Next Article in Journal
Characterization of the Immune Response during Infection Caused by Clostridioides difficile
Next Article in Special Issue
Diversity, Distribution, and Ecology of Fungi in the Seasonal Snow of Antarctica
Previous Article in Journal
Comparison of Different Invasive and Non-Invasive Methods to Characterize Intestinal Microbiota throughout a Production Cycle of Broiler Chickens
Previous Article in Special Issue
Should We Not Further Study the Impact of Microbial Activity on Snow and Polar Atmospheric Chemistry?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 7
Issue 10
10.3390/microorganisms7100434
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ecophysiology of Chloromonas hindakii sp. nov. (Chlorophyceae), Causing Orange Snow Blooms at Different Light Conditions

by
Lenka Procházková
1,*,
Daniel Remias
2,
Tomáš Řezanka
3 and
Linda Nedbalová
1
1
Department of Ecology, Faculty of Science, Charles University, Viničná 7, 12844 Prague, Czech Republic
2
School of Engineering, University of Applied Sciences Upper Austria, Stelzhamerstr. 23, 4600 Wels, Austria
3
The Czech Academy of Sciences, Institute of Microbiology, Vídeňská 1083, 142 20 Prague, Czech Republic
*
Author to whom correspondence should be addressed.
Microorganisms 2019, 7(10), 434; https://doi.org/10.3390/microorganisms7100434
Submission received: 20 August 2019 / Revised: 20 September 2019 / Accepted: 2 October 2019 / Published: 10 October 2019
(This article belongs to the Special Issue Ice and Snow Microbiology)
Browse Figures
Versions Notes

Abstract

:
Slowly melting snowfields in mountain and polar regions are habitats of snow algae. Orange blooms were sampled in three European mountain ranges. The cysts within the blooms morphologically resembled those of Chloromonas nivalis (Chlorophyceae). Molecular and morphological traits of field and cultured material showed that they represent a new species, Chloromonas hindakii sp. nov. The performance of photosystem II was evaluated by fluorometry. For the first time for a snow alga, cyst stages collected in a wide altitudinal gradient and the laboratory strain were compared. The results showed that cysts were well adapted to medium and high irradiance. Cysts from high light conditions became photoinhibited at three times higher irradiances (600 µmol photons m−2 s−1) than those from low light conditions, or likewise compared to cultured flagellates. Therefore, the physiologic light preferences reflected the conditions in the original habitat. A high content of polyunsaturated fatty acids (about 60% of total lipids) and the accumulation of the carotenoid astaxanthin was observed. They are regarded as adaptations to cope with extreme environmental conditions of snow that include low temperatures, freeze-thaw cycles, and variable light intensity. The intraspecific ability of adaptation of the photosynthetic apparatus to different irradiance regimes seems to be advantageous for thriving in different snow habitats.

Graphical Abstract

1. Introduction

For microalgae, snow and ice surfaces are habitats characterized by a multitude of abiotic stresses, including low nutrients, diurnal freeze-thaw cycles, high UV and photosynthetically active radiation (PAR) at the surface, and an overall short growing season. In these ecosystems, diverse algal communities develop distinct snow discolorations and exhibit individual cellular metabolic profiles [1]. The organisms responsible for such a phenomenon mainly belong to green algae [2,3]. Prominent genera thriving in snow are Chloromonas [4] and Sanguina (formerly assigned to Chlamydomonas) [5].
These microalgae are essential primary producers in such an extreme ecosystem (e.g., [6]), where phototrophic life is restricted to a few specialized organisms. For instance, they provide a basic ecosystem, e.g., for snow bacteria [7], fungi [8], and ciliated protozoa [9]. Snow algae microbial communities play an important role in snow food webs and supply nutrients that are delivered throughout the ecosystem (e.g., supraglacial and periglacial environments) [10].
Insight in complex feedbacks between snow and climate were recently done by [11]. Snow in the mid-latitudes appears to be most sensitive to climate change [12], and mid-latitude areas below 1200 m a.s.l. are assumed to suffer complete snow loss by the end of 21st century [13]. Therefore, snow microbial communities of mid-latitude mountains urgently deserve focused research before their habitats are gone forever.
Organisms living in melting snow have to be well adapted. A key factor for photoautotrophic life is the plasticity of the photosynthetic apparatus, necessary for balancing energy consumption and conversion [14], because light conditions in snow are very variable from surface to deeper layers [15]. At the beginning of the season, cells are deep in the snowpack, thus subject to absence of light. Due to the combination of ongoing melting and upwards migration of flagellates, they become exposed in surface layers to higher light conditions [16]. Thus, constant adjustment of the photosynthetic apparatus is required spatially and temporally in the course of a few weeks. Additionally, snowfields can be quite different in regard of light conditions depending on being shaded, partly shaded under canopy, or permanently exposed at sites without trees. This led to the earlier conclusion that red snow, which is usually fully exposed, comprises species with high light tolerance, whereas green snow, which is usually found at shaded places, is taxonomically different and does not tolerate excessive irradiation [17].
Rapid light curves, acquired either via oxygen turnover or by fluorometry of the plastidal electron transport rates, demonstrate the adaptation of snow algal photosystems (i.e., to low temperatures). This was performed with monospecific blooms like Chloromonas (C.) nivalis [18], C. polyptera [19], C. nivalis subsp. tatrae [20], Chloromonas brevispina [21], Scotiella cryophila [22], and Sanguina nivaloides (formerly classified as “Chlamydomonas nivalis”) [23]. However, these studies used only field samples collected at a certain locality, and to our knowledge, there were no efforts yet to compare either the autecological photophysiology of a single species collected from different mountain ranges, or differently exposed sites in terms of PAR. The first ecophysiological comparison of cryoflora populations from two mountain ranges was done in the case of Chlainomonas sp. [16]. However, data on flagellated stages based on laboratory strains or field samples were not available. Thus, the range of light adaptation remained unknown; also the differences between two life cycle stages of typical snow algae in the order Chlamydomonadales (flagellates vs. immotile cysts) were never determined before.
C. nivalis (Chodat) Hoham et Mullet was regarded as a cosmopolitan species living in polar and mid-latitude mountainous regions. The taxon was usually identified solely based on the morphology of fusiform cysts bearing elongated cell wall flanges, which usually dominate field blooms. However, molecular studies showed that it comprises multiple taxa, which were recently independently described, e.g., C. muramotoi [4].
The cysts used in this study that cause orange snow in mid-latitude mountains in central Europe resembled those of C. nivalis as well, but were revealed to be a new taxon of its own by analyses of multiple DNA marker regions. It is described here as C. hindakii Procházková & Remias sp. nov., based on molecular and morphologic characteristics of vegetative flagellates and immotile cysts. The aim was not only to describe morphology and ecology, but also to compare the two main life cycle stages in terms of photobiology and fatty acids profiles. Since we were able to find blooms of this species at habitats with quite different conditions of irradiance, we were able to test the hypothesis that populations from high light conditions get photoinhibited at higher irradiances than those from low light conditions. Finally, the carotenoid composition of the reddish cysts was investigated. To sum up, the results of this study are a showcase, helping to understand the geographical distribution, taxonomy, habitat preferences, and intraspecific physiological variability of a new species of snow alga in the snow melting period.

2. Materials and Methods

2.1. Sampling and Snow Characteristics

Orange colored spots of snow were investigated in May and June in the years 2017–2019 in the High Tatra (Slovakia, Poland), Krkonoše, and Jeseníky Mountains (the Czech Republic) (Figure 1, Table 1, Figure S1).
For sampling, the selection of virtually monospecific spots was done with a field microscope according to [5]. Orange snow was harvested with a sterile shovel, placed in 5 l buckets, 1 l thermos bottles, or 50 mL centrifugation tubes, and transported the same day to the laboratory. Prior to photosynthesis measurements, samples were melted gently at darkness overnight at 4–5 °C. Electrical conductivity (EC) and pH of the meltwater were obtained with WTW Instruments (Cond 340i and Inolab, Germany) or with HANNA (Combo EC, ftb Romania). Snow water equivalent (SWE; referred to as ‘snow water content’ in the following reference) was carried out as described previously [20].

2.2. Strain Isolation

For obtaining a unialgal strain of C. hindakii sp. nov., a subsample of WP129 (containing only sedimented cysts, no flagellates observed) with visible orange coloration was put into sterile 2 mL cryotubes and the meltwater replaced with deionized water. For induction of germination of the cysts, the cells were kept at 1 °C during the day (14 h) resp. −1 °C during the night (10 h) in a Percival LT-36VL (CLF Plant Climatics, Wertingen, Germany). The light intensity generated by fluorescent tubes was approximately 40–70 μmol PAR m−2 s−1. After several weeks, many cysts developed daughter cells (Figure S2), and subsequently, green flagellates were present in the supernatant; 10 µL aliquots of the latter were transferred into liquid 0.6 N Bold’s Basal Medium (BBM) [24] and irradiation was dimmed to 20–30 μmol PAR m−2 s−1. In the next step, the culture was used for genetics, microscopy, fluorometry, and lipid analysis. This strain was deposited as CCCryo 531-19 at the Culture Collection of Cryophilic Algae in Germany.

2.3. Light and Electron Microscopy

Light microscopy (LM) was performed with an Olympus BX43 at 1000× magnification using oil immersion, equipped with Nomarski Contrast and an Olympus DP27 camera or digital camera DXM 1200F (Nikon, Melville, NY, USA), using cellSens Entry Imaging Software. Scanning and transmission electron microscopy (SEM and TEM) were carried out as described previously [20].

2.4. Isolation of DNA, PCR, Sequencing

DNA isolation was carried out with a DNeasy Plant Mini Kit (Qiagen, Germany), as in [20]. If less than 20 mg wet biomass was available, DNA was extracted using the Instagene Matrix Kit (Bio-Rad Laboratories, Hercules, CA, USA) according to [25]. The 18S small subunit ribosomal RNA gene (18S rDNA), internal transcribed spacer region 2 (ITS2 rDNA), and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) marker regions were amplified from DNA isolates by polymerase chain reaction (PCR) using existing primers (Table 2). Amplification reactions were described in [20]. PCR products were purified and sequenced using an Applied Biosystems automated sequencer (ABI 3730xl) at Macrogen Europe (Amsterdam, Netherlands). The obtained sequences of C. hindakii sp. nov. were submitted to NCBI Nucleotide sequence database (accession numbers at Table 3).

2.5. ITS2 rRNA Secondary Structure Prediction and Phylogenetic Analysis

The methods of annotation and prediction of the secondary structure of the nuclear rDNA ITS2 region were the same as in [20]. The secondary structure of nuclear rDNA ITS2 of C. hindakii sp. nov. was drawn using VARNA version 3.9 [32]. The 18S rDNA alignment contained 40 sequences (1567 bp) examined in previous studies [4,22], as well as three specimens of field-collected cysts and C. hindakii strain WP129 (= CCCryo 531-19); the rbcL matrix consisted of 37 sequences (924 bp), as well as four specimens of field-collected cysts and C. hindakii strain WP129 (= CCCryo 531-19); the mesophilic species of the genus Chloromonas sensu [33] or the Chloromonadinia clade [34] were selected as the outgroup. The best-fit nucleotide substitution model was estimated by jModeltest 2.0.1 [35]. Based on the Akaike Information Criterion, the GTR+I+G model was selected for 18rDNA. Three partitions were set for rbcL gene sequences and the following substitution models were applied: TIM1+I+G (first codon position), K80+I (second codon position), and GTR+I+G (third codon position). The 18S rDNA and rbcL phylogenetic trees were inferred by Bayesian inference (BI) and maximum likelihood (ML) according to [36], with the minor modification that Markov Chain Monte Carlo runs were carried out for three million generations in BI. Convergence of the two cold chains was checked by the average standard deviation of split frequencies (0.000533 and 0.00105 for 18S rDNA and rbcL dataset, respectively). Bootstrap analyses and Bayesian posterior probabilities were performed as described by [36].

2.6. Photosynthesis

In vivo chlorophyll fluorescence parameters were obtained with a pulse–amplitude modulated fluorometer (PAM 2000, Heinz Walz GmbH, Germany) in a 0.6 mL chamber and cooled with an ice bath to approximately 2 °C. To obtain the relative electron transport rates (rETR) and the light saturation point Ik, cells were exposed to photon flux densities (PFD) of 5, 9, 34, 67, 104, 201, 366, 622, 984, 1389, 1666, and 2018 µmol photons m−2 s−1 for 30 s each. Four independent replicates were measured. For further details, see [20].

2.7. Pigment Analysis

Carotenoids and chlorophylls were analyzed by HPLC (Agilent 1200 ChemStation) equipped with a quaternary pump and a diode array detector at 450 nm, using a reversed phase YMC C30 Carotenoids column (YMC Europe, Dinslaken, Germany), ID 300 mm × 4.6 mm at 25 °C. α-tocopherol was simultaneously measured with a fluorescence detector (Em/Ex = 295/325 nm). The flow rate was 1 mL min−1, analysis time was 20 min following an 8 min post-run prior next injection. The mobiles phases were (A) methanol (gradient grade), (B) methyl tert-butyl ether (MTBE; HPLC grade) with 1.3% deionized water (w/w), and (C) MTBE (HPLC grade). The linear solvent gradient was: From 0 to 4 min at 82% A, 18% B, from 4 to 12 min to 50% A, 0% B, 50% C, from 12 to 20 min to 20% A, 80% C. Post-run was 20% A, 0% B, 80% C from 20 to 23 min, from 23 to 24 min to 82% A, 18% B, and then kept for 4 min. Cells were lyophilized for 48 h and frozen at −25 °C prior use. Extraction was performed with a porcelain mortar and pestle (Z247464 and Z247502, Sigma-Aldrich), using liquid nitrogen for 2 min of precooling and during grinding of cells for 1 min. The cell powder (approximately 10–50 mg) was suspended in approximately 5 mL of chloroform/dichloromethane (2/1) with 1 mM BHT (butylated hydroxytoluene) as antioxidants, the suspension grinded for another minute, and then transferred with a glass pipette into 50 mL plastic tubes for a subsequent post-extraction for at least 12 h at −25 °C. Afterwards, the supernatant was gently evaporated at 30 °C and resuspended in a defined volume of organic solvents (usually 5 mL) composed of 82% mobile phase A and 18% mobile phase B. Prior to injection, the extracts were centrifuged for 10 min at 10,000× g and 1 °C. Peak identification was done by peak retention time and peak spectrum in relation to calibration standards (Sigma-Aldrich, Darmstadt, Germany).

2.8. Lipid Extraction and Fatty Acid Methyl Esters Analysis (FAMEs)

The extraction procedure was based on the method of [37], and elution was done from a Sep-Pak Vac Silica cartridge 35cc (Waters; 10 g normal-phase silica) by chloroform (neutral lipids), acetone (glycolipids), and methanol (phospholipids) [38]. All classes of lipids were saponified overnight in 10% KOH in methanol at room temperature. The structures of FAMEs were confirmed by comparison with Gas Chromatography/Mass Spectrometry retention times and fragmentation patterns with those of standard FAMEs (Supelco, Prague) method of [39,40]. Procedures were described in detail by [20].

3. Results

3.1. Habitat Conditions

In the High Tatra (Slovakia, Poland), and Krkonoše and Jeseníky Mountains (Czech Republic), orange snow fields were found in May and June 2017 and 2019 at altitudes from 984 to 2082 m a.s.l. (Figure 2, Table 1). The habitat conditions of these localities are shown in Table 4. The orange blooms occurred at open sites above timberline (snow surface: Samples “WP194”, “WP129”, “WP130”, “WP136”; for “LP06”, spots were visible at the surface but the main bloom was harvested at 3–5 cm depth), a semi-shaded site above timberline (close to a boulder, sample “NW”), below dwarf pines (“Rozcestí”). Below timberline, the species was found at open sites (at avalanche slopes, data not shown), semi-shaded (samples “DD2”, “Jes19-1”), and full-shaded sites (“Jes19-6”). For the purpose of rapid light curves measurements, a sample from high light conditions (WP194) and samples from low light conditions (LP06 and DD2) were investigated.

3.2. Maximal Population Density and Morphology of Field-Collected Cysts

The population densities reached from 19,950 to 79,100 orange cysts mL−1 meltwater (Table 4). Neither green nor orange flagellates were observed in the field material. Cell wall surfaces and intracellular organization were observed by light and electron microscopy (Figure 3). The fusiform cysts with wall surface structures corresponded to those of the aplanozygote of C. nivalis, as proposed by [41]. Cells were 18.5–34.3 µm long and 11.9–23.1 µm wide, with a length to width ratio of 1.2:1.9 (Figure S3). Typically, there were 7–10 flanges at the equatorial plane. Wall flanges were either straight or slightly undulating. SEM showed that four prominent flanges always joined at the apex and antapex of the cell, and these flanges ran from one pole to the other. Other wall flanges were shorter and terminated either isolated in the subapex zone, or less often, fused with another flanges. The cytoplasm was dominated by orange–reddish pigmented compartments. Mature cysts had small chloroplast discs (data not shown). The daughter cells within the cysts were smooth-walled (Figure 3e).

3.3. Phylogeny and Comparative Analysis of Internal Transcribed Spacer 2

The sequences of 18S rDNA and rbcL among the strain WP129 (= CCCryo 531-19) and field-collected cysts were identical. According to phylogenies of 18S rDNA (Figure 4) and rbcL (Figure 5), this species is a member of “Chloromonas clade B” sensu [4]. Chloromonas hindakii is related to Chloromonas nivalis Gassan-B (11 bp different out of 1650 bp in 18S rDNA), Chloromonas polyptera DRAnt023 (15 bp different out of 1653 bp in 18S rDNA), Scotiella cryophila K-1 (21 bp out of 1680 bp in 18S rDNA), and Chloromonas nivalis subsp. tatrae LP01 (34 bp out of 1683 bp in 18S rDNA). The new species formed a well supported subclade with other specimens of field cysts identified as Chloromonas nivalis P24/DR4 from the Austrian Alps and Chloromonas nivalis subsp. tatrae from the High Tatra Mountains (Slovakia) in 18S rDNA phylogeny. In contrast, the new species formed a well supported subclade together with Scotiella cryophila K-1 from the Austrian Alps in the rbcL phylogeny. Within all investigated samples (Table 3), the number of nucleotide differences in the entire ITS2 region ranged from 0 to 4 bp, and no compensatory base changes (CBCs) were detected (Figure 6). Conversely, one CBC was found between strain WP129 (= CCCryo 531-19) and an uncultured environmental clone ALBC6 from Switzerland (Figure S4), and between strain WP129 (= CCCryo 531-19) and Chloromonas nivalis Gassan-B from Japan (Figure S5), even near to the 5’ apex of III helix, the most conserved part of ITS2 [42].

3.4. Morphology of Vegetative Cells of Chloromonas hindakii sp. nov.

The strain consisted of green and solitary cells, bean-shaped with a rounded posterior end, 7–12.5 μm wide and 17–24.5 μm long (Figure 7). Cells had two equal flagella (if present) at the anterior end, a single chloroplast not fully occupying the posterior end of the protoplast (Figure 7a), two contractile vacuoles near the base of the flagella (Figure 7a), and the wall had no prominent anterior papilla (Figure 7b). The compact, elongated to slightly bean-shaped chloroplast had an emargination in the median region where the nucleus is usually located. The plastid was further lacking an eyespot and pyrenoids. The nucleus was almost spherical, located in the ventral half in the middle of the protoplast (Figure 7b). Asexual reproduction occurred via zoospore (autospore) formation. Generally, two, four, or rarely, eight daughter cells were produced within the parental wall (Figure 7c–e). Sexual reproduction was not observed in the culture, even under nitrogen starvation; nor was the formation of cysts or accumulation of secondary reddish pigments. For testing temperature preferences, cells of C. hindakii were exposed to 15 °C but started to decay after 2 weeks, whereas at 5 °C they grew well long-term, and likewise at 1 °C (data not shown).
Figure 7f shows an overview of a flagellate by TEM. The papilla was small and flattened (Figure 7g). Cytokinesis took place in equatorial position of the cell (Figure 7h), resulting either in two spherical cells surrounded by undulating cytoplasmatic membrane only (Figure 7i), or resulting in two elongated cells per sporangium with a prominent rough endoplasmic reticulum (indicating active metabolism). The daughter cells already possessed flagella (see an ultrastructure trait marked with “f”) (Transversal section, Figure 7j). Prior the release from the mother cell, the flagellates developed their own cell wall. The majority released flagellates were bean-shaped, but unusual spherical cells were also observed. Older, mature flagellates contained numerous small discoid chloroplasts with starch grains (Figure 7k).

3.5. Taxonomic Treatment

Chloromonas hindakii Procházková & Remias sp. nov. (Figure 3 and Figure 7)
DESCRIPTION: Vegetative cells solitary, having two equal flagella, two contractile vacuoles near the base of the flagella, a single chloroplast, single spherical nucleus positioned in the ventral half at the middle of the cell, without prominent anterior papilla. Cells elongate, kidney-shaped or bean-shaped with rounded posterior end; 7–11.5 µm wide and 17–24.5 µm long. A single chloroplast not occupying the posterior end of the protoplast and lacking eyespot and pyrenoid. Asexual reproduction by formation of two, four, or eight zoospores within the parental cell. Cell aggregates not observed in old cultures. Sexual reproduction unknown. Zygotes or cysts elongate to fusiform, 18.5–34.3 µm long and 11.9–23.1 µm wide, with length to width ratio within a range of 1.2–1.9. Cell walls with rib-like surface structures, such flanges are either straight or slightly undulating. Four prominent flanges always join at the apex and antapex of the cell, and they run entirely from one pole to the other. Further wall flanges are shorter, i.e., terminating either isolated at the subapical zone or less often fusing with another flange, or representing solitary flanges. The cytoplasm of cysts or zygotes usually contains reddish carotenoid droplets. The species differs from any other described representatives of the genus Chloromonas in the nuclear 18S rDNA, ITS rDNA, and plastid rbcL gene sequences (accession numbers: MN251865, MN251865, and MN251877, respectively).
HOLOTYPE: Specimen WP129 deposited at the Culture Collection of Algae of Charles University in Prague (CAUP), Czech Republic; material consists of resin-embedded vegetative cells from culture strain WP129.
AUTHENTIC STRAIN: WP129. The strain was deposited at the Culture Collection of Cryophilic Algae (CCCryo, Available online: http://cccryo.fraunhofer.de/web/strains) in Potsdam, Germany, as a living culture, strain number CCCryo 531-19.
TYPE LOCALITY: N49°11.424 E20°03.153, snowfield at Dolina za Mnichem, High Tatra Mountains, Powiat tatrzański, Bukowina Tatrzańska, Lesser Poland, Poland.
OTHER DISTRIBUTIONS: High Tatra Mountains (Slovakia), and Krkonoše and Jeseníky Mountains (Czech Republic).
ETYMOLOGY: The species epithet ‘hindakii’ is in memoriam to Prof. František Hindák (1937–2019), a Slovak phycologist with influential contributions on microscopic algae. He described many new genera and species, including snow algae (e.g., [43,44]), and was one of the pioneers in successfully cultivating snow algae at laboratory conditions [45].

3.6. Photosynthesis

The photosynthetic activity of C. hindakii sampled at locations with different light conditions was tested and rapid light curves generated (Figure 8). Additionally, the performance of field cysts was compared with the laboratorial strain. Generally, the cysts were not dormant in terms of photosynthesis, as indicated by rETR. For the strain, and field cysts from low light conditions (below dwarf pine or 5 cm below the snow surface at a site above timberline), photoinhibition occurred above 200 μmol PAR m−2 s−1. The strain showed an α value of 0.23, a relative ETRmax of 6.6 ± 2.3, and an Ik value of 33 ± 8 μmol PAR m−2 s−1. Field cysts from low light conditions had one-quarter lower alpha values (0.17 and 0.16) and two-fold higher Ik (73 and 78). In contrast, cysts from the snow surface above timberline (i.e., high light conditions) showed later signs of photoinhibition, starting from three times higher irradiances (600 μmol photons m−2 s−1); they also showed a two-fold higher ETRmax (14.5 ± 1) and four times higher Ik (129 ± 27), but a nearly twice lower α (0.13), when compared to the strain.

3.7. Pigment Composition

The orange pigmentation of cysts of C. hindakii was caused by the secondary (non-plastid) carotenoid astaxanthin. Its abundance and those of other pigments and α-tocopherol was calculated in reference to chlorophyll-a (Table 5). Astaxanthin comprised 19.8% and 22.1% of all pigments, respectively (WP194, LP06). At HPLC, it occurred in a range of several peaks with identical absorption spectra, all of them likely esters with different fatty acids (Figure S6). Chlorophylls (a and b) comprised 57.7% and 57.6% of all pigments, primary (plastid) carotenoids represented 22.5% and 20.3% of the pigment pool. The overall ratio of cysts for astaxanthin to chl-a was 0.4 and 0.5, respectively. Further details are given in Table 5. In contrast, the laboratorial strain always stayed green (data not shown).

3.8. Fatty Acid (FA) Composition

The relative content of FAs (percentage of total lipids and percentage of the three major lipid groups) in C. hindakii is given in Table 6. FAs with 14 to 18 C prevailed in field cysts and the strain (WP129). Cells showed high levels of PUFAs (65.8% and 58.1%, respectively, of total lipids), whereas the content of saturated acids (SAFA) did not exceed 23% (mainly palmitic acid, 16:0). The main monounsaturated fatty acid (MUFA) was oleic acid (18:1 (9Z), 9.8 ± 3.6% and 9.4%). The major PUFAs were identical for field cysts and the strain flagellates but differed in relative proportions. The dominant PUFA was α-linolenic acid (18:3 (9Z,12Z,15Z), 25.9 ± 3.7% and 31.6%, respectively). Flagellates had three times higher content of hexadecatetraenoic acid (16:4 (4Z,7Z,11Z,13Z), 28.5 ± 4.6%) than cysts (10.3%) and similar levels of steariadonic acid (18:4 (6Z,9Z,12Z,15Z), 5.9 ± 0.2 and 4.7%). Only minor differences in the FA composition between the three lipid classes of vegetative flagellates were observed (Table 6). PUFAs dominated the neutral lipids, phospholipids, and glycolipids (63.8%, 65.1%, and 75%, respectively). α-linolenic acid was up to twice higher in phospholipids than in neutral and glycolipids.

4. Discussion

4.1. Geographic Distribution and Ecology

Based on the discoveries in several mountain ranges of Poland, Slovakia, and the Czech Republic, C. hindakii sp. nov. seems to be a common member of the local cryoflora. Remarkably, it causes orange blooms both below and above timberline, contrary to many other snow algae, which usually thrive either in exposed or shaded habitats. The distribution of the species, at altitudinal gradient, ranged from montane to subalpine and alpine vegetation belt; e.g., for Krkonoše Mountains, see [47] (p. 271). The discoloration may vary; along with lower population densities, the snow was once reported to be pinkish [48]. A further, hitherto unidentified snow alga with eyespot and prominent cellular tail from the same sampling region reported as ´C. nivalis´ [48] is not in accordance to the morphology of C. hindakii (compare Figure 2b,c in [48] to Figure 7a,b in this study). However, in the study of [48], cysts morphologically identical to C. hindakii were found in Krkonoše at a wide altitudinal gradient from 740 to 1545 m a.s.l., at shaded (broad leaf and spruce trees) as well as at open sites (assigned to C. nivalis, see Figure 2e–g in [48]). Moreover, C. hindakii may occur also in other mountains in Slovakia [49]. Moreover, it may be found in the Bulgarian Vitosha Mountains, since [50] reported morphologically corresponding cysts in term of cell size, prominent cell apexes, and number and organization of longitudinal cell wall flanges. The overall geographic distribution of C. hindakii, including further regions like the European Alps, is not known yet, but distinct morphologic traits reported in this study and deposited molecular marker sequences should help for a future correct recognition.

4.2. Taxonomy and Related Species

To our knowledge, the vegetative strain of C. hindakii is the first available with a “C. nivalis-like” morphology of cysts (fusiform cells with prominent cell wall flanges) within the Chloromonas ‘snow clade B’ (sensu [4]). In many cases for snow algae, cysts were not made to germinate for generating a flagellate culture. Comparative analysis of the ITS2 rRNA secondary structure showed that C. hindakii is closely genetically related to an uncultured environmental clone, ALBC6, from a glacier forefield in Switzerland (accession number JX435348, [51]) and to C. nivalis Gassan-B from snow in Japan (accession number LC012758, [52]), indicating that the closest relatives also thrive in cold habitats. However, by using solely light microscopy, the cysts of C. hindakii have probably been reported several times as those of C. nivalis (as “Scotiella nivalis”) in the Krkonoše [48,53,54,55,56] and High Tatra Mountains [49,57,58,59,60]. On the other hand, this is the first report about cryoflora from the Jeseníky Mountains. By the help of electron microscopy and molecular methods, it was possible to describe this new species out of the “collective” taxon C. nivalis. This goes along with the description of further new snow algae like C. hoshawii or C. remiasii, which were formerly assigned to C. nivalis as well [61].

4.3. Morphology of the Field Cysts

Field-collected cysts in snow identifiable by LM as the cosmopolitan taxon C. nivalis were recently shown to represent multiple species [61]. Detailed morphological comparisons of the cyst (i.e., cell wall flanges distribution and characterization [20]) and flagellates [61] is crucial for classical species determination. Morphologically, cysts of C. hindakii differ from its close molecular relative Scotiella cryophila K-1 in having significantly less elongated cysts (the latter has length to width ratios from 2.1 to 4.7 [22]). Moreover, C. hindakii cysts differ from genetically distinct C. nivalis in the Austrian Alps [18], and C. nivalis subsp. tatrae [20] in the High Tatras in their cell size (larger cysts) and more prominent cell wall flanges. The number of cell wall flanges when observed at equatorial position is lower for the new species compared to C. nivalis subsp. tatrae (the latter has (9)10 to 12(14) flanges). These two species co-occurred occasionally in the High Tatra Mountains (own observations). Aplanozygotes of C. nivalis from North America [41] possess a lower number of flanges at cross-section (six to eight), are similarly large (16–37 μm × 10–27 μm), but lack fusing/diverting flanges apart from the apex; however, here are no sequences available for these cysts yet. In addition, the identity of several vegetative Chloromonas strains isolated from the collection sites of C. nivalis in North America [41] is still unknown, and morphological details of their source material are missing (i.e., UTEX SNO16, UTEX SNO17, UTEX SNO18, UTEX SNO19, and UTEX SNO21). Matsuzaki et al. [4] reported for C. muramotoi a regular cell wall flange organization (i.e., four long flanges reached to both poles of the cell) similar to C. hindakii; however, C. muramotoi can be discriminated by its markedly smaller cell sizes (9.1–13.4 μm wide and 15.6–22.4 μm long). Moreover, a bifurcation of wall flanges was not observed for C. muramotoi and shorter flanges were only medially located (i.e., not reaching subapical cell regions). In this aspect, the new species is somehow similar to another snow alga, C. miwae, which, however, is smaller (10–16 μm wide and 20–26 μm long) and lacks visible accumulation of secondary carotenoids [52]. Mature cysts of C. hindakii have small chloroplast discs like all other cysts of Chloromonas species dwelling in snow (e.g., see chloroplast shape in Figure 22 in [20]). To conclude, it is generally possible to distinguish the cysts of C. hindakii morphologically from cysts of other snow algae.

4.4. Morphology of the Strain and Context to C. nivalis

The vegetative flagellates of C. hindakii differ from the five other most similar looking elongate to bean-shaped Chloromonas species isolated from snow as follows: The chloroplast of C. hindakii does not occupy the posterior ending of the protoplast, in contrast to C. krienitzii [52]. C. hindakii is larger in size than C. fukushimae when kept at the same cultivation conditions (4–9 µm × 15–23 µm; [62]) and develops only rarely eight zoospores in zoosporangia. Large cell aggregates were not observed in old cultures of Chloromonas hindakii in opposition to Chloromonas polyptera, where aggregates are made up of more than 16 cells [63]. Chloromonas hindakii differs in chloroplast morphology from C. rostafinskii—the latter has a cup-shaped chloroplast [64]. Chloromonas hindakii differs from Chloromonas rubroleosa in papilla shape and number of contractile vacuoles near the base of flagella—the latter has prominent bimamillate papilla and four contractile vacuoles [65]. Additionally, the vegetative morphology of C. hindakii is different from species not possessing bean-shaped flagellates, such as the North American strain UTEX SNO71 [4], which was recently proposed to represent the ‘true’ C. nivalis [4,41]. The latter has tear drop-shaped flagellates with a prominent posterior end. However, Robert Chodat´s type locality of C. nivalis in France close to Mont Blanc has not yet been resurveyed for revealing the molecular identity of its population. Moreover, in the original description the flagellate morphology is missing [66]. Recent molecular data suggest that species with a C. nivalis-like morphology of cysts evolved several times in the history of snow-thriving Chloromonas species [4,52,61].

4.5. Photobiology of Field Cysts vs. Laboratorial Strain

The rapid light curves from different habitats showed a high intraspecific flexibility of C. hindakii in terms of light acclimation, reflecting the occurrence in semi-shaded locations close to spruce canopy, below dwarf pine vegetation, as well as in exposed sites above timberline. This likely indicates the capabilities of the photosynthetic apparatus in regard to changeable short- and long-term incident irradiations, such as (a) diurnal changes due to topographic or/and vegetation shadings [48], (b) the distance of the cells from the snow surface during melting season [16], and (c) actual weather situation (e.g., sunny vs. cloudy day; [67]).
The fluorometric measurements of cysts showed that the photosystem II was well adapted to medium-to-high levels of irradiation. The cysts from the high light conditions (red graph in Figure 8) became photoinhibited at much higher irradiances than cysts from low light conditions (blue and orange graphs in Figure 8) or the laboratory strain, which was grown at low-light conditions (green graph in Figure 8). At open sites, at a snow depth of 20 cm, usually less than 5% of incident irradiation may be available [15]. Thus, in case of this study, the cysts found at an alpine location 5 cm below snow surface (sample LP06) perceived similarly low PAR like the cells at snow surface below spruce canopy (sample DD2). As a consequence, the characteristics of the rapid light curves (i.e., alpha, Ik and ETR values) of cells from these two different shaded sites are similar, which indicates that acclimation of the photosynthesis to certain snow depths is similar for C. hindakii with acclimation to a snow surface at semi-shaded site. Semi-shaded sites below timberline differ from open sites above timberline in the amplitude of PAR; for the former in the Krkonoše Mountains it reaches up to ~1300 µmol photons m2 s−1 [48]. In contrast, the cysts from open alpine sites (sample WP194) in the High Tatra Mountains were exposed to PAR exceeding 2000 µmol photon m2 s−1 (see Supplementary Figure S27 in [16]). Likewise, other species were still able to perform positively at such high irradiances, and the light saturation (optimal) irradiance (i.e., Ik) of C. hindakii was nearly as high as those for cysts of C. nivalis and C. nivalis subsp. tatrae, causing reddish/brownish snow [18,20]. In contrast, the strain of C. hindakii exhibited a similarly low Ik and high light utilization efficiency (alpha value) to those recorded for cysts of the snow alga Scotiella cryophila caused green subsurface stripes at a depth of 20 cm below the snow surface [22]. In other words, photosynthesis was adapted to low light conditions. The high intraspecific flexibility of C. hindakii’s response to different light conditions allows this species to colonize, respectively survive at changeable conditions in snow.

4.6. Pigments and Fatty Acid Composition

The average levels of astaxanthin that cause the reddish coloration of C. hindakii are comparable to mature cysts of C. nivalis from the Austrian Alps [18]. Still, the astaxanthin to chlorophyll a ratio is three times lower than for C. nivalis subsp. tatrae from exposed sites at the High Tatras [20]. The main role of astaxanthin is likely to act as sunscreen against excessive visible and harmful UV irradiation. On the other hand, too much astaxanthin would shade the plastids too much, thus decreasing the photosynthetic performance at sites with lower irradiation levels. Apparently, this species has developed a compromise. Probably, the accumulation of astaxanthin reflects the extent of endogenous cyst maturation, regardless of whether the cells are found at high light or at low light conditions (i.e., WP194 had similar astaxanthin to chl-a ratio like LP06). The laboratorial strain of C. hindakii produces no astaxanthin (data not shown), different to other microalgae feasible for biotechnology [68].
With the same protocol as for pigments, the plastid antioxidant α-tocopherol was quantified. The cysts of C. hindakii showed one magnitude higher concentrations than C. nivalis from the Austrian Alps [18], but the quantities were similarly low to cells that cause red snow (Sanguina nivaloides, referred as Chlamydomonas nivalis in [23]). The accumulation of vitamin E was reported to increase during the maturation process of Chlainomonas sp. cysts under harsh environmental conditions in the late melting season [16].
In both stages, the strain and the field cysts of C. hindakii had a high level of PUFAs, which is regarded as an adaptation to cold conditions [69]. High levels of PUFAs are common also for other snow-dwelling Chloromonas species (e.g., see FAs composition in Table 5 in [20]) and algae living in other cold habitats such as lake ice [70]. Hexadecatetraenoic acid was present in flagellates of C. hindakii at relatively high levels of total FAs (~30%); its production in C. hindakii was the same as in a strain of C. remiasii CCCryo 005-99 isolated from snow in the Arctic and kept under nitrogen deficient conditions [71]. A likewise high accumulation of hexadecatetraenoic acid was found in edible marine macroalgae Undularia pinnatifida and Ulva pertusa [72]. This fatty acid extracted from algae was shown to have physiological effects on the human health [73]; it inhibited production of leukotrienes involved in several inflammatory and allergic reactions (e.g., [74]). What is more, alpine and polar microalgal strains are promising candidates for biotechnology [75], also in outdoor bioreactors at low temperature conditions [76]. Higher levels of saturated palmitic acid and monounsaturated oleic acid in C. hindakii correspond to similar amounts found in other strains of genus Chloromonas [77].

5. Conclusions

Molecular phylogenetic assays, in combination with morphological observation of cysts (likely zygotes) and vegetative flagellates, demonstrated that C. hindakii is a new species within a group of morphologically and taxonomically closely related cryoflora phytoflagellates, and most of them were formerly associated with the collective taxon C. nivalis. An unialgal vegetative strain with motile flagellates was established from field-collected cysts under suitable laboratorial conditions simulating the temperature of melting snow. For further detail in physiological, cytological, or closer molecular investigations, a clonal strain should be derived from a single cell. C. hindakii occurred at very different altitudes from the montane belt to subalpine and alpine locations of mid-latitude mountains, and it exhibited an infraspecific photosynthetic flexibility accordingly. This study shows for the first time for a snow alga that populations from high light conditions get photoinhibited at higher irradiances than those harvested from low light conditions. The physiologic light preferences reflected the light conditions in the original habitat. PUFAs prevailed in the lipids of C. hindakii, and astaxanthin was the pigment responsible for the orange coloration of the snow bloom. Generally, the response of a cold-adapted alga exposed to different light conditions can be investigated, along with screening which responses are activated (e.g., effect on pigments, proteins), as done for Koliella antarctica [78]. In future, the intraspecific variability among populations of other snow algae and its relation to the incident irradiation may be tested.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2607/7/10/434/s1

Author Contributions

Conceptualization, L.P., D.R., and L.N.; data curation, L.P.; formal analysis, L.P.; funding acquisition, D.R. and L.N.; investigation, L.P., D.R., and T.Ř.; methodology, L.P. and D.R.; project administration, D.R. and L.N.; resources, L.P., D.R., and L.N.; supervision, L.N.; visualization, L.P.; writing—original draft, L.P.; writing—review and editing, L.P. and D.R.

Funding

This research was funded by the Czech Science Foundation (GACR) projects 18-02634S granted to L.N. and L.P., 17-00027S granted to T.Ř., and by the Austrian Science Fund (FWF) project P29959 granted to D.R.

Acknowledgments

We are grateful to David Kaftan for assistance in the field, and to Tomáš Hájek for technician support (both: University of South Bohemia in České Budějovice, Czech Republic). Open Access Funding by the Austrian Science Fund (FWF).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Davey, M.P.; Norman, L.; Sterk, P.; Huete-Ortega, M.; Bunbury, F.; Loh, B.K.W.; Stockton, S.; Peck, L.S.; Convey, P.; Newsham, K.K.; et al. Snow algae communities in Antarctica—Metabolic and taxonomic composition. New Phytol. 2019, 222, 1242–1255. [Google Scholar] [CrossRef]
  2. Anesio, A.M.; Lutz, S.; Chrismas, N.A.M.; Benning, L.G. The microbiome of glaciers and ice sheets. NPJ Biofilms Microbiomes 2017, 3, 10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Cvetkovska, M.; Hüner, N.P.A.; Smith, D.R. Chilling out: The evolution and diversification of psychrophilic algae with a focus on Chlamydomonadales. Polar Biol. 2017, 40, 1169–1184. [Google Scholar] [CrossRef]
  4. Matsuzaki, R.; Nozaki, H.; Takeuchi, N.; Hara, Y.; Kawachi, M. Taxonomic re-examination of “Chloromonas nivalis (Volvocales, Chlorophyceae) zygotes” from Japan and description of C. muramotoi sp. nov. PLoS ONE 2019, 14, e0210986. [Google Scholar] [CrossRef] [PubMed]
  5. Procházková, L.; Leya, T.; Křížková, H.; Nedbalová, L. Sanguina nivaloides and Sanguina aurantia gen. et spp. nov. (Chlorophyta): The taxonomy, phylogeny, biogeography and ecology of two newly recognised algae causing red and orange snow. FEMS Microbiol. Ecol. 2019, 95, fiz064. [Google Scholar] [CrossRef] [PubMed]
  6. Vimercati, L.; Solon, A.J.; Krinsky, A.; Arán, P.; Porazinska, D.L.; Darcy, J.L.; Dorador, C.; Schmidt, S.K. Nieves penitentes are a new habitat for snow algae in one of the most extreme high-elevation environments on Earth. Arct. Antarct. Alp. Res. 2019, 51, 190–200. [Google Scholar] [CrossRef] [Green Version]
  7. Terashima, M.; Umezawa, K.; Mori, S.; Kojima, H.; Fukui, M. Microbial community analysis of colored snow from an alpine snowfield in Northern Japan reveals the prevalence of Betaproteobacteria with snow algae. Front. Microbiol. 2017, 8, 1481. [Google Scholar] [CrossRef] [PubMed]
  8. Brown, S.P.; Olson, B.J.S.C.; Jumpponen, A. Fungi and algae co-occur in snow: An issue of shared habitat or algal facilitation of heterotrophs? Arct. Antarct. Alp. Res. 2015, 47, 729–749. [Google Scholar] [CrossRef]
  9. Bidigare, R.R.; Ondrusek, M.E.; Kennicutt II, M.C.; Iturriaga, R.; Harvey, H.R.; Hoham, R.W.; Macko, S.A. Evidence for a photoprotective function for secondary carotenoids of snow algae. J. Phycol. 1993, 29, 427–434. [Google Scholar] [CrossRef]
  10. Hamilton, T.L.; Havig, J. Primary productivity of snow algae communities on stratovolcanoes of the Pacific Northwest. Geobiology 2017, 15, 280–295. [Google Scholar] [CrossRef]
  11. Thackeray, C.W.; Derksen, C.; Fletcher, C.G.; Hall, A. Snow and climate: Feedbacks, drivers, and indices of change. Curr. Clim. Chang. Rep. 2019, 1–12. [Google Scholar] [CrossRef]
  12. Mudryk, L.R.; Kushner, P.J.; Derksen, C.; Thackeray, C. Snow cover response to temperature in observational and climate model ensembles. Geophys. Res. Lett. 2017, 44, 919–926. [Google Scholar] [CrossRef]
  13. Marty, C.; Schlögl, S.; Bavay, M.; Lehning, M. How much can we save? Impact of different emission scenarios on future snow cover in the Alps. Cryosphere 2017, 11, 517–529. [Google Scholar] [CrossRef] [Green Version]
  14. Morgan-Kiss, R.M.; Priscu, J.C.; Pocock, T.; Gudynaite-Savitch, L.; Huner, N.P.A. Adaptation and acclimation of photosynthetic microorganisms to permanently cold environments. Microbiol. Mol. Biol. R. 2006, 70, 222–252. [Google Scholar] [CrossRef] [PubMed]
  15. Gorton, H.L.; Vogelmann, T.C. Ultraviolet radiation and the snow alga Chlamydomonas nivalis (Bauer) Wille. Photochem. Photobiol. 2003, 77, 608–615. [Google Scholar] [CrossRef]
  16. Procházková, L.; Remias, D.; Holzinger, A.; Řezanka, T.; Nedbalová, L. Ecophysiological and morphological comparison of two populations of Chlainomonas sp. (Chlorophyta) causing red snow on ice-covered lakes in the High Tatras and Austrian Alps. Eur. J. Phycol. 2018, 53, 230–243. [Google Scholar] [CrossRef] [PubMed]
  17. Remias, D. Cell structure and physiology of alpine snow and ice algae. In Plants in Alpine Regions. Cell physiology of Adaption and Survival Strategies; Lütz, C., Ed.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 175–186. [Google Scholar]
  18. Remias, D.; Karsten, U.; Lűtz, C.; Leya, T. Physiological and morphological processes in the Alpine snow alga Chloromonas nivalis (Chlorophyceae) during cyst formation. Protoplasma 2010, 243, 73–86. [Google Scholar] [CrossRef] [PubMed]
  19. Remias, D.; Wastian, H.; Lütz, C.; Leya, T. Insights into the biology and phylogeny of Chloromonas polyptera (Chlorophyta), an alga causing orange snow in Maritime Antarctica. Antarct. Sci. 2013, 25, 648–656. [Google Scholar] [CrossRef]
  20. Procházková, L.; Remias, D.; Řezanka, T.; Nedbalová, L. Chloromonas nivalis subsp. tatrae, subsp. nov. (Chlamydomonadales, Chlorophyta): Re–examination of a snow alga from the High Tatra Mountains (Slovakia). Fottea 2018, 18, 1–18. [Google Scholar]
  21. Kvíderová, J.; Stibal, M.; Nedbalová, L.; Kaštovská, K. The first record of snow algae vitality in situ by variable fluorescence of chlorophyll. Czech Phycol. 2005, 5, 69–77. [Google Scholar]
  22. Remias, D.; Procházková, L.; Holzinger, A.; Nedbalová, L. Ecology, cytology and phylogeny of the snow alga Scotiella cryophila K-1 (Chlamydomonadales, Chlorophyta) from the Austrian Alps. Phycologia 2018, 57, 581–592. [Google Scholar] [CrossRef] [PubMed]
  23. Remias, D.; Lütz-Meindl, U.; Lütz, C. Photosynthesis, pigments and ultrastructure of the alpine snow alga Chlamydomonas nivalis. Eur. J. Phycol. 2005, 40, 259–268. [Google Scholar] [CrossRef]
  24. Bischoff, H.W.; Bold, H.C. Phycological studies. IV. Some soil algae from Enchanted Rock and related algal species. Univ. Texas Publ. 1963, 6318, 95. [Google Scholar]
  25. Remias, D.; Pichrtová, M.; Pangratz, M.; Lütz, C.; Holzinger, A. Ecophysiology, secondary pigments and ultrastructure of Chlainomonas sp. (Chlorophyta) from the European Alps compared with Chlamydomonas nivalis forming red snow. FEMS Microbiol. Ecol. 2016, 92, fiw030. [Google Scholar] [CrossRef] [PubMed]
  26. Piercey-Normore, M.D.; DePriest, P.T. Algal switching among lichen symbioses. Am. J. Bot. 2001, 88, 1490–1498. [Google Scholar] [CrossRef] [PubMed]
  27. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA Genes for phylogenetics. In PCR Protocols—A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; Volume 18, pp. 315–322. [Google Scholar]
  28. Helms, G.; Friedl, T.; Rambold, G.; Mayrhofer, H. Identification of photobionts from the lichen family Physiaceae using algal-specific ITS rDNA sequencing. Lichenologist 2001, 33, 73–86. [Google Scholar] [CrossRef]
  29. Vilgalys, R.; Hester, M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptoccocus species. J. Bacteriol. 1990, 172, 4238–4246. [Google Scholar] [CrossRef]
  30. Katana, A.; Kwiatowski, J.; Spalik, K.; Zakryś, B.; Szalacha, E.; Szymańska, H. Phylogenetic position of Koliella (Chlorophyta) as inferred from nuclear and chloroplast small subunit rDNA. J. Phycol. 2001, 37, 443–451. [Google Scholar] [CrossRef]
  31. Hoham, R.W.; Bonome, T.A.; Martin, C.W.; Leebens-Mack, J.H. A combined 18S rDNA and rbcL phylogenetic analysis of Chloromonas and Chlamydomonas (Chlorophyceae, Volvocales) emphasizing snow and other cold-temperature habitats. J. Phycol. 2002, 38, 1051–1064. [Google Scholar] [CrossRef]
  32. Darty, K.; Denise, A.; Ponty, Y. VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 2009, 25, 1974–1975. [Google Scholar] [CrossRef] [Green Version]
  33. Pröschold, T.; Marin, B.; Schlösser, U.G.; Melkonian, M. Molecular phylogeny and taxonomic revision of Chlamydomonas (Chlorophyta). I. Emendation of Chlamydomonas Ehrenberg and Chloromonas Gobi, and description of Oogamochlamys gen. nov. and gen. nov. and Lobochlamys gen. nov. Protist 2001, 152, 265–300. [Google Scholar] [CrossRef]
  34. Nakada, T.; Misawa, K.; Nozaki, H. Molecular systematics of Volvocales (Chlorophyceae, Chlorophyta) based on exhaustive 18S rRNA phylogenetic analyses. Mol. Phylogenet. Evol. 2008, 48, 281–291. [Google Scholar] [CrossRef] [PubMed]
  35. Posada, D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef] [PubMed]
  36. Nedbalová, L.; Mihál, M.; Kvíderová, J.; Procházková, L.; Řezanka, T.; Elster, J. Identity, ecology and ecophysiology of planktic green algae dominating in ice-covered lakes on James Ross Island (northeastern Antarctic Peninsula). Extremophiles 2017, 21, 187–200. [Google Scholar] [CrossRef] [PubMed]
  37. Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Phys. 1959, 37, 911–917. [Google Scholar] [CrossRef]
  38. Saunders, R.D.; Horrocks, L.A. Simultaneous extraction and preparation for high-performance liquid chromatography of prostaglandins and phospholipids. Anal. Biochem. 1984, 143, 71–75. [Google Scholar] [CrossRef]
  39. Řezanka, T. Identification of very long polyenoic acids as picolinyl esters by Ag+ ion-exchange high-performance liquid chromatography, reversed-phase high-performance liquid chromatography and gas chromatography—mass spectrometry. J. Chromatogr. A 1990, 513, 344–348. [Google Scholar] [CrossRef]
  40. Dembitsky, V.M.; Řezanka, T.; Bychek, I.A.; Shustov, M.V. Identification of fatty acids from Cladonia lichens. Phytochemistry 1991, 30, 4015–4018. [Google Scholar] [CrossRef]
  41. Hoham, R.W.; Mullet, J.E. The life history and ecology of the snow alga Chloromonas cryophila sp. nov. (Chlorophyta, Volvocales). Phycologia 1977, 16, 53–68. [Google Scholar] [CrossRef]
  42. Coleman, A.W. Pan-eukaryote ITS2 homologies revealed by RNA secondary structure. Nucleic Acids Res. 2007, 35, 3322–3329. [Google Scholar] [CrossRef] [Green Version]
  43. Hindák, F. Brownish snow in the High Tatras. Biologia 1969, 80–85. [Google Scholar]
  44. Javornický, P.; Hindák, F. Cryptomonas frigoris spec. nova (Cryptophyceae), the new cyst-forming flagellate from the snow of the High Tatras. Biologia 1970, 25, 241–250. [Google Scholar] [PubMed]
  45. Hindák, F.; Komárek, J. Cultivation of cryosestonic alga Koliella (Kol) Hind. Biol. Plant. 1968, 10, 95–97. [Google Scholar] [CrossRef]
  46. Walsby, A.E. Modelling the daily integral of photosynthesis by phytoplankton: Its dependence on the mean depth of the population. Hydrobiologia 1997, 349, 65–74. [Google Scholar] [CrossRef]
  47. Chytrý, M. Current Vegetation of the Czech Republic. In Flora and Vegetation of the Czech Republic; Chytrý, M., Danihelka, J., Kaplan, Z., Pyšek, P., Eds.; Springer: Cham, Switzerland, 2017; pp. 229–337. [Google Scholar]
  48. Nedbalová, L.; Kociánová, M.; Lukavský, J. Ecology of snow algae in the Giant Mts. Opera Corcon. 2008, 45, 59–68. [Google Scholar]
  49. Hanzelová, M.; Vido, J.; Škvarenina, J.; Nalevanková, P.; Perháčová, Z. Microorganisms in summer snow patches in selected high mountain ranges of Slovakia. Biologia 2018, 73, 1177–1186. [Google Scholar] [CrossRef]
  50. Lukavský, J.; Furnadzhieva, S.; Nedbalová, L. First record of cryoseston in the Vitosha Mountains (Bulgaria). Nova Hedwig. 2009, 88, 97–110. [Google Scholar] [CrossRef]
  51. Frey, B.; Bühler, L.; Schmutz, S.; Zumsteg, A.; Furrer, G. Molecular characterization of phototrophic microorganisms in the forefield of a receding glacier in the Swiss Alps. Environ. Res. Lett. 2013, 8, 15033. [Google Scholar] [CrossRef]
  52. Matsuzaki, R.; Kawai-Toyooka, H.; Hara, Y.; Nozaki, H. Revisiting the taxonomic significance of aplanozygote morphologies of two cosmopolitan snow species of the genus Chloromonas (Volvocales, Chlorophyceae). Phycologia 2015, 54, 491–502. [Google Scholar] [CrossRef]
  53. Kociánová, M.; Štursová, H.; Štursa, J.; Vaněk, J.; Vávra, V. Nové nálezy červeného sněhu v Krkonoších. [New records of red snow in the Krkonoše Mountains]. Opera Corcon. 1989, 26, 151–158. [Google Scholar]
  54. Stibal, M. Ecological and physiological characteristics of snow algae from Czech and Slovak mountains. Czech Phycol. 2003, 3, 141–152. [Google Scholar]
  55. Komárek, J.; Nedbalová, L. Green cryosestic algae. In Algae and Cyanobacteria in Extreme Environments; Seckbach, J., Ed.; Springer: Berlin/Heidelberg, Germany, 2007; pp. 321–342. [Google Scholar]
  56. Jehlička, J.; Culka, A.; Nedbalová, L. Colonization of snow by microorganisms as revealed using miniature Raman spectrometers—Possibilities for detecting carotenoids of psychrophiles on Mars? Astrobiology. 2016, 16, 1–12. [Google Scholar] [CrossRef] [PubMed]
  57. Lukavský, J. Algal flora of lakes in the High Tatra Mountains (Slovakia). Hydrobiologia 1994, 274, 65–74. [Google Scholar] [CrossRef]
  58. Kol, E. Cryobiological researches in the High Tatra I. Acta Bot. Hung. 1975, 21, 61–75. [Google Scholar]
  59. Kol, E. Cryobiological researches in the High Tatra II. Acta Bot. Hung. 1975, 21, 279–287. [Google Scholar]
  60. Osterrothová, K.; Culka, A.; Němečková, K.; Nedbalová, L.; Procházková, L.; Jehlička, J. Analyzing carotenoids of snow algae by Raman microspectroscopy and high-performance liquid chromatography. Spectrochim. Acta Part A 2019, 212, 262–271. [Google Scholar] [CrossRef] [PubMed]
  61. Matsuzaki, R.; Nozaki, H.; Kawachi, M. Taxonomic revision of Chloromonas nivalis (Volvocales, Chlorophyceae) strains, with the new description of two snow-inhabiting Chloromonas species. PLoS ONE 2018, 13, e0193603. [Google Scholar] [CrossRef]
  62. Matsuzaki, R.; Hara, Y.; Nozaki, H. A taxonomic study of snow Chloromonas species (Volvocales, Chlorophyceae) based on light and electron microscopy and molecular analysis of cultured material. Phycologia 2014, 53, 293–304. [Google Scholar] [CrossRef]
  63. Ling, H.U.; Seppelt, R.D. Snow algae of the Windmill Islands, continental Antarctica. 3. Chloromonas polyptera (Volvocales, Chlorophyta). Polar Biol. 1998, 20, 320–324. [Google Scholar] [CrossRef]
  64. Starmach, K.; Kawecka, B. The yellowish-green snow in the valley Za Mnichem in the Tatra Mountains. Limnol. Investig. Tatra Mt. Dunajec River Basin 1965, 11, 75–80. [Google Scholar]
  65. Ling, H.U.; Seppelt, R.D. Snow algae of the Windmill Islands, continental Antarctica. 2. Chloromonas rubroleosa sp. nov. (Volvocales, Chlorophyta), an alga of red snow. Eur. J. Phycol. 1993, 28, 77–84. [Google Scholar] [CrossRef]
  66. Chodat, R. Algues vertes de la Suisse, A. Pleurococcoïdes–Chroolépoïdes; K.J.Wyss: Berne, Switzerland, 1902; pp. 145–146. [Google Scholar]
  67. Stibal, M.; Elster, J. Seasonal and diel changes in photosynthetic activity of the snow alga Chlamydomonas nivalis (Chlorophyceae) from Svalbard determined by pulse amplitude modulation fluorometry. FEMS Microbiol. Ecol. 2007, 59, 265–273. [Google Scholar] [CrossRef] [PubMed]
  68. Molino, A.; Iovine, A.; Casella, P.; Mehariya, S.; Chianese, S.; Cerbone, A.; Rimauro, J.; Musmarra, D. Microalgae characterization for consolidated and new application in human food, animal feed and nutraceuticals. Int. J. Environ. Res. Pu. 2018, 15, 2436. [Google Scholar] [CrossRef] [PubMed]
  69. Leya, T. Snow algae: Adaptation strategies to survive on snow and ice. In Polyextremophiles. Life Under Multiple Forms of Stress; Seckbach, J., Oren, A., Stan-Lotter, H., Eds.; Springer: Berlin/Heidelberg, Germany, 2013; Volume 27, pp. 401–423. [Google Scholar]
  70. Osipova, S.; Dudareva, L.; Bondarenko, N.; Nasarova, A.; Sokolova, N.; Obolkina, L.; Glyzina, O.; Timoshkin, O. Temporal variation in fatty acid composition of Ulothrix zonata (Chlorophyta) from ice and benthic communities of Lake Baikal. Phycologia 2009, 48, 130–135. [Google Scholar] [CrossRef]
  71. Spijkerman, E.; Wacker, A.; Weithoff, G.; Leya, T. Elemental and fatty acid composition of snow algae in Arctic habitats. Front. Microbiol. 2012, 3, 1–15. [Google Scholar] [CrossRef] [PubMed]
  72. Ishihara, K.; Murata, M.; Kaneniwa, M.; Saito, H.; Komatsu, W.; Shinohara, K. Purification of stearidonic acid (18:4(n-3)) and hexadecatetraenoic acid (16:4(n-3)) from algal fatty acid with lipase and medium pressure liquid chromatography. Biosci. Biotech. Bioch. 2000, 64, 2454–2457. [Google Scholar] [CrossRef]
  73. Ishihara, K.; Murata, M.; Kaneniwa, M.; Saito, H.; Shinohara, K.; Maeda-Yamamoto, M. Inhibition of icosanoid production in MC/9 mouse mast cells by n-3 polyunsaturated fatty acids isolated from edible marine algae. Biosci. Biotech. Bioch. 1998, 62, 1412–1415. [Google Scholar] [CrossRef]
  74. Calder, P.C. Polyunsaturated fatty acids and inflammatory processes: New twists in an old tale. Biochimie 2009, 91, 791–795. [Google Scholar] [CrossRef]
  75. Suzuki, H.; Hulatt, C.J.; Wijffels, R.H.; Kiron, V. Growth and LC-PUFA production of the cold-adapted microalga Koliella antarctica in photobioreactors. J. Appl. Phycol. 2019, 31, 981–997. [Google Scholar] [CrossRef]
  76. Řezanka, T.; Nedbalová, L.; Lukavský, J.; Střížek, A.; Sigler, K. Pilot cultivation of the green alga Monoraphidium sp. producing a high content of polyunsaturated fatty acids in a low-temperature environment. Algal Res. 2017, 22, 160–165. [Google Scholar] [CrossRef]
  77. Lang, I.; Hodač, L.; Friedl, T.; Feussner, I. Fatty acid profiles and their distribution patterns in microalgae: A comprehensive analysis of more than 2000 strains from the SAG culture collection. BMC Plant Biol. 2011, 11, 124. [Google Scholar] [CrossRef] [PubMed]
  78. La Rocca, N.; Sciuto, K.; Meneghesso, A.; Moro, I.; Rascio, N.; Morosinotto, T. Photosynthesis in extreme environments: Responses to different light regimes in the Antarctic alga Koliella antarctica. Physiol. Plantarum. 2015, 153, 654–667. [Google Scholar] [CrossRef] [PubMed]
Microorganisms 07 00434 g001 550
Figure 1. Sampling locations of Chloromonas hindakii sp. nov. in (a) Krkonoše, Czech Republic (square), Jeseníky, Czech Republic (triangle), and at the High Tatras, Slovakia and Poland (circle), with codes of the European countries (AU, Austria; CZ, Czech Republic; DE, Germany; HU, Hungary; PL, Poland; SK, Slovakia); (b) Detailed map of the High Tatras, showing principal peaks with their elevation in meters (triangles).
Figure 1. Sampling locations of Chloromonas hindakii sp. nov. in (a) Krkonoše, Czech Republic (square), Jeseníky, Czech Republic (triangle), and at the High Tatras, Slovakia and Poland (circle), with codes of the European countries (AU, Austria; CZ, Czech Republic; DE, Germany; HU, Hungary; PL, Poland; SK, Slovakia); (b) Detailed map of the High Tatras, showing principal peaks with their elevation in meters (triangles).
Microorganisms 07 00434 g001
Microorganisms 07 00434 g002 550
Figure 2. Two representative sampling sites of Chloromonas hindakii indicated by red arrowheads and detailed views of the orange snow blooms. (a,c) Open site above timberline (i.e., high light conditions) in the High Tatra Mountains (sample WP194) and (b,d) semi-shaded site close to spruce trees (i.e., low light conditions) in the Krkonoše Mountains (sample DD2).
Figure 2. Two representative sampling sites of Chloromonas hindakii indicated by red arrowheads and detailed views of the orange snow blooms. (a,c) Open site above timberline (i.e., high light conditions) in the High Tatra Mountains (sample WP194) and (b,d) semi-shaded site close to spruce trees (i.e., low light conditions) in the Krkonoše Mountains (sample DD2).
Microorganisms 07 00434 g002
Microorganisms 07 00434 g003 550
Figure 3. Light and electron microscopy of field-collected cysts of Chloromonas hindakii sp. nov.—samples Jes 19-1 (a,b), WP129 (c,d), WP194 (e,f,h–k), and DD2 (g). (a–d) Light micrographs. (a) Surface view showing cell wall flanges. (b,c) Optical sections, showing cytoplasm containing reddish astaxanthin depots and greenish chloroplast (b) and prominent wall flanges reaching the cell apexes (c). (d) A cell in upright position, showing eight cell wall flanges. (e–g) Transmission electron micrographs. (e) Cell cross-section showing cleavages within the mother cell wall. (f) A detailed view of the newly formed cell wall of two daughter cells (empty arrowheads). (g) The cytoplasm of mature cysts occupied by large peripheral lipid bodies (l) with centrally located chloroplasts (c). (h–k) Scanning electron micrographs, showing characteristic organization of the cell ornamentation. An empty arrowhead indicates a flange reaching from pole to antapex. (h) Two flanges joining or a bifurcation of one flange into two independents (white arrowheads). (i) An isolated furcated flange (white arrowhead), (j) Slightly undulating flanges. (k) Apical view of a cell presenting eight flanges in total. Four of them are usually running from apex to antapex.
Figure 3. Light and electron microscopy of field-collected cysts of Chloromonas hindakii sp. nov.—samples Jes 19-1 (a,b), WP129 (c,d), WP194 (e,f,h–k), and DD2 (g). (a–d) Light micrographs. (a) Surface view showing cell wall flanges. (b,c) Optical sections, showing cytoplasm containing reddish astaxanthin depots and greenish chloroplast (b) and prominent wall flanges reaching the cell apexes (c). (d) A cell in upright position, showing eight cell wall flanges. (e–g) Transmission electron micrographs. (e) Cell cross-section showing cleavages within the mother cell wall. (f) A detailed view of the newly formed cell wall of two daughter cells (empty arrowheads). (g) The cytoplasm of mature cysts occupied by large peripheral lipid bodies (l) with centrally located chloroplasts (c). (h–k) Scanning electron micrographs, showing characteristic organization of the cell ornamentation. An empty arrowhead indicates a flange reaching from pole to antapex. (h) Two flanges joining or a bifurcation of one flange into two independents (white arrowheads). (i) An isolated furcated flange (white arrowhead), (j) Slightly undulating flanges. (k) Apical view of a cell presenting eight flanges in total. Four of them are usually running from apex to antapex.
Microorganisms 07 00434 g003
Microorganisms 07 00434 g004 550
Figure 4. 18S ribosomal RNA gene-based Bayesian phylogenetic tree of Chloromonas focusing on snow-inhabiting species. C. = Chloromonas. The labeled clades ‘A’, ‘B’, and ‘C’ correspond to [4]. Posterior probabilities (0.95 or more) and bootstrap values from maximum likelihood analyses (50% or more) are shown. Full statistical support (1.00/100) is marked with an asterisk. Thick branches represent nodes receiving the highest posterior probability support (1.00). Newly obtained sequences are in bold. Accession numbers, strain, or field sample codes are indicated after each species name.
Figure 4. 18S ribosomal RNA gene-based Bayesian phylogenetic tree of Chloromonas focusing on snow-inhabiting species. C. = Chloromonas. The labeled clades ‘A’, ‘B’, and ‘C’ correspond to [4]. Posterior probabilities (0.95 or more) and bootstrap values from maximum likelihood analyses (50% or more) are shown. Full statistical support (1.00/100) is marked with an asterisk. Thick branches represent nodes receiving the highest posterior probability support (1.00). Newly obtained sequences are in bold. Accession numbers, strain, or field sample codes are indicated after each species name.
Microorganisms 07 00434 g004
Microorganisms 07 00434 g005 550
Figure 5. rbcL gene-based Bayesian phylogenetic tree of Chloromonas focusing on snow-inhabiting species. C. = Chloromonas. The labeled clades ‘A’, ‘B’, and ‘C’ correspond to [4]. Posterior probabilities (0.95 or more) and bootstrap values from maximum likelihood analyses (50% or more) are shown. Full statistical support (1.00/100) is marked with an asterisk. Thick branches represent nodes receiving the highest posterior probability support (1.00). Newly obtained sequences are in bold. Accession numbers, strain, or field sample codes are indicated after each species name.
Figure 5. rbcL gene-based Bayesian phylogenetic tree of Chloromonas focusing on snow-inhabiting species. C. = Chloromonas. The labeled clades ‘A’, ‘B’, and ‘C’ correspond to [4]. Posterior probabilities (0.95 or more) and bootstrap values from maximum likelihood analyses (50% or more) are shown. Full statistical support (1.00/100) is marked with an asterisk. Thick branches represent nodes receiving the highest posterior probability support (1.00). Newly obtained sequences are in bold. Accession numbers, strain, or field sample codes are indicated after each species name.
Microorganisms 07 00434 g005
Microorganisms 07 00434 g006 550
Figure 6. Intraspecific variability in the secondary structure of ITS2 rDNA transcripts of Chloromonas hindakii sp. nov.—comparison between the type strain WP129 (= CCCryo 531-19) (accession number MN251865) and field-collected cysts from different localities. The marker was identical for the strain and the following field samples: Rozcestí (MN251867), Jes19-6 (MN251869), LP06 (MN251870), NW (MN251872), WP194 (MN251873). It differed by 1–4 bp in comparison with the field samples (1-DD2, MN251866; 2-Jes19-1, MN251868; 3-WP136, MN251871). Helices are labeled with Latin numbers: I–IV. Nucleotide differences of the field samples are described in red outside the structure and linked by dotted lines. Note the U–U mismatch in helix II (arrows).
Figure 6. Intraspecific variability in the secondary structure of ITS2 rDNA transcripts of Chloromonas hindakii sp. nov.—comparison between the type strain WP129 (= CCCryo 531-19) (accession number MN251865) and field-collected cysts from different localities. The marker was identical for the strain and the following field samples: Rozcestí (MN251867), Jes19-6 (MN251869), LP06 (MN251870), NW (MN251872), WP194 (MN251873). It differed by 1–4 bp in comparison with the field samples (1-DD2, MN251866; 2-Jes19-1, MN251868; 3-WP136, MN251871). Helices are labeled with Latin numbers: I–IV. Nucleotide differences of the field samples are described in red outside the structure and linked by dotted lines. Note the U–U mismatch in helix II (arrows).
Microorganisms 07 00434 g006
Microorganisms 07 00434 g007 550
Figure 7. LM and TEM of vegetative cells of Chloromonas hindakii sp. nov. strain WP129 (= CCCryo 531-19): (a–e) LM. (a) Optical section of the cell, showing two contractile vacuoles (white arrowheads) and a chloroplast not totally occupying the posterior end of the protoplast (black arrowhead) within the cell. (b) Position of the nucleus (white arrowhead) within the cell. (c) Sporangium and plate-like sections of the plastid. (d,e) Development of two spherical daughter cells. (f–k) TEM. The following structures are labeled: Undulating plasmatic membrane (arrowhead), chloroplast (c), endoplasmic reticulum (e), flagellum (f), Golgi body (g), mitochondrion (m), nucleus (n), starch (s), vacuole with crystalline content (v). (f) Longitudinal cell section, showing position of nucleus. (g) Papilla shape. (h) Cell cleavage. (i) Two spherical daughter cells in mother cell wall, still lacking own cell wall. (j) Detail of one out of four spherical daughter cells with newly developed cell wall, still inside the sporangium wall. Note prominent rough endoplasmic reticulum. (k) Transversal cell section of an older cell with many discoid chloroplasts including starch grains.
Figure 7. LM and TEM of vegetative cells of Chloromonas hindakii sp. nov. strain WP129 (= CCCryo 531-19): (a–e) LM. (a) Optical section of the cell, showing two contractile vacuoles (white arrowheads) and a chloroplast not totally occupying the posterior end of the protoplast (black arrowhead) within the cell. (b) Position of the nucleus (white arrowhead) within the cell. (c) Sporangium and plate-like sections of the plastid. (d,e) Development of two spherical daughter cells. (f–k) TEM. The following structures are labeled: Undulating plasmatic membrane (arrowhead), chloroplast (c), endoplasmic reticulum (e), flagellum (f), Golgi body (g), mitochondrion (m), nucleus (n), starch (s), vacuole with crystalline content (v). (f) Longitudinal cell section, showing position of nucleus. (g) Papilla shape. (h) Cell cleavage. (i) Two spherical daughter cells in mother cell wall, still lacking own cell wall. (j) Detail of one out of four spherical daughter cells with newly developed cell wall, still inside the sporangium wall. Note prominent rough endoplasmic reticulum. (k) Transversal cell section of an older cell with many discoid chloroplasts including starch grains.
Microorganisms 07 00434 g007
Microorganisms 07 00434 g008 550
Figure 8. Rapid light curves showing the intraspecific photosynthetic flexibility of Chloromonas hindakii sp. nov. The effect of increasing photon fluence rates (x-axis) on the relative electron transport rate (rETR; y-axis) of chloroplasts was measured for vegetative flagellates (green diamonds, strain WP129 (= CCCryo 531-19) grown in the lab) and non-motile field-collected cysts (blue triangles—semi-shaded site close to a spruce canopy, sample DD2; orange circles—site above timberline, population located mainly 3–5 cm below snow surface, sample LP06; red boxes—site above timberline, population at snow surface, sample WP194). Values are means of four replicate measurements (n = 4, ± SD). The data points were fitted to the photoinhibition model of [46].
Figure 8. Rapid light curves showing the intraspecific photosynthetic flexibility of Chloromonas hindakii sp. nov. The effect of increasing photon fluence rates (x-axis) on the relative electron transport rate (rETR; y-axis) of chloroplasts was measured for vegetative flagellates (green diamonds, strain WP129 (= CCCryo 531-19) grown in the lab) and non-motile field-collected cysts (blue triangles—semi-shaded site close to a spruce canopy, sample DD2; orange circles—site above timberline, population located mainly 3–5 cm below snow surface, sample LP06; red boxes—site above timberline, population at snow surface, sample WP194). Values are means of four replicate measurements (n = 4, ± SD). The data points were fitted to the photoinhibition model of [46].
Microorganisms 07 00434 g008
Table
Table 1. Sampling locations of Chloromonas hindakii sp. nov. from Krkonoše, Jeseníky, and High (H.) Tatra Mountains with sample codes, collection date, sampling site, altitude (m a.s.l.) and geographic position (GPS) (CZ, Czech Republic; PL, Poland; SK, Slovakia). The numbers in parentheses indicate position in the map of Figure 1 (L., Lake).
Table 1. Sampling locations of Chloromonas hindakii sp. nov. from Krkonoše, Jeseníky, and High (H.) Tatra Mountains with sample codes, collection date, sampling site, altitude (m a.s.l.) and geographic position (GPS) (CZ, Czech Republic; PL, Poland; SK, Slovakia). The numbers in parentheses indicate position in the map of Figure 1 (L., Lake).
SampleDateLocationAltitudeGPS
DD211.5.2017CZ (1), Krkonoše, Dlouhý důl984N50°43.231 E15°39.433
Rozcestí12.5.2017CZ (2), Krkonoše, close to Na Rozcestí1349N50°42.327 E15°40.368
Jes19-18.5.2019CZ (3), Jeseníky, close to U Výrovky1137N50°06.673 E17°10.967
Jes19-69.5.2019CZ (4), Jeseníky, next to Sněžná kotlina1157N50°08.121 E17°08.817
LP0614.6.2017PL (5), H. Tatras, Dolina za Mnichem1858N49°11.656 E20°03.146
WP12915.6.2017PL (6), H. Tatras, Dolina za Mnichem2082N49°11.424 E20°03.153
WP13015.6.2017PL (7), H.Tatras, ice-covered Zadni Mnichowy L.2038N49°11.403 E20°03.101
WP13615.6.2017SK (8), H. Tatras, Mengusovská dolina1976N49°10.475 E20°04.910
NW18.6.2017SK (9), H. Tatras, shore of Nižné Wahlenberg.L.2061N49°9.543 E20°1.612
WP19417.6.2018SK (10), H. Tatras, Velká Studená dolina2022N49°10.540 E20°09.414
Table
Table 2. List of primers used for amplification of 18S rDNA, ITS1 rDNA, ITS2 rDNA (ITS), and rbcL markers (F, forward; R, reverse).
Table 2. List of primers used for amplification of 18S rDNA, ITS1 rDNA, ITS2 rDNA (ITS), and rbcL markers (F, forward; R, reverse).
PrimerMarkerDirectionSequenceReference
SSUITS2FCTGCGGAAGGATCATTGATTC[26]
LSUITS2RAGTTCAGCGGGTGGTCTTG[26]
ITS5ITS2FGGAAGTAAAAGTCGTAACAAGG[27]
ITS1ITS2FTCCGTAGGTGAACCTGCGG[27]
ITS4ITS2RTCCTCCGCTTATTGATATGC[27]
Al1500afITS2FGCGCGCTACACTGATGC[28]
LR3ITS2RGGTCCGTGTTTCAAGACGG[29]
18F218SFAACCTGGTTGATCCTGCCAGT[30]
18R218SRTGATCCTTCTGCAGGTTCACCTACG[30]
rbcL1FrbcLFCTGCTTTATACTGCGAAACTGC[31]
rbcL7RrbcLRAAATAAATACCACGGCTACG[31]
Table
Table 3. List of marker sequences for the authentic strain of Chloromonas hindakii and field samples, indicating the Genbank accession numbers for ITS2 rDNA/18S rDNA/rbcL sequences.
Table 3. List of marker sequences for the authentic strain of Chloromonas hindakii and field samples, indicating the Genbank accession numbers for ITS2 rDNA/18S rDNA/rbcL sequences.
Sample/Strain CodeNCBI Accession Numbers
ITS2 rDNA18S rDNArbcL
WP129 (= CCCryo 531-19)MN251865MN251865MN251877
DD2MN251866MN251874MN251878
RozcestíMN251867MN251875MN251879
Jes19-1MN251868
Jes19-6MN251869MN251876
LP06MN251870
WP136MN251871
NWMN251872 MN251880
WP194MN251873 MN251881
Table
Table 4. Abiotic habitat parameters and cell sizes of Chloromonas hindakii field samples from the Krkonoše, Jeseníky, and High Tatra Mountains. Electrical conductivity (EC; μS.cm−1), pH of meltwater and snow water content (SWE; %), maximal population density ± standard deviation (SD), average sizes of cells in μm ± SD, length to width ratio (L:W ratio) ± SD are shown.
Table 4. Abiotic habitat parameters and cell sizes of Chloromonas hindakii field samples from the Krkonoše, Jeseníky, and High Tatra Mountains. Electrical conductivity (EC; μS.cm−1), pH of meltwater and snow water content (SWE; %), maximal population density ± standard deviation (SD), average sizes of cells in μm ± SD, length to width ratio (L:W ratio) ± SD are shown.
SampleECpHSWECells Per mL MeltwaterCell LengthCell WidthL:W Ratio
DD2145.748.7 ± 0.319,950 ± 200025.5 ± 216.3 ± 1.41.57 ± 0.1
Rozcestí95.9--25.0 ± 2.116.6 ± 1.51.51 ± 0.1
Jes19-1287.0-60,800 ± 608027.3 ± 2.117.9 ± 2.21.53 ± 0.1
Jes19-6336.9-43,050 ± 430030.3 ± 2.119.7 ± 1.71.54 ± 0.1
LP065.25.555.9 ± 2.154,150 ± 540025.2 ± 216.4 ± 1.51.54 ± 0.1
WP129----23.7 ± 1.215.0 ± 0.81.52 ± 0.1
WP130---47,100 ± 4700---
WP136---79,100 ± 790023.5 ± 2.315.6 ± 2.11.52 ± 0.1
NW----23.0 ± 2.115.0 ±1.41.54 ± 0.1
WP1945.16.860.8 ± 5.9721,900 ± 210026.8 ± 1.417.6 ± 1.41.53 ± 0.1
Table
Table 5. Relative cellular content of carotenoids, chlorophyll b, and α-tocopherol in relation to chlorophyll a (= 1) in field samples of Chloromonas hindakii sp. nov. from the High Tatras at the Slovak side (sample WP194; high light conditions) and at the Polish side (LP06; low light conditions), determined by HPLC. Abbreviations: n & v, neoxanthin and violaxanthin; lut, lutein; zea, zeaxanthin; chl b, chlorophyll b; β-car, β-carotene; ast, astaxanthin (free/unesterified); ast-E, astaxanthin derivatives (esters); ast-tot, astaxanthin in total (free and derivatives); α-toc; α-tocopherol; n.d., not detected.
Table 5. Relative cellular content of carotenoids, chlorophyll b, and α-tocopherol in relation to chlorophyll a (= 1) in field samples of Chloromonas hindakii sp. nov. from the High Tatras at the Slovak side (sample WP194; high light conditions) and at the Polish side (LP06; low light conditions), determined by HPLC. Abbreviations: n & v, neoxanthin and violaxanthin; lut, lutein; zea, zeaxanthin; chl b, chlorophyll b; β-car, β-carotene; ast, astaxanthin (free/unesterified); ast-E, astaxanthin derivatives (esters); ast-tot, astaxanthin in total (free and derivatives); α-toc; α-tocopherol; n.d., not detected.
SampleN&VLutZeaChl bβ-carAstAst-EAst-totα-toc
WP1940.1200.315n.d.0.2270.0140.0370.3850.4220.085
LP060.1350.277n.d.0.2730.0200.0120.4760.4880.080
Table
Table 6. Cellular fatty acid composition of Chloromonas hindakii sp. nov. vegetative strain WP129 (= CCCryo 531-19) cultivated at 1 °C (n = 3) compared to field-collected cysts (from sample Rozcestí) in % of total lipids (TL) and in % of the three major lipid groups: Neutral lipids (NL), phospholipids (PL), and glycolipids (GL). The table shows only fatty acids that have abundances greater than 0.1%. The relative proportion of saturated (SAFA), monounsaturated (MUFA), and polyunsaturated (PUFA) fatty acids is also given.
Table 6. Cellular fatty acid composition of Chloromonas hindakii sp. nov. vegetative strain WP129 (= CCCryo 531-19) cultivated at 1 °C (n = 3) compared to field-collected cysts (from sample Rozcestí) in % of total lipids (TL) and in % of the three major lipid groups: Neutral lipids (NL), phospholipids (PL), and glycolipids (GL). The table shows only fatty acids that have abundances greater than 0.1%. The relative proportion of saturated (SAFA), monounsaturated (MUFA), and polyunsaturated (PUFA) fatty acids is also given.
Fatty AcidWP129 (= CCCryo 531-19)Rozcestí
TLNLPLGLTL
14:00.7 ± 0.50.8 ± 0.61.1 ± 0.300.5
16:014.7 ± 6.115.6 ± 8.315.7 ± 1.410.4 ± 0.919.2
16:1 (9Z)0.3 ± 0.102.5 ± 1.301.9
16:1 (7Z)0.4 ± 0.30.5 ± 0.5002.1
3t-16:1004.6 ± 0.100
16:2 (7Z,10Z)00003.2
16:3 (4Z,7Z,10Z)00000.3
16:3 (7Z,10Z,13Z)2.1 ± 1.11.9 ± 1.41.5 ± 0.23.6 ± 0.32.7
16:4 (4Z,7Z,11Z,13Z)28.5 ± 4.630.6 ± 6.112.1 ± 0.629.5 ± 1.610.3
18:07.3 ± 6.86.7 ± 8.91.5 ± 0.614.5 ± 3.61.3
18:1 (11Z)0.5 ± 0.30.5 ± 0.41.1 ± 0.307.5
18:1 (9Z)9.8 ± 3.612.1 ± 5.28.4 ± 1.109.4
18:2 (9Z,12Z)3.4 ± 0.83.9 ± 1.03.4 ± 0.11.2 ± 0.74.8
18:3 (9Z,12Z,15Z)25.9 ± 3.721.4 ± 3.744.7 ± 1.733.2 ± 8.431.6
18:3 (6Z,9Z,12Z)00000.5
18:4 (6Z,9Z,12Z,15Z)5.9 ± 0.26.0 ± 1.63.3 ± 1.17.4 ± 4.74.7
SAFA22.7 ± 10.923.1 ± 13.518.4 ± 1.025.0 ± 3.621
MUFA11.5 ± 3.613.1 ± 5.016.6 ± 0.8020.9
PUFA65.8 ± 9.963.8 ± 8.565.1 ± 1.575.0 ± 3.658.1

Share and Cite

MDPI and ACS Style

Procházková, L.; Remias, D.; Řezanka, T.; Nedbalová, L. Ecophysiology of Chloromonas hindakii sp. nov. (Chlorophyceae), Causing Orange Snow Blooms at Different Light Conditions. Microorganisms 2019, 7, 434. https://doi.org/10.3390/microorganisms7100434

AMA Style

Procházková L, Remias D, Řezanka T, Nedbalová L. Ecophysiology of Chloromonas hindakii sp. nov. (Chlorophyceae), Causing Orange Snow Blooms at Different Light Conditions. Microorganisms. 2019; 7(10):434. https://doi.org/10.3390/microorganisms7100434

Chicago/Turabian Style

Procházková, Lenka, Daniel Remias, Tomáš Řezanka, and Linda Nedbalová. 2019. "Ecophysiology of Chloromonas hindakii sp. nov. (Chlorophyceae), Causing Orange Snow Blooms at Different Light Conditions" Microorganisms 7, no. 10: 434. https://doi.org/10.3390/microorganisms7100434

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop