, J.M. Production of mucin degrading sulphatase and glycosidases by Bacteroides thetaiotaomicron. Lett. Appl. Microbiol. 1991, 13, 97–101. [Google Scholar] [CrossRef] [Scilit]
- Degnan, B.A.; Macfarlane, G.T. Arabinogalactan utilization in continuous cultures of Bifidobacterium longum: Effect of co-culture with Bacteroides thetaiotaomicron. Anaerobe 1995, 1, 103–112. [Google Scholar] [CrossRef] [Scilit]
- Arboleya, S.; Watkins, C.; Stanton, C.; Ross, R.P. Gut bifidobacteria populations in human health and aging. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef] [Scilit]
- Duncan, S.H.; Flint, H.J. Probiotics and prebiotics and health in ageing populations. Maturitas 2013, 75, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Rivière, A.; Selak, M.; Lantin, D.; Leroy, F.; Vuyst, L.D. Bifidobacteria and butyrate-producing colon bacteria: Importance and strategies for their stimulation in the human gut. Front. Microbiol. 2016, 7. [Google Scholar] [CrossRef] [Scilit]
- Schell, M.A.; Karmirantzou, M.; Snel, B.; Vilanova, D.; Berger, B.; Pessi, G.; Zwahlen, M.-C.; Desiere, F.; Bork, P.; Delley, M.; et al. The genome sequence of Bifidobacterium longum reflects its adaptation to the human gastrointestinal tract. Proc. Natl. Acad. Sci. USA 2002, 99, 14422–14427. [Google Scholar] [CrossRef] [Scilit]
- Ling, N.X.-Y.; Pettolino, F.; Liao, M.-L.; Bacic, A. Preparation of a new chromogenic substrate to assay for β-galactanases that hydrolyse type II arabino-3,6-galactans. Carbohydr. Res. 2009, 344, 1941–1946. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Kim, J.Y.; Park, M.S.; Ji, G.E. Novel Bifidobacterium promoters selected through microarray analysis lead to constitutive high-level gene expression. J. Microbiol. 2012, 50, 638–643. [Google Scholar] [CrossRef] [Scilit]
- Rinttilä, T.; Kassinen, A.; Malinen, E.; Krogius, L.; Palva, A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J. Appl. Microbiol. 2004, 97, 1166–1177. [Google Scholar] [CrossRef] [Scilit]
- Polic, I.I. Evaluation of the Impact of Azo Dyes on the Metabolism of Stabilized Fecal Communities and In Vitro Cell Culture. Master’s Thesis, University of Guelph, Guelph, ON, Canada, 2018. [Google Scholar]
- Kaoutari, A.E.; Armougom, F.; Gordon, J.I.; Raoult, D.; Henrissat, B. The abundance and variety of carbohydrate-active enzymes in the human gut microbiota. Nat. Rev. Microbiol. 2013, 11, 497–504. [Google Scholar] [CrossRef] [Scilit]
- Von Heijne, G. The signal peptide. J. Membr. Biol. 1990, 115, 195–201. [Google Scholar] [CrossRef] [Scilit]
- Lammerts van Bueren, A.; Mulder, M.; van Leeuwen, S.; Dijkhuizen, L. Prebiotic galactooligosaccharides activate mucin and pectic galactan utilization pathways in the human gut symbiont Bacteroides thetaiotaomicron. Sci. Rep. 2017, 7, 40478. [Google Scholar] [CrossRef] [Scilit]
- Sarbini, S.; Rastall, R. Prebiotics: Metabolism, structure, and function. Func. Food Rev. 2011, 3, 93–106. [Google Scholar] [CrossRef]
- Martinez, F.A.C.; Balciunas, E.M.; Converti, A.; Cotter, P.D.; de Souza Oliveira, R.P. Bacteriocin production by Bifidobacterium spp. a review. Biotechnol. Adv. 2013, 31, 482–488. [Google Scholar] [CrossRef] [Scilit]
- Kishimoto, A.; Ushida, K.; Phillips, G.O.; Ogasawara, T.; Sasaki, Y. Identification of intestinal bacteria responsible for fermentation of gum arabic in pig model. Curr. Microbiol. 2006, 53, 173–177. [Google Scholar] [CrossRef] [Scilit]
- Macy, J.M.; Ljungdahl, L.G.; Gottschalk, G. Pathway of succinate and propionate formation in Bacteroides fragilis. J. Bacteriol. 1978, 134, 84–91. [Google Scholar] [CrossRef] [Scilit]
- Rios-Covian, D.; Sánchez, B.; Salazar, N.; Martínez, N.; Redruello, B.; Gueimonde, M.; de los Reyes-Gavilán, C.G. Different metabolic features of Bacteroides fragilis growing in the presence of glucose and exopolysaccharides of bifidobacteria. Front. Microbiol. 2015, 6. [Google Scholar] [CrossRef] [Scilit]
- Flint, H.J.; Scott, K.P.; Louis, P.; Duncan, S.H. The role of the gut microbiota in nutrition and health. Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 577–589. [Google Scholar] [CrossRef] [Scilit]
- Schultz, J.E.; Breznak, J.A. Cross-feeding of lactate between Streptococcus lactis and Bacteroides sp. isolated from termite hindguts. Appl. Environ. Microbiol. 1979, 37, 5. [Google Scholar] [CrossRef] [Scilit]





| Target Bacteria | Primers | Product Size | Tm 1 | Target Gene | Reference |
|---|---|---|---|---|---|
| Bac. caccae | F: GTAACACGTATCCAACCTACC R: TATTCCTCACTGCTGCCTC | 252 | 60 °C/30 s | 16S rRNA | This study |
| Bifidobacterium spp. | F: TCGCGTCCGGTGTGAAAG R: CCACATCCAGCATCCAC | 243 | 65 °C/25 s | 16S rRNA | [37] |
| Substrate (pNP) | B. longum subsp. longum NCC 2705 Specific Activity (U/mg protein) | Bac. caccae ATCC 43185 Specific Activity (U/mg protein) | ||
|---|---|---|---|---|
| Cytoplasmic enzyme | Cell wall-associated enzyme | Cytoplasmic enzyme | Cell wall-associated enzyme | |
| α-AF 1 | 0.15 ± 0.006 A,a | 0.19 ± 0.027 A,a | 0.01 ± 0.001 A,b | 0.09 ± 0.006 B,b |
| β-AP 2 | ND 4 | 0.05 ± 0.011 a | ND | 0.04 ± 0.004 a |
| β-gal 3 | 2.64 ± 0.159 A,a | 0.22 ± 0.031 B,a | 0.21 ± 0.011 A,b | 0.11 ± 0.009 B,b |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; LaPointe, G. Arabinogalactan Utilization by Bifidobacterium longum subsp. longum NCC 2705 and Bacteroides caccae ATCC 43185 in Monoculture and Coculture. Microorganisms 2020, 8, 1703. https://doi.org/10.3390/microorganisms8111703
Wang Y, LaPointe G. Arabinogalactan Utilization by Bifidobacterium longum subsp. longum NCC 2705 and Bacteroides caccae ATCC 43185 in Monoculture and Coculture. Microorganisms. 2020; 8(11):1703. https://doi.org/10.3390/microorganisms8111703
Chicago/Turabian StyleWang, Yan, and Gisèle LaPointe. 2020. "Arabinogalactan Utilization by Bifidobacterium longum subsp. longum NCC 2705 and Bacteroides caccae ATCC 43185 in Monoculture and Coculture" Microorganisms 8, no. 11: 1703. https://doi.org/10.3390/microorganisms8111703
APA StyleWang, Y., & LaPointe, G. (2020). Arabinogalactan Utilization by Bifidobacterium longum subsp. longum NCC 2705 and Bacteroides caccae ATCC 43185 in Monoculture and Coculture. Microorganisms, 8(11), 1703. https://doi.org/10.3390/microorganisms8111703

