CRISPR/Cas9-Mediated Gene Replacement in the Fungal Keratitis Pathogen Fusarium solani var. petroliphilum
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Isolates and Culture Media
2.2. Design of crRNA’s for ura3 in F. solani var petroliphilum
2.3. Construction and Amplification of the Hygromycin Resistance Cassette
2.4. Cas9-gRNA Ribonucleoprotein Complexes
2.5. PEG-Mediated Fungal Transformation
3. Results
3.1. Design of the crRNA Protospacer Sequences for Replacement of the ura3 Gene with a Hygromycin Resistance Cassette
3.2. Cas9–MMEJ Transformation Results in Several Colonies of the Expected ura3 Deletion Phenotype
3.3. Genotyping of the Uracil Auxotrophic Mutants Confirms the Expected ura3 Gene Replacement Event
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Leal, S.M.; Pearlman, E. The role of cytokines and pathogen recognition molecules in fungal keratitis—Insights from human disease and animal models. Cytokine 2012, 58, 107–111. [Google Scholar] [CrossRef] [PubMed]
- Prajna, N.V.; Srinivasan, M.; Lalitha, P.; Krishnan, T.; Rajaraman, R.; Ravindran, M.; Mascarenhas, J.; Oldenburg, C.E.; Ray, K.J.; McLeod, S.D.; et al. Differences in clinical outcomes in keratitis due to fungus and bacteria. JAMA Ophthalmol. 2013, 131, 1088–1089. [Google Scholar] [CrossRef] [PubMed]
- Ansari, Z.; Miller, D.; Galor, A. Current thoughts in fungal keratitis: Diagnosis and treatment. Curr. Fungal Infect. Rep. 2013, 7, 209–218. [Google Scholar] [CrossRef] [PubMed]
- Homa, M.; Shobana, C.S.; Singh, Y.R.B.; Manikandan, P.; Selvam, K.P.; Kredics, L.; Narendran, V.; Vágvölgyi, C.; Galgóczy, L. Fusarium keratitis in South India: Causative agents, their antifungal susceptibilities and a rapid identification method for the Fusarium solani species complex. Mycoses 2013, 56, 501–511. [Google Scholar] [CrossRef] [PubMed]
- Godoy, P.; Colombo, A.L.; Höfling-Lima, A.L.; Cano, J.; Gené, J.; Guarro, J. Genotyping of 44 isolates of Fusarium solani, the main agent of fungal keratitis in Brazil. J. Clin. Microbiol. 2004, 42, 4494–4497. [Google Scholar] [CrossRef]
- Rosa, R.H.; Miller, D.; Alfonso, E.C. The changing spectrum of fungal keratitis in South Florida. Ophthalmology 1994, 101, 1005–1013. [Google Scholar] [CrossRef]
- Ritterband, D.C.; Seedor, J.A.; Shah, M.K.; Koplin, R.S.; McCormick, S.A. Fungal keratitis at the New York eye and ear infirmary. Cornea 2006, 25, 264–267. [Google Scholar] [CrossRef]
- Chang, D.C.; Grant, G.B.; O’Donnell, K.; Wannemuehler, K.A.; Noble-Wang, J.; Rao, C.Y.; Jacobson, L.M.; Crowell, C.S.; Sneed, R.S.; Lewis, F.M.T.; et al. Multistate outbreak of Fusarium keratitis associated with use of a contact lens solution. J. Am. Med. Assoc. 2006, 296, 953–963. [Google Scholar] [CrossRef]
- Ma, L.-J.; Geiser, D.M.; Proctor, R.H.; Rooney, A.P.; O’Donnell, K.; Trail, F.; Gardiner, D.M.; Manners, J.M.; Kazan, K. Fusarium Pathogenomics. Annu. Rev. Microbiol. 2013, 67, 399–416. [Google Scholar] [CrossRef]
- Short, D.P.; O’Donnell, K.; Geiser, D.M. Clonality, recombination, and hybridization in the plumbing-inhabiting human pathogen Fusarium keratoplasticum inferred from multilocus sequence typing. BMC Evol. Biol. 2014, 14, 91. [Google Scholar] [CrossRef]
- Debourgogne, A.; Gueidan, C.; de Hoog, S.; Lozniewski, A.; Machouart, M. Comparison of two DNA sequence-based typing schemes for the Fusarium solani species complex and proposal of a new consensus method. J. Microbiol. Methods 2012, 91, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Oechsler, R.A.; Feilmeier, M.R.; Miller, D.; Shi, W.; Hofling-Lima, A.L.; Alfonso, E.C. Fusarium keratitis: Genotyping, in vitro susceptibility and clinical outcomes. Cornea 2013, 32, 667–673. [Google Scholar] [CrossRef] [PubMed]
- Dallé da Rosa, P.; Nunes, A.; Borges, R.; Batista, B.; Meneghello Fuentefria, A.; Goldani, L.Z. In Vitro susceptibility and multilocus sequence typing of Fusarium isolates causing keratitis. J. Mycol. Med. 2018, 28, 482–485. [Google Scholar]
- Short, D.P.G.; O’Donnell, K.; Thrane, U.; Nielsen, K.F.; Zhang, N.; Juba, J.H.; Geiser, D.M. Phylogenetic relationships among members of the Fusarium solani species complex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov. Fungal Genet. Biol. 2013, 53, 59–70. [Google Scholar] [CrossRef] [PubMed]
- Coleman, J.J. The Fusarium solani species complex: Ubiquitous pathogens of agricultural importance. Mol. Plant Pathol. 2016, 17, 146–158. [Google Scholar] [CrossRef] [PubMed]
- Herkert, P.F.; Al-Hatmi, A.M.S.; de Oliveira Salvador, G.L.; Muro, M.D.; Pinheiro, R.L.; Nucci, M.; Queiroz-Telles, F.; de Hoog, G.S.; Meis, J.F. Molecular characterization and antifungal susceptibility of clinical Fusarium species from Brazil. Front. Microbiol. 2019, 10, 737. [Google Scholar] [CrossRef] [PubMed]
- Geiser, D.M.; Aoki, T.; Bacon, C.W.; Baker, S.E.; Bhattacharyya, M.K.; Brandt, M.E.; Brown, D.W.; Burgess, L.W.; Chulze, S.; Coleman, J.J.; et al. One fungus, one name: Defining the genus Fusarium in a scientifically robust way that preserves longstanding use. Phytopathology 2013, 103, 400–408. [Google Scholar] [CrossRef]
- Homa, M.; Galgóczy, L.; Manikandan, P.; Narendran, V.; Sinka, R.; Csernetics, Á.; Vágvölgyi, C.; Kredics, L.; Papp, T. South Indian Isolates of the Fusarium solani species complex from clinical and environmental samples: Identification, antifungal susceptibilities, and virulence. Front. Microbiol. 2018, 9, 1052. [Google Scholar] [CrossRef]
- Hassan, A.S.; Al-Hatmi, A.M.S.; Shobana, C.S.; Van Diepeningen, A.D.; Kredics, L.; Vágvölgyi, C.; Homa, M.; Meis, J.F.; De Hoog, G.S.; Narendran, V.; et al. Antifungal Susceptibility and Phylogeny of Opportunistic Members of the Genus Fusarium Causing Human Keratomycosis in South India. Med. Mycol. 2016, 54, 287–294. [Google Scholar] [CrossRef]
- Walther, G.; Stasch, S.; Kaerger, K.; Hamprecht, A.; Roth, M.; Cornely, O.A.; Geerling, G.; Mackenzie, C.R.; Kurzai, O.; Von Lilienfeld-Toal, M. Fusarium keratitis in Germany. J. Clin. Microbiol. 2017, 55, 2983–2995. [Google Scholar] [CrossRef]
- Scheel, C.M.; Hurst, S.F.; Barreiros, G.; Akiti, T.; Nucci, M.; Balajee, S.A. Molecular analyses of Fusarium isolates recovered from a cluster of invasive mold infections in a Brazilian hospital. BMC Infect. Dis. 2013, 13, 49. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Martín, R.; Cerdá-Olmedo, E.; Avalos, J. Homologous recombination and allele replacement in transformants of Fusarium fujikuroi. Mol. Gen. Genet. 2000, 263, 838–845. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Chen, H.; Tang, X.; Zhang, H.; Chen, W.; Chen, Y.Q. Molecular tools for gene manipulation in filamentous fungi. Appl. Microbiol. Biotechnol. 2017, 101, 8063–8075. [Google Scholar] [CrossRef] [PubMed]
- Sander, J.D.; Joung, J.K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 2014, 32, 347–350. [Google Scholar] [CrossRef]
- Nødvig, C.S.; Nielsen, J.B.; Kogle, M.E.; Mortensen, U.H. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 2015, 10, e0133085. [Google Scholar] [CrossRef]
- Wang, Q.; Cobine, P.A.; Coleman, J.J. Efficient genome editing in Fusarium oxysporum based on CRISPR/Cas9 ribonucleoprotein complexes. Fungal Genet. Biol. 2018, 117, 21–29. [Google Scholar] [CrossRef]
- Al Abdallah, Q.; Ge, W.; Fortwendel, J.R. A simple and universal system for gene manipulation in Aspergillus fumigatus: In vitro-assembled Cas9-guide RNA ribonucleoproteins coupled with microhomology repair templates. mSphere 2017, 2, 1–14. [Google Scholar] [CrossRef]
- Rees, C.A.; Bao, R.; Zegans, M.E.; Cramer, R.A. Natamycin and Voriconazole Exhibit Synergistic Interactions with nonantifungal ophthalmic agents against Fusarium species ocular isolates. Antimicrob. Agents Chemother. 2019, 63, e02505–e02518. [Google Scholar] [CrossRef]
- Chehri, K.; Salleh, B.; Zakaria, L. Morphological and phylogenetic analysis of Fusarium solani species complex in malaysia. Microb. Ecol. 2015, 69, 457–471. [Google Scholar] [CrossRef]
- Oakley, B.R. Aspergillus nidulans. In Brenner’s Encyclopedia of Genetics: Second Edition; Springer: Boston, MA, USA, 2013; pp. 212–215. ISBN 9780080961569. [Google Scholar]
- Ventura, L.; Ramón, D. Transformation of Aspergillus terreus with the hygromycin B resistance marker from Escherichia coli. FEMS Microbiol. Lett. 1991, 82, 189–193. [Google Scholar] [CrossRef]
- Yelton, M.M.; Hamer, J.E.; Timberlake, W.E. Transformation of aspergillus nidulans by using a trpC plasmid. Proc. Natl. Acad. Sci. USA 1984, 81, 1470–1474. [Google Scholar] [CrossRef] [PubMed]
- Van Hartingsveldt, W.; Mattern, I.E.; van Zeijl, C.M.J.; Pouwels, P.H.; van den Hondel, C.A.M.J.J. Development of a homologous transformation system for Aspergillus niger based on the pyrG gene. MGG Mol. Gen. Genet. 1987, 206, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Alani, E.; Cao, L.; Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 1987, 116, 541–545. [Google Scholar] [CrossRef] [PubMed]
- Grigoriev, I.V.; Nikitin, R.; Haridas, S.; Kuo, A.; Ohm, R.; Otillar, R.; Riley, R.; Salamov, A.; Zhao, X.; Korzeniewski, F.; et al. MycoCosm portal: Gearing up for 1000 fungal genomes. Nucleic Acids Res. 2014, 42, D699–D704. [Google Scholar] [CrossRef]
- Tani, S.; Tsuji, A.; Kunitake, E.; Sumitani, J.-I.; Kawaguchi, T. Reversible impairment of the ku80 gene by a recyclable marker in Aspergillus aculeatus. AMB Express 2013, 3, 4. [Google Scholar] [CrossRef]
- Fuller, K.K.; Chen, S.; Loros, J.J.; Dunlap, C. Development of the CRISPR/Cas9 system for targeted gene disruption in Aspergillus fumigatus. Eukaryot Cell 2015, 14, 1073–1080. [Google Scholar] [CrossRef]
- Sternberg, S.H.; Redding, S.; Jinek, M.; Greene, E.C.; Doudna, J.A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 2014, 507, 62–67. [Google Scholar] [CrossRef]
- Zheng, T.; Hou, Y.; Zhang, P.; Zhang, Z.; Xu, Y.; Zhang, L.; Niu, L.; Yang, Y.; Liang, D.; Yi, F.; et al. Profiling single-guide RNA specificity reveals a mismatch sensitive core sequence. Sci. Rep. 2017, 7, 40638. [Google Scholar] [CrossRef]
- Song, R.; Zhai, Q.; Sun, L.; Huang, E.; Zhang, Y.; Zhu, Y.; Guo, Q.; Tian, Y.; Zhao, B.; Lu, H. CRISPR/Cas9 genome editing technology in filamentous fungi: Progress and perspective. Appl. Microbiol. Biotechnol. 2019, 103, 6919–6932. [Google Scholar] [CrossRef]
- Shi, T.Q.; Liu, G.N.; Ji, R.Y.; Shi, K.; Song, P.; Ren, L.J.; Huang, H.; Ji, X.J. CRISPR/Cas9-based genome editing of the filamentous fungi: The state of the art. Appl. Microbiol. Biotechnol. 2017, 101, 7435–7443. [Google Scholar] [CrossRef]
- Jan Vonk, P.; Escobar, N.; Wösten, H.A.B.; Lugones, L.G.; Ohm, R.A. High-throughput targeted gene deletion in the model mushroom Schizophyllum commune using pre-assembled Cas9 ribonucleoproteins. Sci. Rep. 2019, 9, 7632. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Meng, X.; Wei, X.; Lu, L. Highly efficient CRISPR mutagenesis by microhomology-mediated end joining in Aspergillus fumigatus. Fungal Genet. Biol. 2016, 86, 47–57. [Google Scholar] [CrossRef] [PubMed]
- Hsu, P.D.; Scott, D.A.; Weinstein, J.A.; Ran, F.A.; Konermann, S.; Agarwala, V.; Li, Y.; Fine, E.J.; Wu, X.; Shalem, O.; et al. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 2013, 31, 827–832. [Google Scholar] [CrossRef] [PubMed]
- Pattanayak, V.; Lin, S.; Guilinger, J.P.; Ma, E.; Doudna, J.A.; Liu, D.R. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat. Biotechnol. 2013, 31, 839–843. [Google Scholar] [CrossRef]
- Foster, A.J.; Martin-Urdiroz, M.; Yan, X.; Wright, H.S.; Soanes, D.M.; Talbot, N.J. CRISPR-Cas9 ribonucleoprotein-mediated co-editing and counterselection in the rice blast fungus. Sci. Rep. 2018, 8, 14355. [Google Scholar] [CrossRef]
- Wang, Y.; Wei, D.; Zhu, X.; Pan, J.; Zhang, P.; Huo, L.; Zhu, X. A “suicide” CRISPR-Cas9 system to promote gene deletion and restoration by electroporation in Cryptococcus neoformans. Sci. Rep. 2016, 6, 31145. [Google Scholar] [CrossRef]
- Al Abdallah, Q.; Souza, A.C.O.; Martin-Vicente, A.; Ge, W.; Fortwendel, J.R. Whole-genome sequencing reveals highly specific gene targeting by in vitro assembled Cas9-ribonucleoprotein complexes in Aspergillus fumigatus. Fungal Biol. Biotechnol. 2018, 5, 11. [Google Scholar] [CrossRef]
- Hao, Z.; Su, X. Fast gene disruption in Trichoderma reesei using in vitro assembled Cas9/gRNA complex. BMC Biotechnol. 2019, 19, 2. [Google Scholar] [CrossRef]



| Amplification of Hygromycin Resistance Cassette with Ura3 Microhomology |
|---|
| Primer 1: |
| 5′ GCCTTGTCGCCTCTCGTAGCCGGCCGGTCCCTTGGAGCTGaagtggaaaggctggtgtgc |
| Primer 2: |
| 5′ AGTGGGGGCTCCGGAGTAATCGGCTTTAACGCAACCCACCtcgcgtggagccaagagcgg |
| Genotyping putative ura3 deletants |
| Primer 3: 5′ CAAGCCAAGCTTCGCACAAG |
| Primer 4: 5′ GCGATGACATTCAGTGCAGC |
| Primer 5: 5′ GTCGAGCTGCAATACACCAG |
| Primer 6: 5′ GACAAGACGTGGTGAATCGG |
| Primer 7: 5′ AAGTGGAAAGGCTGGTGTGC |
| Primer 8: 5′ TCGCGTGGAGCCAAGAGCGG |
| crRNA sequences |
| 5′ crRNA FsUra3: 5′ CGGCCGGTCCCTTGGAGCTG |
| 3′ crRNA FsUra3: 5′ GGGTTGAGTTTTGCGGTGGT |
| 1° Plate (Hyg Selection) | Analyzed | Hyg Resistant | Uracil Auxotrophs | Efficiency | |
|---|---|---|---|---|---|
| Control | 0 | 0 | 0 | 0 | 0% |
| Repair Template only | 16 | 10 | 10 | 0 | 0% |
| Cas9–MMEJ | 83 | 63 | 63 | 6 | 9.50% |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lightfoot, J.D.; Fuller, K.K. CRISPR/Cas9-Mediated Gene Replacement in the Fungal Keratitis Pathogen Fusarium solani var. petroliphilum. Microorganisms 2019, 7, 457. https://doi.org/10.3390/microorganisms7100457
Lightfoot JD, Fuller KK. CRISPR/Cas9-Mediated Gene Replacement in the Fungal Keratitis Pathogen Fusarium solani var. petroliphilum. Microorganisms. 2019; 7(10):457. https://doi.org/10.3390/microorganisms7100457
Chicago/Turabian StyleLightfoot, Jorge D., and Kevin K. Fuller. 2019. "CRISPR/Cas9-Mediated Gene Replacement in the Fungal Keratitis Pathogen Fusarium solani var. petroliphilum" Microorganisms 7, no. 10: 457. https://doi.org/10.3390/microorganisms7100457
APA StyleLightfoot, J. D., & Fuller, K. K. (2019). CRISPR/Cas9-Mediated Gene Replacement in the Fungal Keratitis Pathogen Fusarium solani var. petroliphilum. Microorganisms, 7(10), 457. https://doi.org/10.3390/microorganisms7100457
