Stringent Response Regulates the Persister Formation and Virulence of Vibrio splendidus
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Experimental Animals
2.3. Growth Conditions and Antibiotics
2.4. Construction of Mutant Strains
2.5. Antibiotic-Induced Persisters
2.6. Single-Cell Raman Spectroscopy
2.7. Determination of Bacterial Growth Curves
2.8. Experimental Infection
2.9. Bacterial Invasion Experiment
2.10. Minimum Inhibitory Concentration (MIC) Assay
2.11. Swimming Motility Assays
2.12. Biofilm Formation
2.13. Protease Activity Assays
2.14. Hemolytic Activity Assays
2.15. Transcriptome Sequencing
3. Results
3.1. Construction and Verification of Mutant Strains
3.2. Effect of Gene Deletion on Persister Formation in V. splendidus
3.3. Effect of Gene Deletion on Growth and Antibiotic Susceptibility of V. splendidus
3.4. Effect of Gene Deletion on Virulence-Related Phenotypes of V. splendidus
3.5. Effect of Gene Deletion on Pathogenicity of V. splendidus
3.6. Transcriptomic Analysis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| WT | Unedited wild-type bacteria |
| Tet | Tetracycline |
| Amp | Ampicillin |
| Kan | Kanamycin |
| Str | Streptomycin |
| Gen | Gentamicin |
| Cip | Ciprofloxacin |
References
- Ayrapetyan, M.; Williams, T.; Oliver, J.D. Relationship between the Viable but Nonculturable State and Antibiotic Persister Cells. J. Bacteriol. 2018, 200. [Google Scholar] [CrossRef]
- Andresen, L.; Varik, V.; Tozawa, Y.; Jimmy, S.; Lindberg, S.; Tenson, T.; Hauryliuk, V. Auxotrophy-Based High Throughput Screening Assay for the Identification of Bacillus subtilis Stringent Response Inhibitors. Sci. Rep. 2016, 6, 35824. [Google Scholar] [CrossRef]
- Urwin, L.; Savva, O.; Corrigan, R.M. Microbial Primer: What Is the Stringent Response and How Does It Allow Bacteria to Survive Stress? Microbiology 2024, 170, 001483. [Google Scholar] [CrossRef] [PubMed]
- Hauryliuk, V.; Atkinson, G.C.; Murakami, K.S.; Tenson, T.; Gerdes, K. Recent Functional Insights into the Role of (p)ppGpp in Bacterial Physiology. Nat. Rev. Microbiol. 2015, 13, 298–309. [Google Scholar] [CrossRef]
- Irving, S.E.; Choudhury, N.R.; Corrigan, R.M. The Stringent Response and Physiological Roles of (pp)pGpp in Bacteria. Nat. Rev. Microbiol. 2021, 19, 256–271. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.H.; Wang, X.; O’Connor, H.F.; Benedik, M.J.; Wood, T.K. Bacterial Persistence Increases as Environmental Fitness Decreases. Microb. Biotechnol. 2012, 5, 509–522. [Google Scholar] [CrossRef]
- Niu, H.; Gu, J.; Zhang, Y. Bacterial Persisters: Molecular Mechanisms and Therapeutic Development. Signal Transduct. Target. Ther. 2024, 9, 174. [Google Scholar] [CrossRef]
- Nakouti, I.; Hobbs, G.; Teethaisong, Y.; Phipps, D. A Demonstration of Athermal Effects of Continuous Microwave Irradiation on the Growth and Antibiotic Sensitivity of Pseudomonas aeruginosa PAO1. Biotechnol. Prog. 2017, 33, 37–44. [Google Scholar] [CrossRef]
- Korch, S.B.; Henderson, T.A.; Hill, T.M. Characterization of the hipA7 Allele of Escherichia coli and Evidence That High Persistence Is Governed by (p)ppGpp Synthesis. Mol. Microbiol. 2003, 50, 1199–1213. [Google Scholar] [CrossRef]
- Svenningsen, M.S.; Veress, A.; Harms, A.; Mitarai, N.; Semsey, S. Birth and Resuscitation of (p)ppGpp Induced Antibiotic Tolerant Persister Cells. Sci. Rep. 2019, 9, 6056. [Google Scholar] [CrossRef] [PubMed]
- Song, S.; Wood, T.K. ppGpp Ribosome Dimerization Model for Bacterial Persister Formation and Resuscitation. Biochem. Biophys. Res. Commun. 2020, 523, 281–286. [Google Scholar] [CrossRef]
- Helaine, S.; Cheverton, A.M.; Watson, K.G.; Faure, L.M.; Matthews, S.A.; Holden, D.W. Internalization of Salmonella by Macrophages Induces Formation of Nonreplicating Persisters. Science 2014, 343, 204–208. [Google Scholar] [CrossRef]
- Nguyen, D.; Joshi-Datar, A.; Lepine, F.; Bauerle, E.; Olakanmi, O.; Beer, K.; McKay, G.; Siehnel, R.; Schafhauser, J.; Wang, Y.; et al. Active Starvation Responses Mediate Antibiotic Tolerance in Biofilms and Nutrient-Limited Bacteria. Science 2011, 334, 982–986. [Google Scholar] [CrossRef]
- Kundra, S.; Colomer-Winter, C.; Lemos, J.A. Survival of the Fittest: The rRelationship of (p)ppGpp with Bacterial Virulence. Front. Microbiol. 2020, 11, 601417. [Google Scholar] [CrossRef]
- Pulschen, A.A.; Fernandes, A.Z.N.; Cunha, A.F.; Sastre, D.E.; Matsuguma, B.E.; Gueiros-Filho, F.J. Many Birds with One Stone: Targeting the (p)ppGpp Signaling Pathway of Bacteria to Improve Antimicrobial Therapy. Biophys. Rev. 2021, 13, 1039–1051. [Google Scholar] [CrossRef]
- Schafhauser, J.; Lepine, F.; McKay, G.; Ahlgren, H.G.; Khakimova, M.; Nguyen, D. The Stringent Response Modulates 4-Hydroxy-2-Alkylquinoline Biosynthesis and Quorum-Sensing Hierarchy in Pseudomonas aeruginosa. J. Bacteriol. 2014, 196, 1641–1650. [Google Scholar] [CrossRef]
- Liu, H.; Zheng, F.; Sun, X.; Hong, X.; Dong, S.; Wang, B.; Tang, X.; Wang, Y. Identification of the Pathogens Associated with Skin Ulceration and Peristome Tumescence in Cultured Sea Cucumbers Apostichopus japonicus (Selenka). J. Invertebr. Pathol. 2010, 105, 236–242. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wood, T.K.; Zhang, W.; Li, C. Vibrio splendidus Persister Cells Induced by Host Coelomic Fluids Show a Similar Phenotype to Antibiotic-induced Counterparts. Environ. Microbiol. 2021, 23, 5605–5620. [Google Scholar] [CrossRef]
- de Oliveira, T.F.; Queiroz, G.A.; Teixeira, J.P.; Figueiredo, H.C.P.; Leal, C.A.G. Recurrent Streptoccoccus agalactiae Infection in Nile Tilapia (Oreochromis niloticus) Treated with Florfenicol. Aquaculture 2018, 493, 51–60. [Google Scholar] [CrossRef]
- Gefen, O.; Balaban, N.Q. The Importance of Being Persistent: Heterogeneity of Bacterial Populations under Antibiotic Stress. FEMS Microbiol. Rev. 2009, 33, 704–717. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.E.; Li, M.; Jarvis, R.M.; Goodacre, R.; Banwart, S.A. Shining Light on the Microbial World: The Application of Raman Microspectroscopy. Adv. Appl. Microbiol. 2010, 70, 153–186. [Google Scholar] [CrossRef]
- Liu, L.; Xue, J.; Song, Y.; Zhan, T.; Liu, Y.; Song, X.; Mei, L.; Wang, D.; Fu, Y.V.; Wei, Q. A Pilot Study on Single-Cell Raman Spectroscopy Combined with Machine Learning for Phenotypic Characterization of Staphylococcus aureus. Microorganisms 2025, 13, 1333. [Google Scholar] [CrossRef]
- Camp, C.H., Jr.; Cicerone, M.T. Chemically Sensitive Bioimaging with Coherent Raman Scattering. Nat. Photon 2015, 9, 295–305. [Google Scholar] [CrossRef]
- Berry, D.; Mader, E.; Lee, T.K.; Woebken, D.; Wang, Y.; Zhu, D.; Palatinszky, M.; Schintlmeister, A.; Schmid, M.C.; Hanson, B.T.; et al. Tracking Heavy Water (D2O) Incorporation for Identifying and Sorting Active Microbial Cells. Proc. Natl. Acad. Sci. USA 2015, 112, 194–203. [Google Scholar] [CrossRef]
- Liu, Y.; Ma, Y.; Zhang, L.; Sun, X.; Yang, J.; Li, X.; Li, F.; Chen, R.; Zhu, P.; Xu, J.; et al. Single-cell Raman Microspectroscopy-Based Assessment of Three Intracanal Disinfectants’ Effect on Enterococcus faecalis. J. Raman Spectrosc. 2022, 53, 902–910. [Google Scholar] [CrossRef]
- Ueno, H.; Kato, Y.; Tabata, K.V.; Noji, H. Revealing the Metabolic Activity of Persisters in Mycobacteria by Single-Cell D2O Raman Imaging Spectroscopy. Anal. Chem. 2019, 91, 15171–15178. [Google Scholar] [CrossRef]
- Wang, C.; Chen, R.; Xu, J.; Jin, L. Single-Cell Raman Spectroscopy Identifies Escherichia coli Persisters and Reveals Their Enhanced Metabolic Activities. Front. Microbiol. 2022, 13, 936726. [Google Scholar] [CrossRef] [PubMed]
- Giannetto, C.; Acri, G.; Giudice, E.; Arfuso, F.; Testagrossa, B.; Piccione, G. Quantifying Serum Total Lipids and Tryptophan Concentrations by Raman Spectroscopy during Standardized Obstacle Course in Horses. J. Equine Vet. Sci. 2022, 108, 103820. [Google Scholar] [CrossRef] [PubMed]
- Maquelin, K.; Kirschner, C.; Choo-Smith, L.-P.; van den Braak, N.; Endtz, H.P.; Naumann, D.; Puppels, G.J. Identification of Medically Relevant Microorganisms by Vibrational Spectroscopy. J. Microbiol. Methods 2002, 51, 255–271. [Google Scholar] [CrossRef]
- Movasaghi, Z.; Rehman, S.; Rehman, I.U. Raman Spectroscopy of Biological Tissues. Appl. Spectrosc. Rev. 2007, 42, 493–541. [Google Scholar] [CrossRef]
- Gerbino, E.; Mobili, P.; Tymczyszyn, E.E.; Frausto-Reyes, C.; Araujo-Andrade, C.; Gómez-Zavaglia, A. Use of Raman Spectroscopy and Chemometrics for the Quantification of Metal Ions Attached to Lactobacillus Kefir: Quantification of Metal Ions Attached to Lactobacillus kefir. J. Appl. Microbiol. 2012, 112, 363–371. [Google Scholar] [CrossRef]
- Athamneh, A.I.M.; Alajlouni, R.A.; Wallace, R.S.; Seleem, M.N.; Senger, R.S. Phenotypic Profiling of Antibiotic Response Signatures in Escherichia coli Using Raman Spectroscopy. Antimicrob. Agents Chemother. 2014, 58, 1302–1314. [Google Scholar] [CrossRef]
- Talari, A.C.S.; Movasaghi, Z.; Rehman, S.; Rehman, I.U. Raman Spectroscopy of Biological Tissues. Appl. Spectrosc. Rev. 2015, 50, 46–111. [Google Scholar] [CrossRef]
- Germond, A.; Ichimura, T.; Horinouchi, T.; Fujita, H.; Furusawa, C.; Watanabe, T.M. Raman Spectral Signature Reflects Transcriptomic Features of Antibiotic Resistance in Escherichia coli. Commun. Biol. 2018, 1, 85. [Google Scholar] [CrossRef] [PubMed]
- Wei, H.L.; Zhang, L.Q. Quorum-Sensing System Influences Root Colonization and Biological Control Ability in Pseudomonas fluorescens 2P24. Antonie Van Leeuwenhoek 2006, 89, 267–280. [Google Scholar] [CrossRef] [PubMed]
- Zhang, W.; Hu, Y.; Wang, H.; Sun, L. Identification and Characterization of a Virulence-Associated Protease from a Pathogenic Pseudomonas fluorescens Strain. Vet. Microbiol. 2009, 139, 183–188. [Google Scholar] [CrossRef]
- Sinha, S.K.; Rs, N.; Devarakonda, Y.; Rathi, A.; Reddy Regatti, P.; Batra, S.; Syal, K. Tale of Twin Bifunctional Second Messenger (p)ppGpp Synthetases and Their Function in Mycobacteria. ACS Omega 2023, 8, 32258–32270. [Google Scholar] [CrossRef]
- Kushwaha, G.S.; Oyeyemi, B.F.; Bhavesh, N.S. Stringent Response Protein as a Potential Target to Intervene Persistent Bacterial Infection. Biochimie 2019, 165, 67–75. [Google Scholar] [CrossRef]
- Chowdhury, N.; Kwan, B.W.; Wood, T.K. Persistence Increases in the Absence of the Alarmone Guanosine Tetraphosphate by Reducing Cell Growth. Sci. Rep. 2016, 6, 20519. [Google Scholar] [CrossRef]
- Zhou, Y.; Liao, H.; Pei, L.; Pu, Y. Combatting Persister Cells: The Daunting Task in Post-Antibiotics Era. Cell Insight 2023, 2, 100104. [Google Scholar] [CrossRef]
- Fisher, R.A.; Gollan, B.; Helaine, S. Persistent Bacterial Infections and Persister Cells. Nat. Rev. Microbiol. 2017, 15, 453–464. [Google Scholar] [CrossRef]
- Ding, J.C.; Dai, L.T.; Tang, J.X.; Zhang, H.M.; Zhai, L.L.; Cai, C.Y.; Xiao, Z.R.; Chen, Z.M.; Ling, J.H.; Zou, M.X.; et al. Accelerated Detection of Carbapenem Resistance in Klebsiella pneumoniae via Single-Cell Raman Spectroscopy. World J. Microbiol. Biotechnol. 2025, 41, 158. [Google Scholar] [CrossRef]
- Hare, P.J.; LaGree, T.J.; Byrd, B.A.; DeMarco, A.M.; Mok, W.W.K. Single-Cell Technologies to Study Phenotypic Heterogeneity and Bacterial Persisters. Microorganisms 2021, 9, 2277. [Google Scholar] [CrossRef]
- Olaniyi, O.O.; Li, H.; Zhu, Y.; Cui, L. Metabolic Responses of Indigenous Bacteria in Chicken Faeces and Maggots to Multiple Antibiotics via Heavy Water Labeled Single-Cell Raman Spectroscopy. J. Environ. Sci. 2022, 113, 394–402. [Google Scholar] [CrossRef]
- Tao, Y.; Wang, Y.; Huang, S.; Zhu, P.; Huang, W.E.; Ling, J.; Xu, J. Metabolic-Activity-Based Assessment of Antimicrobial Effects by D2O-Labeled Single-Cell Raman Microspectroscopy. Anal. Chem. 2017, 89, 4108–4115. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Li, H.Z.; Zhu, X.; Su, J.Q.; Ren, B.; Zhu, Y.G.; Cui, L. Rapid Antibiotic Susceptibility Testing of Pathogenic Bacteria Using Heavy-Water-Labeled Single-Cell Raman Spectroscopy in Clinical Samples. Anal. Chem. 2019, 91, 6296–6303. [Google Scholar] [CrossRef]
- Harms, A.; Maisonneuve, E.; Gerdes, K. Mechanisms of Bacterial Persistence during Stress and Antibiotic Exposure. Am. Assoc. Adv. Sci. 2016, 354, aaf4268. [Google Scholar] [CrossRef] [PubMed]
- Lennon, J.T.; Jones, S.E. Microbial Seed Banks: The Ecological and Evolutionary Implications of Dormancy. Nat. Rev. Microbiol. 2011, 9, 119–130. [Google Scholar] [CrossRef]
- Mu, H.; Han, F.; Wang, Q.; Wang, Y.; Dai, X.; Zhu, M. Recent Functional Insights into the Magic Role of (p)ppGpp in Growth Control. Comput. Struct. Biotechnol. J. 2023, 21, 168–175. [Google Scholar] [CrossRef] [PubMed]
- Bange, G.; Brodersen, D.E.; Liuzzi, A.; Steinchen, W. Two p or Not Two p: Understanding Regulation by the Bacterial Second Messengers (p)ppGpp. Annu. Rev. Microbiol. 2021, 75, 383–406. [Google Scholar] [CrossRef]
- Xu, X.; Yu, H.; Zhang, D.; Xiong, J.; Qiu, J.; Xin, R.; He, X.; Sheng, H.; Cai, W.; Jiang, L.; et al. Role of ppGpp in Pseudomonas aeruginosa Acute Pulmonary Infection and Virulence Regulation. Microbiol. Res. 2016, 192, 84–95. [Google Scholar] [CrossRef] [PubMed]
- Pletzer, D.; Sun, E.; Ritchie, C.; Wilkinson, L.; Liu, L.T.; Trimble, M.J.; Wolfmeier, H.; Blimkie, T.M.; Hancock, R.E.W. Surfing motility is a complex adaptation dependent on the stringent stress response in Pseudomonas aeruginosa LESB58. PLoS Pathog. 2020, 16, e1008444. [Google Scholar] [CrossRef]
- Li, G.; Xie, F.; Zhang, Y.; Bossé, J.T.; Langford, P.R.; Wang, C. Role of (p)ppGpp in Viability and Biofilm Formation of Actinobacillus pleuropneumoniae S8. PLoS ONE 2015, 10, e0141501. [Google Scholar] [CrossRef] [PubMed]
- McLennan, M.K.; Ringoir, D.D.; Frirdich, E.; Svensson, S.L.; Wells, D.H.; Jarrell, H.; Szymanski, C.M.; Gaynor, E.C. Campylobacter jejuni Biofilms up-Regulated in the Absence of the Stringent Response Utilize a Calcofluor White-Reactive Polysaccharide. J. Bacteriol. 2008, 190, 1097–1107. [Google Scholar] [CrossRef]
- Åberg, A.; Shingler, V.; Balsalobre, C. (P)ppGpp Regulates Type 1 Fimbriation of Escherichia coli by Modulating the Expression of the Site-specific Recombinase FimB. Mol. Microbiol. 2006, 60, 1520–1533. [Google Scholar] [CrossRef]
- Geiger, T.; Goerke, C.; Fritz, M.; Schäfer, T.; Ohlsen, K.; Liebeke, M.; Lalk, M.; Wolz, C. Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in Stringent Response and Virulence of Staphylococcus aureus. Infect. Immun. 2010, 78, 1873–1883. [Google Scholar] [CrossRef]
- Grucela, P.K.; Fuhrer, T.; Sauer, U.; Chao, Y.; Zhang, Y.E. Ribose 5-Phosphate: The Key Metabolite Bridging the Metabolisms of Nucleotides and Amino Acids during Stringent Response in Escherichia coli? Microb. Cell 2023, 10, 141–144. [Google Scholar] [CrossRef]
- Liu, S.; Wu, N.; Zhang, S.; Yuan, Y.; Zhang, W.; Zhang, Y. Variable Persister Gene Interactions with (p)ppGpp for Persister Formation in Escherichia coli. Front. Microbiol. 2017, 8, 1795. [Google Scholar] [CrossRef] [PubMed]










| Strains/Plasmids | Description | Reference/Source |
|---|---|---|
| Vibrio splendidus AJ01 | Wild-type strain | Lab stock |
| ΔrelA | AmpR, derivative of V. splendidus AJ01 | This study |
| ΔrelAΔspoT | AmpR, derivative of V. splendidus AJ01 | This study |
| E. coli DH5α | Host strain | Takara |
| E. coli S17λπ | Host strain | Takara |
| pK18mobsacB | KanR, expression vector | Lab stock |
| Primer Name | Sequence (5′–3′) | Information |
|---|---|---|
| KoRelAF1 | CAGGTCGACTCTAGAGGATCCTGTTTTGTGGTTTGGGGAACTT | knockout |
| KoRelAR1 | ATCCCAACCTTGTACCGCAACCATCATGCCT | knockout |
| KoRelAF2 | TTGCGGTACAAGGTTGGGATAGTCCAAAATACTATC | knockout |
| KoRelAR2 | CTATGACATGATTACGAATTCTTTCTTCATCACTCGCA | knockout |
| KoSpoTF1 | CAGGTCGACTCTAGAGGATCCCGCCAGCATCTTACGTTTACC | knockout |
| KoSpoTR1 | CGATAAGACGTCGTAAGAACTAGATCCGG | knockout |
| KoSpoTF2 | GTTCTTACGACGTCTTATCGAATAGATACAAATTAAAGGCCC | knockout |
| KoSpoTR2 | CTATGACATGATTACGAATTCTGATGCAGCCTTAATGGACTTCA | knockout |
| 27F | AGAGTTTGATCMTGGCTCAG | strain identification |
| 1492R | GGTTACCTTGTTACGACTT | strain identification |
| Wavenumber (cm−1) | Molecular Assignment | Components | Reference |
|---|---|---|---|
| 667 | Guanine, tyrosine-G backbone in RNA | Nucleic acids | [27,28,29,30,31,32,33,34] |
| 722 | Adenine, DNA | Nucleic acids | |
| 850 | Polysaccharide structure | Polysaccharide | |
| 924 | ν(C-C) | Protein | |
| 1031 | δ(C-H) bend., Tyr, Phe | Protein | |
| 1304 | CH2 deformation | Lipid | |
| 1326 | C-H deformation, CH2 | Lipid | |
| 1656 | Amide I | Amide |
| Pathways | Gene | Gene Description | Regulate | p-Value |
|---|---|---|---|---|
| Ribosome | rpmH | 50S ribosomal protein L34 | up | 2.62 × 10−35 |
| rplA | 50S ribosomal protein L1 | up | 6.08 × 10−30 | |
| rpsG | 30S ribosomal protein S7 | up | 3.18 × 10−46 | |
| Nucleotide metabolism | adk | adenylate kinase | up | 8.30 × 10−18 |
| gmk | guanylate kinase | up | 1.14 × 10−17 | |
| upp | uracil phosphoribosyltransferase | up | 2.92 × 10−9 | |
| Two-component system | dnaA | chromosomal replication initiator protein | up | 1.11 × 10−17 |
| cpaB | Flp pilus assembly protein | down | 4.87 × 10−4 | |
| torS | TMAO reductase system sensor histidine kinase/response regulator | down | 1.79 × 10−3 | |
| Biofilm formation | rpoS | RNA polymerase sigma factor | down | 1.24 × 10−93 |
| oxyR | DNA-binding transcriptional regulator | down | 5.02 × 10−5 | |
| Quorum sensing | aroG | 3-deoxy-7-phosphoheptulonate synthase | down | 3.00 × 10−85 |
| cqsA | alpha-hydroxyketone-type quorum-sensing autoinducer synthase | down | 2.30 × 10−3 |
| Pathways | Gene | Gene Description | Regulate | p-Value |
|---|---|---|---|---|
| Nucleotide metabolism | deoA | thymidine phosphorylase | up | 2.26 × 10−20 |
| manA | mannose-6-phosphate isomerase type I | up | 1.80 × 10−17 | |
| xdhA | xanthine dehydrogenase small subunit | up | 2.50 × 10−9 | |
| Oxidative phosphorylation | frdA | fumarate reductase (quinol) flavoprotein subunit | up | 2.44 × 10−25 |
| frdD | fumarate reductase subunit | up | 8.31 × 10−24 | |
| ccoN | cytochrome C and quinol oxidase polypeptide I | up | 8.47 × 10−4 | |
| Two-component system | cheY | response regulator | up | 2.96 × 10−4 |
| mcp | methyl-accepting chemotaxis protein | down | 5.57 × 10−19 | |
| uhpT | hexose-6-phosphate:phosphate antiporter | down | 5.82 × 10−6 | |
| Flagellar assembly | flgF | flagellar basal body rod protein | up | 8.52 × 10−6 |
| ABC transporters | malE | maltose/maltodextrin ABC transporter substrate-binding protein | up | 3.50 × 10−62 |
| lolC | lipoprotein-releasing ABC transporter permease subunit | down | 6.04 × 10−4 | |
| phnD | phosphate/phosphite/phosphonate ABC transporter substrate-binding protein | down | 7.68 × 10−3 | |
| Quorum sensing | aroG | 3-deoxy-7-phosphoheptulonate synthase | down | 1.34 × 10−94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Qin, M.; He, Y.; Zhou, Y.; Zhang, P.; Li, C.; Zhang, S. Stringent Response Regulates the Persister Formation and Virulence of Vibrio splendidus. Microorganisms 2026, 14, 1278. https://doi.org/10.3390/microorganisms14061278
Qin M, He Y, Zhou Y, Zhang P, Li C, Zhang S. Stringent Response Regulates the Persister Formation and Virulence of Vibrio splendidus. Microorganisms. 2026; 14(6):1278. https://doi.org/10.3390/microorganisms14061278
Chicago/Turabian StyleQin, Meishan, Yuehui He, Yuanyuan Zhou, Peng Zhang, Chenghua Li, and Shanshan Zhang. 2026. "Stringent Response Regulates the Persister Formation and Virulence of Vibrio splendidus" Microorganisms 14, no. 6: 1278. https://doi.org/10.3390/microorganisms14061278
APA StyleQin, M., He, Y., Zhou, Y., Zhang, P., Li, C., & Zhang, S. (2026). Stringent Response Regulates the Persister Formation and Virulence of Vibrio splendidus. Microorganisms, 14(6), 1278. https://doi.org/10.3390/microorganisms14061278

